Перейти к содержимому

Схема лечения кальцивироза: кальцивироз кошек схемы лечения

Содержание

кальцивироз кошек схемы лечения

Кальцивироз кошек считается частым фактором болезней верхних дыхательных путей. Крайне чувствительны к вирусу котята и молодые усатые – этих набирается до 90% от числа заболевших кальцивирозом кошек.

Важно! Кошка-мама вакцинирована против кальцивирусной инфекции, то детки, пока кушают мамкино молочко, застрахованы от заражения, но только пока питаются материнским молоком.

Симптоматика болезни в прямой зависимости от возраста, здоровья, иммунитета. Кальцивироз кошек коварен для малышей, для взрослых со слабеньким иммунитетом, а так же для тех, кто ослаблен хроническими болезнями.

Симптомы кальцивироза кошек проступают внезапно. Со дня заражения до проявления первых симптомов минует 2-7 дней. 7- 25-ти дней продолжается активная фаза. Если лечение верно подобрано, то по истечении этого времени следует выздоровление

Взрослые кошки часто болеют без видимых признаков. А котята, наоборот, болеют тяжело.

Кальцивироз кошек, как и другие вирусные инфекции, зачинает появление с депрессивного состояния, насморка, выделений из глаз и аппетит пропадает.

Перегрев тела из-за повышенной температуры появляется на третий или четвёртый день, но у котят наступает тут же.

Характерные симптомы кальцивироза кошек:

  1. Питомец начинает чихать. Чихает 1-2 дня.
  2. Слизистые оболочки глаз начинают воспаляться.
  3. Из глаз потекли слёзы.
  4. Появился насморк.
  5. На 3-5 сутки болезни наблюдаются:

- Температура тела повышается, у котят доходит до 40-41 градусов.

- Наступает отказ от еды.

- По животному видно, что слаб.

- Уже из носа не течёт – густая слизь выходит. Из глаз не слезотечение, а гнойные выделения появились.

- Проблемы с дыханием из-за заложенности носа - дышит ртом.

Такого рода клиническая картина характерна массе бактериальных болезней, по этой причине на этом этапе определить болезнь затруднительно. Вот почему возможно упустить первый этап развивания агрессивного штамма, что влечёт к запущенной форме кальцивироза кошек со следующими из-за этого осложнениями и исходами.

Вслед за этим появляются типичные симптомы кальцивироза кошек:

  1. Возникает стоматит, дёсны начинают воспаляться.
  2. На нёбе ротовой полости и языке вначале возникают красные пятна, которые в дальнейшем сформируются в язвы. Так же возможно возникновение язв на носике и в носовой полости.

    Питомец кушает неохотно, так же мало пьёт. Совершает похожие на выпихивающий процесс языком, словно подавился, расчёсывает лапкой нос, покашливает и чихает. Дёсны больше воспаляются, отекают, иногда появляется белый налёт. Из ротика истекает запах не из приятных.


  3. Появляется слюноотделение в обильной степени.

На 3-4 день температура нормализуется. Развитие инфекции у котят и старичков способна перерасти в вирусную пневмонию, возникает одышка. Воспаление перебрасывается на трахею, бронхи и гортань.

Нетипичные симптомы кальцивироза кошек:

  1. Появление язвочек на теле.
  2. Суставы начинают воспаляться, что приводит к артриту. В следствии чего животное начинает хромать, видно, что больно ходить. По истечении времени это проходит.
  3. Редкие случаи появление язв в кишечнике и желудке

Те или иные симптомы, как правило, у владельцев и беспокойства не создают. Ну, кость грыз и поранился – вот и ранка появилась. Спрыгнул не удачно – поэтому прихрамывает. Тем паче, что у симптомов кальцивироза кошек возможны всевозможные сочетание.

Организм одолевает штамм вируса BC-FCV. К главным признакам присоединяются депрессивное состояние, мордочка и ноги отекают, слизистые желтеют. Так редко, но встречается.

Болезнь по продолжительности доходит до 10 дней, но случается, что на пару-тройку недель затянется. Питомец уже здоров, но продолжает источать вирус – значит заражать других усатых.

Пройдёт три-четыре месяца, а возможно и больше, интенсивность источения вируса падает. Половина усатых уже после 3-х месяцев прекращают быть источником вируса. Но часть усатых носители инфекции до конца жизни.

Только в осложнённых случаях животное погибает от кальцивироза кошек. И так из-за возникших осложнений – чаще пневмония и бактериальная инфекция.

Кальцивироз кошек способен перейти в хронический вид. Этому посодействуют – пониженный иммунитет, да кормят не правильно. Выражается в виде стоматита и воспаления дёсен. При появление этого вида болезни питомец проходит курс иммуномодуляторов – 1 раз в 3 месяца.

В редких случаях кальцивероз кошек тяжёлая инфекция. Попав в организм, вирус не довольствуется одними дыхательными путями. Кровеносные сосуды, печень, поджелудочная – вирус к ним беспощаден. Начинают возникать поражения внутренних органов, в результате появляются гепатит, панкреатит, а также кровотечения из носа и кишечника. Возможны отёчности лап и головы. При таком развитии инфекции гибнет 60% и больше усатых.

Калицивироз кошек - симптомы и лечение

Калицивироз - инфекционное заболевание кошек, характеризующееся поражением верхних дыхательных путей и образованием на слизистых оболочках ротовой полости эрозий и язв.

Калицивирус содержит одноцепочную РНК. На своей поверхности имеет чашевидную вдавленность - отсюда и название (calices - чашка).

Вирус попадает во внешнею среду с назальными, оральными, конъюнктивальными выделениями больных или переболевших животных. Во внешней среде при благоприятных условиях (температура, влажность) вирус сохраняется в течении недели. Заражение происходит при попадании вируса в организм кошки воздушно-капельным путем, при непосредственном контакте животных, через зараженные предметы и обслуживающий персонал.

Размножение вируса происходит в ротовой полости и в верхних дыхательных путях. Также вирус может проникать и поражать легкие, суставы, редко другие внутренние органы.

Лечение калицивироза в сети клиник ВЕТОСТРОВ

  • Своевременная диагностика позволяет начать профилактику вторичных осложнений этой инфекции.
  • Мы можем гордиться, что ни один кот с данным диагнозом не погиб при лечении в нашей клинике.
  • Иногда это заболевание протекает тяжело, и наш опыт позволяет назначать животным наиболее оптимальную схему лечения и восстановления.

Симптомы калицивироза кошек

Главным симптомом калицивироза является образование эрозий и язв на носу, губах, языке, деснах, твердом небе.

А также при этом заболевании отмечают:

  • подъем температуры тела,
  • вялость,
  • слабость,
  • отказ от корма,
  • истечения из глаз и носа,
  • слюнотечение,
  • чиханье.

Вышеперечисленные симптомы могут быть разными по силе или отсутствовать. При попадании в легкие вирус может вызвать пневмонию. У некоторых кошек может развиться стойкий фарингит. При поражении калицивирозом суставов появляется мышечная боль и хромота, которая может сохраняться длительное время без вышеописанных симптомов. Так же нужно отметить, что калицивирусная инфекция может вызывать хронический стоматит и гингивит.

Заболевание длится от 3 до 5 дней. При лечении в острой фазе заболевания прогноз наиболее благоприятный. При переходе заболевания в хронический процесс прогноз осторожный.

Диагностика заболевания

Диагноз ставится комплексно на основании клинических признаков и лабораторных исследований. Для лабораторных исследований у животного берутся смывы с мест поражений. Калицивирусную инфекцию необходимо дифференцировать от герпесвирусной инфекции, хламидиоза и микоплазмоза.  Сеть ветеринарных клиник Ветостров на Васильевском острове Санкт-Петербурга и наши специалисты окажут всю необходимую помощь вашему питомцу. Мы работаем круглосуточно.

Лечение калицивироза кошек

Специфического лечения калицивирусной инфекции нет. Основной упор делается на применение антибиотиков общего спектра действия для сдерживания вторичной бактериальной инфекции. В некоторых случаях используются противовирусные, иммуномодулирующие препараты. Назначаются местные обработки пораженных слизистых рта, носа и глаз. При отказе от еды и обезвоживании показаны подкожные или внутривенные инъекции жидкостей и витаминов. При поражении суставов применяются кортикостероиды в иммуносупрессивных дозах.

Профилактика болезни

Лучшая борьба с заболеванием - это его профилактика. Для профилактики калицивироза используется вакцинация по общепринятым схемам:
  1. Вакцинация в 8 недель.
  2. Вакцинация через 3-4 недели.
  3. Ревакцинация через 12 месяцев и далее 1 раз в год.

Вакцина против калицивироза входит в состав комплексных вакцин для кошек, наиболее известные из которых - PUREVAX и Tricat Trio.

Кальцивироз у кошек схема лечения

Любашин блог

ВДОХНОВЛЯЮ ❤ РАДУЮ ❤ ПОМОГАЮ

Кальцивироз у кошек, лечение, симптомы, прогноз

Кальцивироз кошек — это опасный вирус, которому подвержены все кошки, не зависимо от породы и места проживания. Вирус коварный, агрессивный, имеет большое количество штаммов.

Заражение происходит через слюну, выделения из носа, глаз больного животного. Вирус довольно распространен.

Заболеванию подвержены и домашние животные, заражение которых может произойти через грязную обувь или одежду, даже руки человека, который контактировал с больной кошкой.

Для того чтобы обезопасить питомца необходима ежегодная вакцинация, однако заболеть может и привитый котик.

Для собак и человека вирус не опасен.

В данной статье я расскажу о симптомах кальцицвироза и распишу схему лечения кальцивироза в домашних условиях. Это схема прописана ветеринаром и проверена мной лично, если у вас есть вопросы, спрашивайте. Однако, данная статья не заменяет очного осмотра ветеринара. И помните, что положительный результат в лечении зависит от вас!

Кальцивироз симптомы, инкубационный период

Признаки кальцивироза

  • ярким признаком кальцивироза является появление язвочек в ротовой полости, так же на губах, носу, чаще всего на средней щели носика.
  • на первых стадиях заболевания питомец вялый, отказывается от еды
  • кот много спит
  • поднимается температура тела
  • могут увеличиваться подчелюстные лимфоузлы
  • отекает горло
  • может присутствовать неприятный запах изо рта
  • появляются выделения из носа и глаз, чихание
  • коту становится трудно дышать
  • кот может вести себя так, словно он подавился, кашлять, пытаться достать из рта невидимый предмет
  • может появится рвота и диарея
  • может пропасть голос
  • при осложнениях появляется хромота и поражение легких

Симптомы могут появиться не сразу, развиваться постепенно, какие-то могут быть ярче, какие-то слабее. Поэтому важна правильная и ранняя диагностика. Если картина яркая, симптомы выражены приступаем к лечению. Лечение составит из антибактериальной терапии, повышения иммунитета и смягчения симптомов. При правильном лечении тяжелое состояние снимается примерно за 5 дней, общий курс лечения и восстановления составляет две-три недели.

[2]

Схема лечения кальцивироза у кошек в домашних условиях

  • Антибиотик, например, цефтриаксон 1,0 г. Антибиотик разводим 5 мл новокаина 0,5%, делаем раз в сутки, в заднюю лапу. На кота 4,5 кг нам понадобится 1,3 мл готового препарата. Подробно о тонкостях разведения препарата и дозировках можно прочитать в этой статьей: Цефтриаксон для кошек и собак
  • Фелиферон Первые три дня делаем по 1 мл в заднюю лапу, 1 раз в день. Затем по 0,5 мл, в заднюю лапу, так же 1 раз в день — длительность 4 дня.
  • Витамин С дозировка 0,5 мл, в этот же шприц 5% глюкоза 10 мл. Делаем в холку 5 дней
  • При сильном обезвоживании, если животное слабое, не пьет и не ест делаем раствор Рингера Локка. По 20 мл два раза в день. Возможно больше, до 100 мл в день, перерывами, возможно введение за один раз. Делаем в холку.
  • Болтушка для рта, та самая болтушка, из аптеки. Её используем для заживления язвочек, минимум 4-5 раз в день по 1 мл вводит шприцем без иголки в рот. Так же наносим на язвочки, если они есть на носу, губах и других местах. Нанесение данного лекарства возможно и чаще, каждый час-два. Примерно 5 дней, к этому моменту все язвочки должны пройти. Возможно кот будет справляться, будет пена, чихание, это нормальная реакция. Если животное в плохом состоянии, но сопротивляться не будет, однако, по мере выздоровления сопротивления будет всё больше. Важно не бросать и доводить всё до конца, иначе болезнь может вернуться.
  • Постоянная обработка мирамистином или хлоргексидином. После каждый еды обязательно обеззараживаем. И наносим болтушку.
  • Локсиком — на корень языка по 0,2 мл — 1 раз в день, на 3 дня.

Уход за кошкой во время болезни

Кошка ослаблена, сейчас для выздоровления важно хорошее, легкоусвояемое питание, например, куриный бульон или детское питание (индейка, курица, говядина), возможны специализированные корма, для больных, ослабленных животных, обязательно в форме паштета. Пища должна быть мягкой, теплой. Если кот не ест сам, кормить необходимо насильно. Вводим питание через шприц без иглы. Обязательно поить животное.

Кошке необходимо обеспечить тихое, спокойное место для сна, хорошее питание, полное, своевременное, правильное лечение и конечно же окружить питомца любовью и заботой.

Кошка должна находится в чистом помещении, где нет пыли.

Миски моем с хлоргексидином после каждого приёма пищи

Если в семье есть другие кошки, то необходим карантин, нельзя допускать общение, у заболевшей кошки должны быть отдельные миски, отдельное место для сна. Исключаем все контакты со здоровыми котами.

Прогноз при кальцивирозе, осложнения

Выздоровление зависит от нескольких факторов:

  • состояние иммунитета
  • наличие прививок
  • постановка правильного диагноза и назначение адекватного лечения
  • общее состояние животного

И самое главное:

  • действия хозяина, выздоровление будет зависеть от того, насколько точно, усердно и полно хозяин будет лечить своего питомца. Важно не пропускать прием лекарств, не давать животному голодать. При тяжелом течении кальцивироза будьте готовы к тому, что 3-4 дня кота буквально необходимо держать на руках, постоянная санация полости рта, прием лекарств, уколы, кормления. Если всё будет сделано правильно, то прогноз положительный. И вероятность, что животное выживет очень высока. Всё зависит от вас!
  • Избежать осложнений поможет правильное лечение, которое довели до конца. Кальцивироз заболевание коварное, поэтому увидев первые улучшения, лечение прекращать нельзя, обязательно проходим весь курс антибиотиков, вылечиваем все язвочки, поднимаем иммунитет.

Кальцивироз у привитого кота

Да, привитые животные могут заболеть кальцивирозом. И не всегда заболевание проходит в скрытой или легкой форме. В таких случаях у хозяев возникает вопрос — а стоит ли делать прививку от кальцивироза. Однозначно да! В большинстве случаев прививка защитит питомца от болезни. Часто при заражении болезнь пройдет спокойно, без каких-либо последствий. Симптоматика может быть более выражена, что поможет поставить диагноз и начать лечение.

Кальцивироз фото

Это интересно:

Цефтриаксон — препарат III поколения из группы антибиотиков “Цефалоспорины” Цефтриаксон, это недорогой, эффективный и довольно…

Сумка для прогулки с собакой на пояс Небольшая и удобная, для активных прогулок, положить…

Прошу совета по обострению хронического кальцивироза у кота

Добрый день! Прошу помощи и совета по такой ситуации. Есть кот примерно 7 лет от роду (взят 3 года назад с передержки, так что возраст предположительный). Кот домашний любимый, живет исключительно в квартире в компании другой кошки, два последних года не прививался из-за обострений вирусняков. Носительство кальци и рино подтверждено трижды методом ПЦР, также сдаем титры на корону мтодом ИФА раз в 6-9 месяцев, титры при каждой пересдаче исправно падают вдвое на протяжении 3 лет, ПЦР на коронавирус всегда отрицательный (сдавали раз 6-7). У кота периодически весной-осенью «выстреливает» ринюшник, но всегда в относительно легкой форме. А сейчас вот вылез кальцивироз. До этого был очередной месячный заход по лечению гингивита, десны красные, кровоточивость. Лечились как обычно — с переменным успехом. Пошли вчера с котом к вету, показать один подозрительный зуб — зуб тут же на месте удалили, он на волоске висел. Попутно врач разглядела глубоко на корне языка язвочку. Прописала антибиотик и иммуномодулятор, антибиотик — амоксоил по весу, по 0.7 мг через день 4 раза, один раз уже уколола прямо в клинике, остальные три шприца с собой дала. Иммуномодулятор оставила на мой выбор. Я обычно кота колю раз в полгода форветом и гамапреном, хотя к форвету отношение неоднозначное, я в курсе.

Сейчас сомневаюсь. Надо ли оставлять антибиотик широкого действия — амоксоил? Кот исправно ел и ест, настроение у него отличное, бодр и весел, кошку по квартире гоняет и цветы объедает — обычный кот, как всегда. Выделений из глаз и носа нет и не было, температура нормальная. Но десны красные, зубы слабые, кровоточивость периодически усиливается. А теперь вот и язва на языке обнаружилась. Все-таки — как лучше сейчас полечить кота?

Десны до этого я обрабатывала мирамистином 2 недели, потом на Дентавидин перешла — побоялась долго мирамистин использовать. Врач посоветовала Зубастик вместо Дентавидина — от Зубастика кот конкретно озверел и почти не дается его брызгать.

Да, у нас еще и печень по анализам на ахти, АЛТ завышена, гепатовет уже почти месяц даю по весу, 2 раза в день. Неохота на фоне проблем с печенью еще и антибиотик колоть. Прошу совета для кота с нежным и проблемным здоровьем.

Только зарегистрированные пользователи имеют возможность начинать новые темы. Зарегистрируйтесь и войдите на сайт, введя свои логин и пароль справа в окне, и Вы сможете начать новую тему.

Прежде чем задать вопрос на форуме, ознакомьтесь с темой: «Как правильно задать вопрос вет.врачу», а также со списком ответов на часто задаваемые вопросы, это поможет Вам сэкономить Ваше время и быстрее получить ответ на Ваш вопрос.
Обратите особое внимание на документ: Симптомы заболеваний животных. Возможно, в Вашей ситуации нельзя ожидать ответа на форуме, а нужно срочно вызывать врача или везти животное в ветеринарную клинику!

Прежде чем задать вопрос на форуме, ознакомьтесь со следующими разделами, это поможет сэкономить Ваше время и быстрее получить отсвет на ваш вопрос:

Внимание!

Обратите особое внимание на документ «Симптомы заболеваний животных». Возможно, в Вашей ситуации нельзя ожидать ответа на форуме, а нужно срочно вызывать врача или везти животное в ветеринарную клинику!

Кальцивироз у кошек и котов — симптомы, признаки, лечение и профилактика

Кальцивироз у кошек и котов – это респираторная контагиозная болезнь, вызывающая воспалительные изменения в верхних дыхательных путях, полости рта и конъюнктиве глаз. Возбудитель – РНК-содержащий вирус (род Vesivirus) из семейства Caliciviridae. Инфекционный агент не имеет собственной оболочки, обладает способностью размножаться внутри клетки, индуцирует образование специфических вируснейтрализующих антител.

Первым определил и описал вирион в 1957 году американский вирусолог Фостьер. Вирус малоустойчив во внешней среде, в условиях умеренной влажности сохраняет патогенные свойства до 10 суток, в сухой почве – не более 2 – 3 дней, чувствителен к высоким температурам (в течение получаса погибает при температуре 50 градусов), формальдегиду и раствору хлорной извести. Не теряет своей активности при действии кислых сред, хлороформа, эфира.

Восприимчивость

Заболевание распространено во многих странах мира. Кальцивирозу подвержены кошки всех возрастных групп и пород. Наибольшая восприимчивость к инфекции отмечается у котят до трёх месячного возраста. У них она протекает остро, очень агрессивно, быстро приводит к летальному исходу. Для взрослых кошек характерен переход болезни в хроническую стадию.

Факторами риска являются сниженный иммунитет после других, недавно перенесенных инфекций, и не правильно проведенная вакцинация или её отсутствие.

При изолированном домашнем содержании кальцивироз у котов встречается довольно редко. Количество случаев заболевания среди животных, содержащихся в питомниках и приютах, значительно выше. Максимальная циркуляция возбудителя инфекции регистрируется осенью и зимой.

[3]

Пути передачи

Основным источником кальцивироза служат больные животные, особи в стадии выздоровления (в течение длительного времени выделяют вирус в окружающую среду), здоровые носители. Чаще всего вирус попадает в организм воздушно – капельным путём (через заражённый воздух), алиментарным путём (через рот, при употреблении инфицированной воды и пищи), реже при контакте с вещами, на поверхность которых попали инфицированные выделения из глаз, рта, носа.

Ещё одним из способов, как передается кальцивироз, является проникновение возбудителя в организм плода от матери через плаценту.

Механизм развития болезни

Размножение вируса происходит в цитоплазме клеток слизистой ротовой полости, верхних дыхательных путей, конъюнктивы, что приводит к их дистрофии и гибели. В местах внедрения инфекции образуются группы пузырьков (везикул) с прозрачным содержимым, содержащим вирус. При лёгком надавливании оболочка жидкостных образований разрушается, обнажая кровоточащие язвы.

Инфицированное содержимое везикул, попадая на другие участки слизистой, вызывает появление новых поражений. Возбудитель кальцивироза может поражать легочную и почечную ткань, синовиальную оболочку суставов.Повреждённые участки эпителия часто становятся входными воротами для патогенной микрофлоры — бактерий, вирусов, микоплазм, хламидий. Вторичная инфекция осложняет течение заболевания и в большинстве случаев приводит к смерти животного.

Инкубационный период кальцивироза (период от попадания вируса в организм до развития заболевания) составляет от нескольких суток до 19 дней.

Признаки и симптомы

В зависимости от того, сколько длится кальцивироз, выделяют острую и хроническую форму заболевания.

Острая форма

Начальные признаки и симптомы кальцивироза у кошек выражаются общим недомоганием, отказом от пищи, чиханием, кратковременным повышением температуры. У животного появляется конъюнктивит, серозные выделения из носа и глаз, усиливается слюноотделение. В полости рта, на языке, в носовых ходах, на губах, кончике носа образуются язвы.

При не осложнённом течении болезни, вовремя назначенном лечении, хорошем иммунитете инфекция проходит в течение 1 – 2 недель. Наличие сопутствующей патологии, низкий иммунный статус, присоединение вторичной инфекции приводит к распространению патологического процесса на другие органы и системы, более длительной терапии (средний курс 3 – 4 недели) и даже к летальному исходу.

Частым осложнением кальцивироза является прогрессирующая интерстициальная пневмония. Болезнь сопровождается высокой температурой, глубоким, мучительным, влажным кашлем, одышкой, тяжёлым общим состоянием, учащением сердечных сокращений. В лёгких выслушиваются хрипы. У некоторых кошек воспаляются суставы, конечности опухают. Из-за выраженных болевых ощущений, животные начинают прихрамывать или вовсе отказываются ходить. Проникновение вируса в центральную нервную систему сопровождается судорогами.

Хроническая форма

У взрослых кошек чаще встречается хронический кальцивироз. Заболевание имеет стёртую клиническую картину, протекает длительно. В период относительной ремиссии отмечается сниженный аппетит, вялость, повышенная температура, плохая прибавка веса или её отсутствие, быстрая утомляемость, неустойчивый стул.

Фаза обострения характеризуется подъемом температуры тела, появлением выделений из глаз и носа, изъязвлений на слизистой рта и в носовой полости, отказом от пищи, вяло текущими бронхитами и пневмониями. В ряде случаев развивается инфекционно – аллергический процесс в почках и суставах, что сильно затрудняет лечение кальцивироза у кошек.

Больные животные являются вирусоносителями на протяжении длительного времени, постоянно выделяют вирус в окружающую среду. Прогноз неблагоприятный, инфекция приводит к полному истощению организма и смерти.

Особенности течения болезни у котят

Кальцивироз у котят в возрасте от одного до трёх месяцев начинается молниеносно и имеет крайне тяжёлое течение. Инфекционный процесс характеризуется яркими катаральными явлениями, частым развитием осложнений (бронхит, пневмония, гнойный конъюнктивит, расстройство стула). Выраженный отёк слизистой ротовой полости, боль, вызванная язвами на языке, твёрдом и мягком нёбе, приводят к затруднению сосания и глотания, полному отказу от пищи, воды. Котёнок быстро обезвоживается, резко теряет в весе, спустя несколько дней от начала заболевания умирает.

Диагностика

При постановке диагноза принимаются во внимание наличие контакта с больным животным, особенности начала заболевания, состояние здоровья питомца до первых проявлений болезни. Ветеринар проводит углублённый медицинский осмотр, оценивает общее состояние кошки, работу различных органов и систем. Делается общий и биохимический анализ крови, анализ мочи. Полученных данных достаточно для постановки предварительного диагноза.

Окончательный диагноз ставится только после идентификации возбудителя. Для диагностики инфекции используют метод ПЦР (выявляет наличие в крови, глазной, носовой жидкости антигена), реакцию иммунофлюоресценции (РИФ) — определение специфических антител в сыворотке крови.

Очень информативным является метод парных сывороток. В этом случае забор крови для исследований проводится в начале заболевания и через 14 дней. Рост титра (количества) антител свидетельствует об остром течении заболевания. При появлении хрипов в лёгких делается рентген грудной клетки.
В особо сложных ситуациях проводится биологическая проба и посмертное исследование органов.

Как и чем лечить кальцивироз у котов и кошек знает только ветеринарный врач. Без должного опыта и наличия медицинского образования принимать решения в таких вопросах не рекомендуется – это может привести к тяжёлым осложнениям и смерти питомца.

То, сколько лечится кальцивироз, зависит от возраста кошки, состояния иммунитета, наличия сопутствующей патологии. Курс терапии при лёгком течении заболевания рассчитан на одну – две недели, при наличии осложнений — на 3 – 4 недели. Лечение при переходе процесса в хроническую стадию может длиться месяцами.

Комплекс препаратов подбирается с учётом всех имеющихся симптомов, общего состояния больного животного. Обычная схема лечения кальцивироза у кошек в домашних условиях включает:

  1. Введение поливалентных иммуноглобулинов (Глобфел — 4, Витафел — C), содержащих антитела к кальцивирозу, панлейкопении, хламидиозу и инфекционному ринотрахеиту и гипериммунных сывороток по схеме, назначенной ветеринаром.
  2. Подкожные или внутримышечные инъекции иммуномодуляторов.
  3. Внутримышечное введение антибактериальных препаратов широкого спектра действия.
  4. Антигистаминные препараты, поливитамины.
  5. Обработка ротовой полости антисептическими растворами 2- 3 раза в сутки.
  6. Промывание глаз и очищение носа от корок три раза в день специальными средствами с последующим закапыванием по 1 – 2 капли лекарственного препарата, назначенного ветеринаром, в каждый глаз или ноздрю.
  7. Сбалансированное диетическое питание.
  8. Создание комфортных условий содержания, надлежащий уход.

При первых признаках обезвоживания организма назначается внутривенное или подкожное введение физиологических растворов — Рингера, 0,9 % натрия хлорида, 5 % глюкозы несколько раз в сутки. Объём жидкости рассчитывается на килограмм веса, все манипуляции проводит врач. Для поддержания сердечной деятельности назначают сульфокамфокаин, с целью нормализации работы печени – эссенциале. Дозировка и способ введения лекарственного средства определяются ветеринаром.

Такие инфекционно — аллергические последствия кальцивироза у кошек, как гломерулонефрит, полиартрит плохо поддаются лечению и требуют наблюдения в динамике.

Тяжелее всего кальцивироз протекает у котят. В этом случае терапия должна начинаться незамедлительно. Помимо специфических, антибактериальных и симптоматических средств котятам назначается капельное введение жидкости (с целью дезинтоксикации, борьбы с обезвоживанием, поддержания жизненно важных функций организма).

Профилактика

Для профилактики недуга используются поливалентные вакцины, защищающие сразу от нескольких инфекций — панлейкопении, кальцивироза, хламидиоза, ринотрахеита. К ним относятся «Мультифел – 4», «Fel-O-Vax» (Феловакс) и другие. Вакцинация проводится клинически здоровым особям. Противопоказанием к введению препарата является лактация, беременность, повышенная чувствительность к одному из компонентов.

Животные подлежат ревакцинации один раз в год.

После перенесенного заболевания у кошек в течение полугода сохраняется иммунитет.

Опасность для человека

Инфекция не представляет угрозы для человека. Однако не зависимо от того, опасен ли кошачий кальцивироз для человека или нет, при выявлении болезни у питомца необходимо проконсультироваться с ветеринаром. Только специалист сможет точно поставить диагноз и определить вероятность заражения в каждом конкретном случае.

Ухаживая за животным, больным кальцивирозом, необходимо соблюдать правила личной гигиены (использовать специальную одежду, перчатки, дезинфицирующие средства), проводить текущую дезинфекцию помещения.

Лечим кальцивироз у кошек в домашних условиях: симптомы, последствия и схема лечения

Кальцивироз – это серьёзное и широко распространённое инфекционное заболевание кошек. Без должного лечения от этого заболевания животные погибают.

Признаки кальцивироза у кошек

Видео удалено.

Видео (кликните для воспроизведения).

Язвы в ротовой полости — первый признак кальцивироза

Характерным признаком болезни является появление язв в ротовой полости, на языке и носовом зеркальце. Если по какой-то причине совершенно нет возможности обратиться в клинику для необходимого лечения, а помочь животному хочется, можно попробовать улучшить состояние дома.

Высокая температура у кошки — первый признак начинающейся инфекции!

Кальцивироз, как и другие вирусные инфекции, проявляется неспецифическими и специфическими симптомами.

Неспецифические симптомы всегда возникают в виде повышенной температуры (животное горячее на ощупь), отказом от корма, вялостью, слабостью, апатией. Кошка может прятаться в тёмные и отдалённые места.

Специфические симптомы – это те самые язвы, о которых сказано выше, а также может наблюдаться увеличенное выделение слюны, которая выливается из ротовой полости и пачкает подбородок.

Гиперсаливация (увеличенное количество слюны) связано с воспалительным процессом во рту. Также появляются истечения из глаз и носа, сопровождающиеся чиханием. Кошка может кашлять.

Гиперсаливация у кошки

Иногда наблюдается суставная форма инфекции – в этом случае кошка хромает, область поражённого сустава болезненная.

Болезнь может проявляться любой комбинацией вышеперечисленных симптомов. Однако очень часто вирусная инфекция длительное время может «выражать» своё присутствие лишь язвами на слизистых оболочках.

Более того, кальцивирусная инфекция может протекать в комбинации с другими вирусными заболеваниями, вследствие чего наслаиваются другие симптомы, например, понос или рвота. Не исключён вариант развития вторичной бактериальной инфекции вследствие ослабления иммунитета, что может приводить к пневмониям.

Схема лечения кальцивироза у кошек

Начальная стадия кальцивироза

Подход к лечению кошек с кальцивирозом очень сильно зависит от состояния животного и давности процесса. Кошки, которые больны уже давно, могут погибнуть от истощения. Тяжело переносят инфекцию молодые животные, особенно такие, которые только лишились материнских антител.

[1]

Ослабленные животные нуждаются в инфузионной терапии для улучшения состояния.

Поставить капельницу коту в домашних условиях не получится. Также животных нужно принудительно кормить, так как длительное голодание для кошек очень опасно . Курс антибиотиков поможет предотвратить развитие вторичной инфекции. Разные поддерживающие препараты помогут организму легче перенести болезнь и пойти на поправку.

Если же возможности обратиться в клинику нет никакой, а животное в тяжёлом состоянии, шансов на выживание у него практически нет . Если же состояние кошки довольно стабильно, можно попробовать побороться с инфекцией.

Принудительное кормление и борьба с обезвоживанием

Если кошка не ест, необходимо поставить ей капельницу

Прежде всего необходимо не забывать о принудительном кормлении. Корм нужно выбрать наиболее питательный и мягкий, для этой цели подойдут паштеты, которые используются для ослабленных животных. Они высококалорийные и их удобно задавать животному через рот.

В качестве борьбы с обезвоживанием вместо капельницы можно вводить подкожно растворы.

Это ни в коей мере не заменит капельное введение, однако какой-то эффект позитивный может оказать. С этой целью используют растворы натрий хлорида, рингера, глюкозы . Дозировка зависит от веса и состояния животного, и может колебаться от 5 до 20 мл в сутки, а то и больше. Большие объёмы можно разбивать на несколько подходов. Вводятся растворы в холку – так называется область над лопатками, где наиболее эластичная кожа.

В случае высокой температуры ни в коем случае нельзя давать кошкам препараты из собственной аптечки – можно только сделать хуже, а то и вовсе вызвать отравление. Нужно помнить, что парацетамол кошкам нельзя категорически . Лучше всего использовать для этой цели ветеринарные препараты. При этом важно знать какая именно температура у животного. Температура измеряется ректально. Не обязательно для этой цели иметь электронный градусник, ртутный тоже подойдёт, но держать его придётся подольше.

Боремся с инфекцией в глазах и в носу

Кальцивироз на носу и глаза

Нужно бороться с инфекцией в глазах и носу. С этой целью используются капли, например, Тобрекс или что-то на основе Ципрофлоксацина .

Использовать капли с гормонами нельзя – кортикостероиды понижают иммунитет, а кошке с вирусной инфекцией он крайне необходим.

Перед закапыванием нужно очистить носовой проход и глаза. Промывать нос и глаза можно обычным физраствором (тем самым натрий хлоридом, который вводится подкожно) со шприца под напором, убирая выделения салфеткой или тампонами.

Промывать рот хлоргексидином лучше не стоит – он очень горький, а кошки крайне чувствительны к горькому вкусу. Для санации ротовой полости прекрасно подойдёт отвар ромашки, приготовленный по стандартной инструкции на упаковке.

Длительность курса лечения кальцивироза

Длительность курса зависит от того, насколько ослаблена кошка и как сильно у неё проявляются симптомы, от силы иммунитета, возраста и многих других факторов. Это очень индивидуально, поэтому если браться за лечение кошки, нужно запастись терпением.

Грубо говоря, лечение должно проводиться до исчезновения последних симптомов.

Видео о выявлении кальцивироза у кошки

Заключение

Приведённая схема лечения не является 100% гарантией излечения животного. Для качественной борьбы с кальцивирозом необходима консультация с ветеринарным врачом. Эта информация о лечении приведена лишь для случаев крайней нужды. Помните: лучшее лечение – это профилактика. Прививайте животное раз в год комплексной вакциной, и в промежутке между вакцинациями кошка будет полностью защищена.

Кальцивироз у кошек – симптомы, лечение и советы владельцам

Евгения Михайлова • 25.06.2018

Кальцивироз у кошек – это вирусное заболевание, поражающее преимущественно дыхательные пути. Болезни подвержены котята старше 5-6 недель, однако, и у более молодых животных может встречаться вирусная инфекция. Особенно ей подвержены кошки при скученном содержании – приюты и питомники. Большой риск взять больное животное, если котенок приобретается у продавцов, занимающихся приемом и перепродажей котят на птичьем рынке или в переходах. Отсутствие дезинфекции приводит к тому, что клетки и коробки пополняются испражнениями животных. Передача вируса происходит почти постоянно.

Заболевание кальцивирозом у кошек наступает резко, активная форма может длиться 7-25 дней, после чего животное при правильном лечении выздоравливает. Риски гибели молодых непривитых животных зависят от времени, прошедшего от первых клинических симптомов до установления кальцивироза и начала активного лечения. При своевременно начатой адекватной противовирусной и поддерживающей терапии смертность среди непривитых кошек и котят по разным источникам колеблется от 15 до 30% об общего числа заболевших.

В литературе можно встретить разные написания заболевания: кальцивироз, калицивироз и даже кальцивирус. Все они употребляемы в мировой ветеринарной практике. Трактовки связаны с разночтением латинского названия.

Кальцивироз у кошек для человека безопасен. Болезнь является видоспецифической и не передается собакам, людям, мелким грызунам. Другие представители семейства кошачьих, к сожалению, очень подвержены этому вирусу.

Причины кальцивироза у кошек

Заболевание вызывает вирус Feline calicivirus. Шаровидный вирион имеет диаметр 38—40 нм. Вирус устойчив к повышенной температуре, сохраняется во влажной среде. В сухое время года вирус хранится в течение 2-3 дней, во время слякоти и снега при температуре от -3 до +10 градусов он выживает до 10-12 дней. Большинство дезинфицирующих средств не действуют на него, из-за этого повышается риск переноса вируса из помещений, где содержится заболевшее животное.

Заразиться здоровая кошка может несколькими путями:

  1. При прямом контакте с носителями кальцивироза. Опасность в том, что не всегда владелец кота или кошки осведомлен, что животное является вирусоносителем. Вязки с таким питомцем, передача в зоогостиницу, поездки в общественном транспорте повышают риски распространения вируса на других кошачьих.
  2. От больных калицивирозом кошек. Это случается в инкубационном периоде или в начале заболевания, когда клинические симптомы не так явно выражены. Животное с чиханием или слезотечением выделяет клетки, пораженные вирусом. При попадании на слизистые оболочки других кошек происходит заражение.
  3. В приютах и питомниках, где на одной территории содержится много животных. Заражение происходит через лотки, миски для корма и воды. Достаточно одного носителя вируса, чтобы животные перезаражались.

Вирус не может сохраняться долго вне организма животного. Предельный срок выживания пораженных вирусом клеток зафиксирован в течение 18 дней. Это стоит учесть владельцам, которые планируют взять кота после гибели от кальцивироза предыдущего.

Признаки кальцивироза у кошек

Как и другие заболевания, кальцивироз у кошек начинается с угнетенного состояния, истечения из носа или глаз, отказа от еды. О том, как промывать глаза, мы писали ранее. Температура повышается сразу, но иногда гипертермия наступает на 3-4 день. Рвота может быть неукротимой, единичной или отсутствовать. Диагностировать по таким признакам заболевание тяжело. Кальцивироз кошек опасен тем, что на начальной стадии, когда необходимо распознать заболевание и начать интенсивное лечение, он может маскироваться под другие болезни.

Еще большая проблема правильно поставить диагноз животному, которое имеет свободный выгул на улице. В это время кошка может съесть что-то токсическое, например, отравленную мышь, и начальные симптомы будут проявляться в виде угнетения и отказа от корма.

Характерным признаком являются небольшие язвы на языке, небе, губах и носу. Они могут не появляться в первые дни болезни и быть единичными. Нередки случаи, когда язва маленькая и списывается на раздражение от носовых истечений. Случается, что на этом этапе животному ставится диагноз ринотрахеит, которых проходит с меньшим масштабом осложнений.

После язв появляется затрудненное дыхание – болезнь дает осложнения в виде пневмонии. Нередки воздействия вируса на опорно-двигательную систему. Может появляться артрит.

Первое, о чем спросит ветеринарный врач во время осмотра, это наличие прививок против инфекционных заболеваний кошек. Если их нет, то исключать кальцивироз нельзя.

Что должно стать тревожными симптомами для владельца:

  • кошка отказывается от еды, хотя в течение последних дней не переедала и не ела непривычной пищи;
  • у нее поднялась температура – измерить ее – это первое, что требуется сделать, если животное отказалось от еды;
  • кошка тяжело дышит, старается вытолкнуть языком изо рта несуществующую помеху;

Признаки могут появиться задолго до язв и истечений. Совпали все три? Не откладывайте визит в ветеринарную клинику.

Не забудьте рассказать врачу, если случилась одна из ситуаций:

  • кошка полизала химические средства для чистки сантехники или стиральный порошок. В некоторых случаях животные испытывают патологическую тягу к веществам;
  • в доме есть растения, которые кошка пожевала – многие из них являются токсическими, например, алоэ;
  • кошке досталась жирная и непривычная для нее пища;
  • животное купали накануне и плохо высушили;
  • в квартире работал кондиционер.

Если хоть один из пунктов имел место, то нельзя исключать и иных причин плохого самочувствия животного.

Диагностика заболевания проводится путем ПЦР-анализа, в ходе которого устанавливается, если ли вирусный код в ДНК кошки или нет. Отрицательный результат нельзя считать достоверным, нередко при проведении повторного анализа через несколько дней владельцы получают неутешительный положительный ответ. Если провести анализ невозможно, то диагноз ставят на основании клинической картины.

Лечение кальцивироза у кошек

Препараты, применяемые при лечении вирусных заболеваний кошек, можно разделить на несколько групп:

  • антибиотики – учитывая то, что вирус действует на дыхательную систему, подбираются соответствующие препараты. Неплохой эффект дает Амоксиклав. Многие врачи используют Цефтриаксон, Бицилин;
  • препараты, воздействующие на иммунную систему – это может быть ветеринарный препарат Ронколейкин или средство из аптеки для людей Циклоферон;
  • противовирусные препараты местного действия – например, ветеринарный Максидин в виде капель в нос;
  • поддерживающая терапия – внутривенные инфузии Глюкозы, Раствора Рингера, Витаминов. Животному, теряющему жидкость из организма с истечениями и от высокой температуры, необходимо ее восполнять для избегания обезвоживания.

Из народных средств может использоваться ромашковый чай. Он обладает противовоспалительным свойством и помогает почкам при выводе продуктов распада.

Неплохо себя зарекомендовала сыворотка из крови гипериммунизированных животных Витафел. Она вводится с лечебной целью животным, имеющим признаки заболевания, и в качестве профилактики котам, контактировавшим с больными. Препараты используются при лечении кальцивироза у котят и взрослых животных. Схему лечения и дозировку средств подбирает доктор.

Кальцивироз у беременных кошек

Кальцивироз у беременных кошек опасен вдвойне: добавляется опасность рождения неполноценного потомства или самопроизвольного аборта. Решение о назначении препаратов животному «в положении» принимает только ветеринарный врач. Он обращает внимание на срок беременности, характер и степень запущенности заболевания, общее состояние. Некоторые виды антибиотиков могут применяться у беременных животных без риска для котят. Препараты подбираются врачом так, чтобы сохранить плоды, если это возможно.

Лечение кальцивироза кошек в домашних условиях не рекомендуется проводить самостоятельно, и уже тем более этого стоит избегать, если кошка беременна.

Советы владельцу кошек

Простые советы помогут избежать заражения вирусом кальцивироза у кошек. А если такое случилось, то помочь животному вылечится в максимально короткие сроки.

Последствия калицивироза у кошек

После полного курса лечение выздоровевшее животное приобретает относительный иммунитет к болезни. Повторное заражение встречается редко, но тем не менее, исходя из того, что случаи фиксируются, говорить о стойком иммунитете переболевших животных нельзя.

Чаще питомец после выздоровления не проявляет видимых симптомов. Однако, даже внешне здоровая кошка может быть опасна для других кошачьих. По результатам исследования британских ученых в течение первого месяца после окончания симптомов болезни все животные являются активными вирусоносителями. Их владельцам рекомендуется избегать посещения квартир, где есть непривитые кошки и, в особенности, котята первого года жизни. Также не стоит приглашать гостей, имеющих кошек, в квартиру, где находится вирусоноситель.

С течением времени активность выделения вируса снижается. Через два с половиной месяца опасными являются только 50% переболевших кошек. И только некоторые животные с особенно ослабленным иммунитетом могут сохранять носительство на протяжении жизни.

Единственным лабораторным методом, подтверждающим носительство кальцивироза, является ПЦР – полимеразная цепная реакция. Она позволяет обнаружить малые фрагменты вирусной ДНК в крови кошки. Если реакция положительна в течение года после окончания болезни, то нужно говорить о переходе заболевания в хроническую форму. Однако, сделать анализ могут не все владельцы.

Как убедиться, что кошка осталась носителем кальцивироза

В хронической форме он проявляется в виде неизлечимого стоматита и гингивита. У кошки образуется воспалительный процесс на деснах, который после терапии проходит на непродолжительное время. Нередко зубы выпадают даже у весьма молодого животного. Поскольку препарата, излечивающего кальцивироз, нет, то кошкам рекомендуется периодический курс ронколейкина и реаферона. Схема лечения с применением препаратов 3-4 раза в год под наблюдением врача позволит не развиться осложнениям в виде гломерулонефрита или хронической почечной недостаточности.

Видео удалено.
Видео (кликните для воспроизведения).

Вирусное заболевание проще предотвратить, чем лечить. Достаточно соблюдать сроки ежегодной вакцинации, чтобы животное не заболело или перенесло болезнь в легкой бессимптомной форме.

Источники


  1. Изилов, Ю. С. Практикум по скотоводству / Ю.С. Изилов. — М.: КолосС, 2012. — 184 c.

  2. Рабинович, М.И. Лекарственные растения в ветеринарии / М.И. Рабинович. — М.: Россельхозиздат, 1981. — 224 c.

  3. Ветеринарная фармация. — М.: Лань, 2011. — 512 c.
  4. Мишанин, Ю. Ф. Ихтиопатология и ветеринарно-санитарная экспертиза рыбы / Ю.Ф. Мишанин. — М.: Лань, 2012. — 560 c.
  5. Соторов, П. П. Справочник ветеринарного врача-ихтиопатолога: моногр. / П.П. Соторов. — М.: Росзооветснабпром, 2014. — 100 c.

Кальцивироз у кошек схема лечения

Оценка 5 проголосовавших: 1

Приветствую Вас на моем сайте. Я Ирина Ларионова. В настоящее время я уже более 10 лет работаю ветеринаром. Считаю, что являюсь специалистом в этом направлении, хочу помочь всем посетителям сайта решать сложные задачи с их любимцами.
Все данные для сайта собраны и тщательно переработаны с целью донести в удобном виде всю нужную информацию. Однако чтобы применить все, необходима обязательная консультация со специалистами.

Лечение кальцивироза у кошек - Ветеринарная клиника Vetstate

                                            Калицивироз (Feline calicivirus - FCV).

       Несмотря на широкое применение вакцинации, у кошек все еще довольно часто встречается такое инфекционное респираторное заболевание как калицивироз. Переболевшие животные после выздоровления долго выделяют вирус и являются источником инфекции для других кошек. Некоторые остаются пожизненно носителями калицивируса. Вероятно, носители и являются главной причиной, почему калицивирус так широко распространен. Болезнь чаще встречается там, где скученность кошек, например, питомники, приюты, зоомагазины и после посещения выставок, клиники и передержки. У данного вируса существует огромное количество штаммов.

      Естественный путь инфицирования назальный, оральный и конъюнктивальный. Передается через руки, одежду и общие предметы обихода.

       Патогномоничной особенностью этой инфекции является язвы в ротовой полости. Они начинаются как пузырьки, которые потом лопаются. Язвы заживают 2-3 недели. Поражение легких (пневмония) встречается редко и только при определенном вирулентном штамме. Также редко встречается инфицирование суставов – острый синовит.

Клинические симптомы ка калицивироза у кошек

       Из-за большого количества штаммов вируса, могут наблюдаться различные клинические признаки заболевания. Большинство штаммов вызывают характерные поражения респираторного тракта с повышением температуры. Некоторые штаммы способствуют хроническому гингивостоматиту кошек. Другие вирулентные штаммы способны вызвать тяжелое системное заболевание с высокой смертностью.

     

Ранними симптомами классического калицивироза обычно является вялость, повышение температуры, чихание, выделения из глаз и носа, как правило, возникают, но они слабо выражены. Наиболее характерным симптомом является язвы на языке, иногда задет нос и губы. Обильное слюнотечение начинается как следствие язв.

    

  Некоторые высоковирулентные штаммы могут вызывать пневмонию с сопутствующей одышкой.

       Особенностью некоторых штаммов является хромота и высокая температура (до 40-41 градусов). Кошка становится вялая, не запрыгивает высоко, отмечается хромота и редко отказ от еды. В большинстве случаев хромота проходит через 24-48 часов без поражений суставов. Также хромота редко встречается у котят после вакцинации от калицивироза живой вакциной.

       Вирулентное тяжелое системное заболевание калицивируса сначала начинается с симптомов классической формы калицивируса в легкой форме, затем начинаются системные проявления полиорганной недостаточности опасные для жизни. Могут быть отеки конечностей и морды, желтуха, поражение органов брюшной полости, нарушение дыхательной функции, коагулопатия (кровотечения). Смертность высокая.

Диагностика калицивироза у кошек

     

  Диагноз Калицивироз   ставят на основании характерных клинических симптомов, таких как язвы в ротовой полости и на носовом зеркале, слюнотечение, отсутствие аппетита и высокая температура.

       Подтверждают диагноз специфическим тестом – ПЦР смывов с ротовой полости и конъюнктивы. Через месяц после выздоровления, для выяснения носительства инфекции, берется смыв из ротовой полости. При 3-х кратном (с интервалом месяц) положительном результате животное является носителем (источником) инфекции и такое животное не должно находиться с другими кошками в приюте/передержке и т.п.

       К сожалению, не существует тест-систем на все штаммы калицивируса, поэтому результат ПЦР может быть и отрицательным.

Лечение калицивироза у кошек

       Симптоматическое лечение. Необходимо предлагать мягкую, теплую еду, чтобы запах привлекал кошку. Если прием пищи болезненный для кошки, то может потребоваться жидкостная терапия. В некоторых тяжелых случаях при длительной анорексии устанавливают пищеводный зонд. При наличии корочек в носовых ходах нужно очищать нос, чтобы кошке было легко дышать. Обрабатывать ротовую полость Хлоргексидидом 0,05% или гелем Стомадин. Для снижения температуры применяют ветеринарные нестероидные противовоспалительные средства не более 3-х дней. Антибиотики нужны для контроля вторичной бактериальной инфекции. Лечение должен назначать врач.

Профилактика заболевания

- вакцинация, которая защищает от клинических признаков болезни. Существуют живые и инактивированные вакцины, в составе которых только несколько штаммов калицивируса.

- вирус распространяется между остро инфицированными и восприимчивыми кошками, поэтому больных надо изолировать. Также носители калицивируса не должны находиться в одном помещении с другими кошками.

-вирус выживает в окружающей среде короткий период, около недели. В приюте/питомнике/передержке надо мыть клетки, лотки, посуду с дезинфецирующим средством (хлорка 1:32 частям воды).

-все кошки, допущенные в питомник, должны иметь плановые вакцинации. Котята вакцинированы 2-х кратно и заселяться не менее, чем через 7 дней после второй прививки.

Если у вашей кошки наблюдаются признаки калицивироза, то ветеринарные специалисты  ветеринарной городской поликлиники "VetState" помогут провести полную диагностику здоровья вашего питомца и вовремя оказать необходимые эффективные лечебные мероприятия.  

 Мы рады видеть вас 7 дней в неделю, 365 дней в году. Без праздников и выходных дней круглосуточно.

 За более подробной информацией Вы можете обращаться по многоканальному телефону

 8 (499) 704-08-74

8 (499) 372-08-74

Калицивироз кошек. Применение препарата Гамапрен

Некоторые штаммы вируса помимо размножения в слизистой ткани ротовой полости и верхних дыхательных путях имеют предрасположенность к размножению в ткани легких и суставах (были обнаружены внутри макрофагов (иммунные комплексы) в суставах) и других тканях висцеральных органов.

Наиболее частое место размножения вируса, определяющее наиболее узнаваемый симптом заболевания - в ротовой полости, начинается с образования небольших пузырьков (везикул), которые затем прорываются и образуются очаги воспаления и некроза эпителиальной ткани (с инфильтрацией нейтрофилов). К имеющейся вирусной инфекции может присоединиться бактериальная микрофлора, что значительно осложняет течение болезни и может привести к пневмонии.

Наиболее тяжело инфекция протекает у молодых котят и у кошек со сниженным иммунитетом.

Инкубационный период калицивироза составляет 2-6 дней. Неосложненная инфекция обычно протекает 14-21 день и в течение этого периода кошка выделяет вирус и представляет опасность для других кошек. Многие животные после перенесенной инфекции остаются носителями. Обычно состояние носительства длится в течение нескольких месяцев, но у некоторых животных может сохраниться и на всю жизнь. У носителей могут не проявляться или редко проявляться симптомы болезни, но они являются источником инфекции для восприимчивых кошек, в том числе кошки-носители могут заражать своих котят.

Смертность в некоторых случаях при тяжелом течении может достигать 60-70%.

Клинические симптомы калицивироза кошек

Обычно калицивироз считается менее опасной инфекцией, нежели герпесвирусный ринотрахеит, но из-за огромного количества штаммов заболевание может протекать с различными признаками и в разной степени тяжести (от острой до субклинической бессимптомной). Хронически и субклинически протекающее заболевание при стрессе может перейти в острое.

Наиболее частые и характерные симптомы заболевания:

- Язвы в ротовой полости, в том числе на языке, деснах, губах, а также поражается нос и носовая полость (иногда это единственный клинический признак)

- Лихорадка

- Конъюнктивит и блефароспазм

- Чихание

- Истечения из носа

- Стоматит

- Саливация

- Снижение аппетита (анорексия)

- Снижение активности

- Увеличение лимфатических узлов

При тяжелом течении:

- Одышка, затрудненное дыхание

- Пневмония

- Полиартриты и болезненная хромота

- Гломерулонефрит

- Полиорганная недостаточность

Диагностика калицивироза

Для диагностики заболевания необходим подробный анамнез, выявление клинических признаков и лабораторные исследования (ОКА, Б/Х, ПЦР).

Необходимо дифференцировать калицивироз от герпесвирусного ринотрахеита, хламидиоза, стоматитов, неоплазии, микоза в области носа.

ПЦР используется не часто, диагноз чаще ставится на основании клинических признаков, так как велик риск получения ложноотрицательных результатов (из-за изменчивости штаммов вируса). Также без клинических признаков серологические тесты могут дать положительный результат при носительстве и при наличии поствакцинального иммунитета.

Лечение и профилактика калицивироза

Для специфической профилактики используют вакцины. У котят, которых кошки кормят молоком, за счет иммунитета матери, эффективность вакцин может снижаться. Кроме того, из-за постоянно меняющихся штаммов, вакцина далеко не всегда работает и защищает.

Для неспецифической профилактики, при высоком риске развитии инфекции (при посещении мест массового скопления кошек (выставки), в питомниках, приютах) рекомендуется использовать Гамапрен. Препарат безопасен для здоровых животных при применении для профилактики, так как не вызывает гиперстимуляции иммунной системы. При угрозе заражения Гамапрен умеренно стимулирует работу собственного клеточного и гуморального иммунитета, что помогает в защите от вирусной инфекции.

Лечение

В комплексном лечении заболевания используют антибиотикотерапию (для подавления вторичной бактериальной инфекции), при необходимости назначают капельные инфузии растворов (часто с добавлением глюкозы и витаминных препаратов), и безусловно необходим эффективный иммуномодулятор и противовирусный препарат. Многие препараты не эффективны, так как стимулируют иммунную систему (после чего возможно развитие иммуносупрессии). В отличие от них Гамапрен имеет подтвержденное прямое противовирусное действие.

Механизм действия Гамапрена основывается на воздействии на один или несколько этапов жизненного цикла вирусов. В качестве действующего вещества в Гамапрене используется 0,5% водный раствор динатриевой соли фосфата полипренолов. Полипренилфосфаты могут связываться с вирионами вне клетки, препятствовать сорбции вируса на мембране клетки или выходу вирионов из клетки, нарушать репликацию и сборку вирусных частиц внутри клетки (в этом случае происходит выход дефектных вирусных частиц).

Гамапрен восполняет недостаток эндогенных фосфатов полипренолов, которые участвуют в биосинтезе иммуноглобулинов, интерферонов и цитокинов, клеточных рецепторов и поверхностных антигенов. Гамапрен нормализует функции иммунокомпетентных клеток, способствует стимуляции собственного клеточного иммунитета организма.

О воздействии полипренилфосфатов Вы можете ознакомиться в статье «Система изопреноидов. Роль в противовирусном иммунитете»

Схема применения Гамапрена

Перорально 2 раза в день в следующих дозах:

Масса животного До 0,5 кг 0,5– 2 кг 2– 5 кг Более 5 кг
мл 0,3 0,5 1 2

Лечение проводят в течение 5– 10 дней подряд. При необходимости может быть назначен повторный курс лечения с интервалом не менее чем 14 дней. Возможно подкожное или внутримышечное введение Гамапрена в тех же дозах.

Препарат очень удобен. Эффективно выпаивание (причем количество и вкусовые качества Гамапрена делают эту процедуру не сложной).

Также доказана эффективность использования Гамапрена для орошения и промывания ротовой и носовой полости совместно с оральным или пероральным применением, что ускоряет исчезновение клинических признаков. Что очень важно для борьбы с основным клиническим симптомом — язвами в ротовой полости.

На базе питомников и клиник было проведено много исследований на сотнях кошек.

Включение препарата Гамапрен в комплексную терапию калицивироза кошек приводит к значительно более быстрому выздоровлению. Исчезновение клинических признаков у кошек, которые получали Гамапрен, происходило раньше, чем у кошек, в схеме лечения которых Гамапрен не применялся. Промывание ротовой полости препаратом помогает быстрее устранить язвы, что приводит к улучшению самочувствия кошки, появлению аппетита.

Таким образом, Гамапрен при лечении вирусных инфекций способствует повышению эффективности терапии и ускорению сроков выздоровления.

Вирусные заболевания у кошек: лечение, симптомы

Вирусные инфекции у кошек встречаются достаточно часто, и могут приводить к смертельному исходу.


При этом диагностика таких патологий затруднена, а лечение не всегда производит нужный эффект. Поэтому владельцу нужно уделять особое внимание формированию эффективного иммунитета и профилактике вирусных заболеваний. В этом случае даже при заражении вирусом высока вероятность легкого течения заболевания и быстрого выздоровления.

Вирусные инфекции, чаще всего встречающиеся у кошек

Коты и кошки могут заразиться вирусными инфекциями:

  • При контакте с больными кошками, или животными-носителями вируса (без клинических проявлений патологии).
  • При совместном содержании здоровых и больных животных без непосредственного контакта (через посуду, клетки, подстилки).

Основные факторы риска, повышающие вероятность развития патологии — ослабление иммунитета, стресс, другие инфекционные заболевания.

Перечень вирусных заболеваний кошек обширен. Наиболее распространенные патологии:

  • Панлейкопения (кошачья чумка). Отличается высокой - до 95% заболевших — смертностью, может протекать в молниеносной форме. При остром течении поднимается температура тела, болезнь сопровождается рвотой. Поносом, поражением кожных покровов. Плохо поддается лечению.
  • Ринотрахеит — вызывается вирусом герпеса или другими вирусами. Сопровождается гнойными выделениями из носа или пасти, реже стоматитом. В перечень симптомом также включают кашель, боязнь яркого света или лихорадку.
  • Калицивироз — вирусная инфекция, поражающая дыхательные пути. На ранних стадиях страдают слизистые оболочки (анемичность, сухость, появление язв), при отсутствии лечения развиваются бронхиты или трахеиты.
  • Коронавирусный энтерит — патология, сопровождающаяся поражением кишечного эпителия у молодых кошек. Может протекать бессимптомно или без осложнений с формированием достаточно стойкого иммунитета. При острой форме наблюдается рвота. Вздутие живота или понос.

Это лишь краткий перечень вирусных заболеваний у кошек. В него также входят кошачий грипп, перитонит, коронавирусные инфекции и другие патологии.

Направления лечения вирусных заболеваний у котов

До недавнего времени эффективно лечить вирусные заболеваний у котов было невозможно из-за отсутствия действенных препаратов. Поэтому:

  • Основной упор в терапии делался на купирование опасных симптомов инфекции — это давало возможность организму самостоятельно справиться с возбудителем.
  • Особое внимание уделялось вакцинированию — кот, прошедший вакцинацию по календарю, получал эффективную защиту от большинства вирусов.

Сегодня, несмотря на наличие достаточно эффективных ветеринарных противовирусных препаратов, также не стоит пренебрегать вакцинацией. Вакцинировать нужно в первую очередь животных, которые активно контактируют с другими кошками — участвующих в выставках и живущих в частных домах с возможностью свободного выгула.

Для купирования симптомов и борьбы с вирусными инфекциями применяют такие препараты:

  • Гамавит
  • Витафел
  • Камедон
  • Максидин
  • Фоспренил
  • Иммунофан (иммуностимулятор) и др.

Эффективность применения противовирусных препаратов зависит от точности диагностики заболевания, а также стадии развития, на которой было начато лечение. Поэтому владельцам котов и кошек нужно тщательно следить за состоянием здоровья питомцев, и при появлении подозрительных симптомов вовремя обращаться к ветеринару. Даже если симптомы не будут вызваны воздействием вируса, вовремя начатая терапия быстрее принесет результат.

Кальцивироз у кошек - проявления, пути передачи и инкубационный период, как лечить и опасность для человека

Кошки – домашние любимцы, ведь они очень ласковые, дружелюбные и игривые животные, которые, однако, подвержены заболеваниям. В случае необходимости человек должен следить за здоровьем своего питомца. Кальцивироз у кошек – распространенное вирусное заболевание, которое способно поражать дыхательную систему, сопровождается такими симптомами, как лихорадка, слезотечение, конъюнктивит, язвы во рту, на языке и носу. Если болезнь вовремя не диагностировать, то развивается артрит и пневмония, в запущенных случаях возможен летальный исход.

Что такое кальцивироз у кошек

Вирус с одной цепочкой РНК (рибонуклеиновая кислота), который поражает котов во всем мире, называется кальцивироз. Он отдаленно похож на человеческий грипп, является возбудителем респираторных заболеваний у котов. Существует около 40 разновидностей этого вируса, к тому же он склонен к мутации. Животные, которые привиты от заболевания или уже переболели им, все равно могут заразиться новым штаммом кальцивироза, но пострадать в меньшей мере.

Причины болезни­

Из причин, которые провоцируют возникновение вирусной инфекции, следует выделить такие:

  1. Плохая вентиляция помещений, т.к. способствует накоплению вируса.
  2. Отсутствие регулярной ежегодной вакцинации против кальцивируса.
  3. Групповое содержание большого количества взрослых котов и котят в приютах, питомниках.

Пути заражения

Для того чтобы заболеть, кошке не нужно даже контактировать с переносчиком заболевания – ей стоит только понюхать фекалии или мочу зараженного животного. Кальцивироз передается воздушно-капельным путем, для этого хватает расстояния 1 метра между здоровым и больным питомцем. Кошка, которая никогда не бывает на улице, может заразиться от человека – носителя инфекции.

Инкубационный период

До появления первых симптомов инкубационный период длится до одной недели. Кошачья болезнь кальцивироз продолжается в течение 2-3 недель в зависимости от конкретного штамма – возбудителя инфекции, может перерасти в хроническую форму. Наибольшую опасность вирус представляет для маленьких котят и взрослых животных. Инкубационный период у новорожденного малыша менее 24 часов, за это время он поражает слизистые оболочки. Если беременная кошка не была привита от кальцивируса, то вероятность смерти детенышей составляет до 90%.

Признаки

У маленьких котят вирусный кальцивироз протекает тяжело и в ярко выраженной форме, но взрослый здоровый питомец болеет без четкого проявления симптомов. К основным признакам инфекции у котов относят:

  • повышение температуры тела до 40 градусов, которое продолжается в течение 3-4 дней;
  • слезотечение из глаз, выделения из носа и ротовой полости, грудь и подбородок постоянно мокрые;
  • в ротовой полости, на губах и носу появляются язвы, нарывы;
  • расстройства желудочно-кишечного тракта – понос, рвота, запор;
  • снижение аппетита, отказ от еды;
  • зловонный запах изо рта животного;
  • постоянное чихание, кашель;
  • хромота, как следствие поражения суставов вирусом;
  • изменения характера – появление агрессии, апатии, вялости.

Лечение кальцивироза у кошек

При возникновении первых признаков недомогания нужно не ждать, а обратиться в ветеринарную клинику. Лечение можно проводить дома, если заболевание не осложнено, но под контролем врача. Стационар предписывается в тяжелых случаях, например, при вирусных пневмониях. Кальцивироз у котят протекает намного серьезней, чем у взрослых животных. Специфического препарата для лечения кальцивируса кошачьих не существует. Лечение симптоматическое и направлено на поддержание иммунитета.

Схема лечения

Самолечение может быть опасным для жизни питомца. Только своевременная и комплексная терапия даст положительный результат. Схема лечения должна включать:

  • прием антибиотиков для устранения или предотвращения вторичной бактериальной инфекции, развивающейся на фоне снижения иммунитета;
  • употребление противоотечных средств или ингаляции для избавления от густой слизи в носу;
  • применение обезболивающих, антибактериальных, заживляющих, противовоспалительных препаратов для нормализации температуры тела, обработки ротовой полости, глаз;
  • инфузионные процедуры, если животное истощено и обезвожено;
  • прием противовирусных препаратов;
  • употребление витаминных комплексов.

Препараты

Специфических средств против вируса кальцивироза у котов нет. Основными препаратами в схеме лечения должны быть:

  • антибиотики – Флемоксин, Цефалексин;
  • иммуномодуляторы, иммуностимуляторы – Фоспренил;
  • противовирусный препарат для человека – Циклоферон;
  • раствор Рингера от обезвоживания;
  • витаминные комплексы, минеральные добавки – Гамавит;
  • сыворотки Имунофил, Витафел;
  • жаропонижающие – Кетофен, Локсиком (парацетамол котам категорически противопоказан, он может привести к смерти питомца).

Уход за выздоравливающей кошкой

Информация о том, что кальцивироз у кота способен распространяться на человека и других животных, является безосновательной. Заболевание видоспецифично, то есть страдает им только семейство кошачьих. По этой причине не стоит опасаться заражения вирусом и ограждать себя и семью от выздоравливающего домашнего любимца, жизнь которого всецело в руках хозяина.

Заболевание забирает у животного все силы, поэтому особое внимание нужно уделить питанию. В рационе должны быть калорийные, легкоусвояемые продукты, которые необходимо подавать в жидком виде. Содержать питомца нужно в чистоте, раз в сутки проветривать помещение. Необходимо своевременно удалять выделения из носа и глаз, обрабатывать язвы во рту.

Профилактика

Прививка от кальцивируса – лучшая превентивная мера, которая способна хоть и не на 100%, но защитить питомца от этого заболевания. Вакцинация проводится один раз в год, котят прививают в возрасте 10-12 недель. Привитых кошек вирус способен поразить, но течение болезни будет очень легким. Для профилактики болезни необходимо ограждать питомца от нежелательных контактов и соблюдать правила гигиены, но по той причине, что заболевание очень заразно, даже безупречные условия содержания животного не гарантируют защиту от вируса.

Опасен ли кальцивироз для человека

Вирус кальцивироза выживает в окружающей среде неделю, еще больше при повышенной влажности воздуха. Хозяин питомца, прикасаясь к зараженным животным или предметам, может стать переносчиком вируса. Заразиться кальцивирозом могут только коты. Заболевание не опасно для человека и других животных. Можно без опасения заботиться о больном кальцивирозом питомце.

Видео

1323

Была ли эта статья полезной?

Да

Нет

1 человек ответили

Спасибо, за Ваш отзыв!

человек ответили

Что-то пошло не так и Ваш голос не был учтен.

Нашли в тексте ошибку?

Выделите её, нажмите Ctrl + Enter и мы всё исправим!

Калицивирусная инфекция кошек. Руководство ABCD по профилактике и лечению

https://doi.org/10.1016/j.jfms.2009.05.004Получить права и содержание

Резюме

Обзор

Калицивирус кошек (FCV) является высоковариабельным вирусом. В последнее время наблюдаются более тяжелые системные формы инфекции FCV.

Инфекция

Больные, остро инфицированные кошки или кошки-носители выделяют FCV с ороназальным и конъюнктивальным секретом. Заражение происходит в основном контактным путем.

Признаки болезни

Основными клиническими признаками являются язвы в полости рта, симптомы со стороны верхних дыхательных путей и высокая температура. Кошачий калицивирус может быть выделен почти у всех кошек с хроническим стоматитом или гингивитом. У кошек с «вирулентным системным заболеванием FCV» по-разному проявляются лихорадка, отек кожи, язвенные поражения на голове и конечностях и желтуха. Смертность высока, и болезнь протекает тяжелее у взрослых кошек.

Диагностика

Диагноз FCV можно поставить путем выделения вируса или ПЦР с обратной транскриптазой.Вирусная РНК может быть обнаружена в конъюнктивальных и оральных мазках, крови, соскобах кожи или легочной ткани с помощью ПЦР. Положительные результаты ПЦР следует интерпретировать с осторожностью, так как они могут быть следствием низкого уровня выделения персистентно инфицированных носителей. Диагноз вирулентного системного FCV основывается на клинических признаках и выделении одного и того же штамма из крови нескольких больных кошек.

Ведение болезни

Поддерживающая терапия (включая инфузионную терапию) и хороший уход за больными крайне важны.Анорексичных кошек следует кормить вкусной, смешанной или подогретой пищей. Муколитические препараты (например, бромгексин) или распыление физиологического раствора могут облегчить состояние. Для предотвращения вторичных бактериальных инфекций могут назначаться антибиотики широкого спектра действия. Калицивирус кошек может сохраняться в окружающей среде около 1 месяца и устойчив ко многим обычным дезинфицирующим средствам.

Рекомендации по вакцинации

Рекомендуются две инъекции в возрасте 9 и 12 недель, а затем первая ревакцинация через 1 год.В ситуациях высокого риска рекомендуется третья вакцинация в 16 недель. Бустеры следует давать каждые 3 года. Тем не менее, кошек в ситуациях высокого риска следует ревакцинировать ежегодно. Кошки, выздоровевшие от калицивирусного заболевания, вероятно, не защищены на всю жизнь, особенно если они инфицированы другими штаммами. Вакцинация этих кошек по-прежнему рекомендуется.

Рекомендуемые статьи Со ссылками на статьи (0)

Просмотр полного текста

Copyright © 2009 Издательство Elsevier Ltd.

Рекомендуемые статьи

Со ссылками на статьи

Противовирусное действие хлорида меди на кошачий калицивирус и синергизм с рибавирином in vitro | BMC Veterinary Research

  • 1.

    Кларк ИН, Лэмбден Пр. Молекулярная биология калицивирусов. Джей Ген Вирол. 1997; 78 (часть 2): 291–301.

    КАС Статья Google Scholar

  • 2.

    Di Martino B, Di Rocco C, Ceci C, Marsilio F. Характеристика штамма кошачьего калицивируса, выделенного из образца фекалий собаки. Вет микробиол. 2009;139(1–2):52–7.

    Артикул Google Scholar

  • 3.

    Мартелла В., Прателли А., Джентиле М., Буонаволья Д., Декаро Н., Фьоренте П., Буонаволья К.Анализ гена капсидного белка кошачьего калицивируса, выделенного от собаки. Вет микробиол. 2002;85(4):315–22.

    КАС Статья Google Scholar

  • 4.

    Баттилани М., Ваккари Ф., Карель М.С., Моранди Ф., Бенацци С., Кипар А., Донди Ф., Скальярини А. Вирулентное кошачье калицивирусное заболевание в приюте в Италии: описание случая. рез. вет. 2013;95(1):283–90.

    Артикул Google Scholar

  • 5.

    Август младший. Преданность. В: Консультации по внутренним болезням кошек (пятое издание). Сент-Луис: WB Сондерс; 2006. т.

    Google Scholar

  • 6.

    Сайкс Дж. Э. Детское кошачье заболевание верхних дыхательных путей. Ветеринарная клиника North Am Small Anim Pract. 2014;44(2):331–42.

    Артикул Google Scholar

  • 7.

    Херли К.Ф., Сайкс Дж.Э. Обновленная информация о кошачьем калицивирусе: новые тенденции.Ветеринарная клиника North Am Small Anim Pract. 2003;33(4):759–72.

    Артикул Google Scholar

  • 8.

    Кон Л.А. Комплекс респираторных заболеваний кошек. Ветеринарная клиника North Am Small Anim Pract. 2011;41(6):1273–89.

    Артикул Google Scholar

  • 9.

    Вилли Б., Спири А.М., Мели М.Л., Самман А., Хоффманн К., Сидлер Т., Каттори В., Граф Ф., Дизеренс К. А., Падрутт И. и др. Молекулярная характеристика и характер нейтрализации вируса тяжелых неэпизоотических форм калицивирусной инфекции кошек, напоминающих вирулентное системное заболевание кошек, в Швейцарии и Лихтенштейне.Вет микробиол. 2016;182:202–12.

    КАС Статья Google Scholar

  • 10.

    Койн К.П., Гаскелл Р.М., Доусон С., Портер С.Дж., Рэдфорд А.Д. Эволюционные механизмы персистенции и диверсификации калицивируса в эндемически инфицированных естественных популяциях хозяев. Дж Вирол. 2007; 81 (4): 1961–71.

    КАС Статья Google Scholar

  • 11.

    Рэдфорд А.Д., Койн К.П., Доусон С., Портер С.Дж., Гаскелл Р.М.Калицивирус кошек. Вет рез. 2007;38(2):319–35.

    КАС Статья Google Scholar

  • 12.

    Smith AW, Iversen PL, O'Hanley PD, Skilling DE, Christensen JR, Weaver SS, Longley K, Stone MA, Poet SE, Matson DO. Вирус-специфическое противовирусное лечение для борьбы с тяжелыми и фатальными вспышками кошачьей калицивирусной инфекции. Am J Vet Res. 2008;69(1):23–32.

    КАС Статья Google Scholar

  • 13.

    Wu H, Zhang X, Liu C, Liu D, Liu J, Tian J, Qu L. Противовирусное действие хлорида лития на кошачий калицивирус in vitro. Арх Вирол. 2015;160(12):2935–43.

    КАС Статья Google Scholar

  • 14.

    Wu H, Liu Y, Zu S, Sun X, Liu C, Liu D, Zhang X, Tian J, Qu L. Противовирусное действие гермакрона in vitro на кошачий калицивирус. Арх Вирол. 2016;161(6):1559–67.

    КАС Статья Google Scholar

  • 15.

    МакДонах П., Шихи П.А., Фосетт А., Норрис Дж.М. Противовирусное действие мефлохина на кошачий калицивирус in vitro. Вет микробиол. 2015;176(3–4):370–7.

    КАС Статья Google Scholar

  • 16.

    Debski B. Дополнение рациона свиней цинком и медью в качестве альтернативы обычным противомикробным препаратам. Pol J Vet Sci. 2016;19(4):917–24.

    КАС Статья Google Scholar

  • 17.

    Хориэ М., Огава Х., Йошида Ю., Ямада К., Хара А., Одзава К., Мацуда С., Мизота С., Тани М., Ямамото Ю. и др. Инактивация и морфологические изменения вируса гриппа птиц ионами меди. Арх Вирол. 2008;153(8):1467–72.

    КАС Статья Google Scholar

  • 18.

    Шахабади Н., Аббаси А.Р., Мошткоб А., Шири Ф. Исследования ДНК-связывания нового комплекса Cu (II), содержащего ингибитор обратной транскриптазы и препарат против ВИЧ зальцитабин.J Coord Chem. 2019;72(12):1957–72.

    КАС Статья Google Scholar

  • 19.

    Sucipto TH, Churrotin S, Setyawati H, Kotaki T, Martak F, Soegijanto S. Противовирусная активность дигидрата хлорида меди (ii) против вируса денге TYPE-2 в клетках VERO. Indones J Trop Infect Dis. 2017;6(4):84–7.

    Артикул Google Scholar

  • 20.

    Джопп М., Беккер Дж., Беккер С., Миска А., Гандин В., Марцано С., Шиндлер С.Противораковая активность ряда комплексов меди (II) с триподными лигандами. Eur J Med Chem. 2017; 132: 274–81.

    КАС Статья Google Scholar

  • 21.

    Sagripanti JL, Routson LB, Bonifacino AC, Lytle CD. Механизм медь-опосредованной инактивации вируса простого герпеса. Противомикробные агенты Chemother. 1997;41(4):812–7.

    КАС Статья Google Scholar

  • 22.

    Betanzos-Cabrera G, Rez FJR, Oz JLM, Barrn BL, Maldonado R. Инактивация HSV-2 аскорбатом-Cu (II) и оценка его защиты у мышей CF-1 от энцефалита. Дж. Вироловые методы. 2004;120(2):161–5.

    КАС Статья Google Scholar

  • 23.

    Wen-Jie G, Si-Si Y, Ning C, Juan H, Jing G, Qiu-Yun C. АФК-опосредованная аутофагия была вовлечена в гибель раковых клеток, вызванную новым комплексом меди (II). Экспериментальная и токсикологическая патология: официальный журнал Gesellschaft fur Toxikologische Pathologie.2010;62(5):577–82.

  • 24.

    Strauch BM, Niemand RK, Winkelbeiner NL, Hartwig A. Сравнение микро- и наноразмерного оксида меди и водорастворимого хлорида меди: взаимосвязь между внутриклеточными концентрациями меди, окислительным стрессом и реакцией на повреждение ДНК в клетках легких человека. Часть клетчатки Toxicol. 2017;14(1):17–28.

    Артикул Google Scholar

  • 25.

    Ядав Б., Веннерберг К., Айттокаллио Т., Тан Дж.Поиск синергии лекарств в сложных ландшафтах доза-реакция с использованием модели эффективности взаимодействия. Comput Struct Biotechnol J. 2015;13(C):504–13.

    КАС Статья Google Scholar

  • 26.

    Рифкинд Дж.М., Шин Ю. А., Хейм Дж.М., Эйххорн Г.Л. Кооперативное разупорядочение одноцепочечных полинуклеотидов за счет сшивания медью. Биополимеры. 1976; 15 (10): 1879–902.

    КАС Статья Google Scholar

  • 27.

    Kopitz J, von Reitzenstein C, Muhl C, Cantz M. Роль ганглиозидсиалидазы плазматической мембраны клеток нейробластомы человека в контроле роста и дифференцировки. Biochem Biophys Res Commun. 1994;199(3):1188–93.

    КАС Статья Google Scholar

  • 28.

    Мияги Т., Хата К., Хасегава А., Аояги Т. Дифференциальное действие различных ингибиторов на четыре типа крысиной сиалидазы. Glycoconj J. 1993;10(1):45–9.

    КАС Статья Google Scholar

  • 29.

    РАФЕЛЬСОН М.Д., ШНЕЙР М., УИЛСОН В.Д. Исследования нейраминидазы вируса гриппа. II. Дополнительные свойства ферментов из штаммов Asian и PR 8. Арх Биохим Биофиз. 1963; 103: 424–30.

    КАС Статья Google Scholar

  • 30.

    Howe C, Morgan C. Взаимодействие между вирусом Сендай и эритроцитами человека. Дж Вирол. 1969;3(1):70–81.

    КАС Статья Google Scholar

  • 31.

    Ianevski A, He L, Aittokallio T, Tang J. SynergyFinder: веб-приложение для анализа данных матрицы доза-реакция комбинации препаратов. Биоинформатика (Оксфорд, Англия). 2017;33(15):2413–5.

    Артикул Google Scholar

  • 32.

    Glover ZK, Basa L, Moore B, Laurence JS, Sreedhara A. Взаимодействие ионов металлов с mAb: Часть 1, том. 7; 2015.

    Google Scholar

  • 33.

    Смит М.А., Истон М., Эверетт П., Льюис Г., Пейн М., Риверос-Морено В., Аллен Г. Специфическое расщепление иммуноглобулина G ионами меди. Int J Pept Protein Res. 1996;48(1):48–55.

    КАС Статья Google Scholar

  • 34.

    Belczyk-Ciesielska A, Zawisza IA, Mital M, Bonna A, Bal W. Зависимый от последовательности Cu (II)-зависимый гидролиз пептидной связи: сходства и различия с Ni (II)-зависимой реакцией. Неорг хим. 2014;53(9):4639–46.

    КАС Статья Google Scholar

  • 35.

    Protas AM, Bonna A, Kopera E, Bal W. Селективный гидролиз пептидных связей цистеиновых пептидов в присутствии ионов Ni (II). Дж. Инорг Биохим. 2011;105(1):10–6.

    КАС Статья Google Scholar

  • 36.

    Салинас Б.А., Сатиш Х.А., Шах А.У., Карпентер Дж.Ф., Рэндольф Т.В. Зависимая от буфера фрагментация гуманизированного полноразмерного моноклонального антитела.Дж. Фарм. 2010;99(7):2962–74.

    КАС Статья Google Scholar

  • 37.

    Yanli Z, Xiaoqing C, Ying Y, Kai W, Hongwei D, Chao G, Songtao Y, Guixue H: Выделение и филогенетический анализ трех штаммов кошачьего калицивируса от домашних кошек в провинции Цзилинь, Китай. Арх Вирол. 2017;162(9):2579–89.

  • 38.

    Cui Z, Li D, Yi S, Guo Y, Dong G, Niu J, Zhao H, Zhang Y, Zhang S, Cao L, et al. Фрагменты лошадиного иммуноглобулина F (ab') 2 защищают кошек от кошачьей калицивирусной инфекции.Int Immunopharmacol. 2019;75.

  • 39.

    Ясеноски Л.Д., Кадена С., Мире С.Е., Борисевич В., Харидас В., Ранджбар С., Намбу А., Бавари С., Соловьева В., Садухан С. и др. Одобренный FDA пероральный препарат нитазоксанид усиливает противовирусный ответ хозяина и ингибирует вирус Эбола. iНаука. 2019;19:1279–90.

    КАС Статья Google Scholar

  • Калицивирус у кошек: причины, симптомы и лечение

    Калицивирус кошек (FCV) — это распространенная вирусная инфекция домашних кошек.Вирус вызывает заболевание верхних дыхательных путей, которое часто очень напоминает вирусный ринотрахеит кошек (FVR), и оба вируса могут вызывать синдром, известный как «кошачий грипп», с генерализованным воспалением верхних дыхательных путей и глаз, приводящим к чиханию, двусторонним выделениям из глаз, высокая температура, вялость и отсутствие аппетита.

    Хотя большинство кошек в конечном итоге выздоравливают, случаются смертельные случаи, и многие выздоровевшие кошки становятся хроническими носителями вируса. Вакцины, вводимые котятам, с повторными прививками в более позднем возрасте, при необходимости, гарантируют, что FCV обычно эффективно контролируется у домашних кошек.Колонии диких кошек могут серьезно пострадать от вируса. Существует около пятидесяти штаммов кошачьего калицивируса, вызывающих заболевания различной вирулентности и степени тяжести.

    Передача кошачьего калицивируса

    Кошачий калицивирус передается от инфицированных кошек преимущественно с выделениями из глаз, носа и рта, а также может быть обнаружен в крови, моче и фекалиях. Кошки могут заразиться при прямом контакте от кошки к кошке (капли могут переносить вирус на расстояние до 1,5 м), а также через фомиты (например, через фомиты).г. миски для еды, миски для воды, лотки и т. д.).

    Тщательная очистка и дезинфекция важны при лечении инфицированных кошек для предотвращения случайной передачи вируса.

    Симптомы калицивируса

    Острая форма калицивируса может вызывать симптомы со стороны верхних дыхательных путей, включая насморк и глаза.

    Клинические признаки кошачьей калицивирусной инфекции варьируются от кошки к кошке, от бессимптомных носителей до различной степени заболевания верхних дыхательных путей (от легкой до тяжелой).В редких случаях заболевание может привести даже к летальному исходу.

    Острая форма заболевания обычно вызывает типичные симптомы со стороны верхних дыхательных путей, которые включают выделения из носа и чихание, а также конъюнктивит и выделения из глаз. У многих кошек появляются характерные изъязвления на языке, деснах, твердом небе (небе) и губах. Обычно наблюдаются лихорадка, вялость и отсутствие аппетита.

    В некоторых случаях может развиться пневмония с кашлем и затрудненным дыханием. Реже хромота может возникать из-за поражения суставов.Более вирулентные штаммы FCV могут вызывать другие серьезные симптомы, включая желтуху, отек головы и конечностей и изъязвления на других участках тела.

    У некоторых кошек развиваются хронические (долгосрочные) признаки заболевания, которые могут включать гингивит и полипы носоглотки, а также выделение вируса в долгосрочной перспективе. Около 80% кошек, которые выздоравливают от FCV, становятся хроническими носителями вируса.

    Лечение калицивируса

    Лечение калицивируса у кошек, как правило, поддерживающее, но также может быть назначена противовирусная терапия.

    Теоретически может назначаться противовирусная терапия (например, интерферон или иммуноглобулин), но на практике она используется редко.

    Вместо этого основное внимание уделяется поддерживающей терапии, обеспечивающей комфорт пострадавших кошек, пока собственная иммунная система кошки борется с вирусом.

    • Это поддерживающее лечение может включать общий уход, антибиотики для контроля вторичной бактериальной инфекции, назальные капли с фенилэфрином в качестве противоотечного средства, внутривенные жидкости для борьбы с обезвоживанием и пищевую поддержку.
    • Заболевшие кошки часто теряют обоняние, что приводит к одновременной потере вкуса, поэтому полезно предлагать очень аппетитные корма с сильным, привлекательным запахом, разогревая пищу в микроволновой печи, чтобы сделать ее более привлекательной.
    • Важно очищать выделения из глаз и ноздрей несколько раз в день, используя вату, смоченную теплой водой. Это может помочь добавить 1 чайную ложку соли на 1 пинту воды.

    Большинство (но не все) кошек постепенно выздоравливают от острой активной фазы болезни в течение 7-10 дней.

    Калицивирусная вакцина

    Вакцинация против калицивируса кошек — лучший способ предотвратить это заболевание.

    Доступна эффективная вакцинация против FCV: это часть плановой вакцины против FVRCP, которую вводят котятам, а взрослым кошкам регулярно делают бустерные прививки с интервалами, соответствующими их образу жизни. Как правило, первичную серию прививок против FVRCP следует делать всем котятам и кошкам.

    Взрослых домашних кошек можно ревакцинировать каждые три года для поддержания минимального иммунитета.Кошкам, которые выходят на улицу, смешиваясь с другими кошками, или кошкам, которые посещают питомники или выставки, может быть сделана ежегодная ревакцинация, но это тема для обсуждения с вашим собственным ветеринаром. Прививки следует проводить с интервалами, основанными на индивидуальной оценке риска для каждого пациента.

    Согласно текущим рекомендациям Американской ассоциации фелинологов (AAFP), первую дозу вакцины следует вводить в возрасте 9 недель, вторую дозу — в 12 недель и третью дозу — в 16 недель.Затем через год следует провести ревакцинацию, а затем повторные ревакцинации каждые три года.

    Эти рекомендации основаны на «средней» кошке, и всегда стоит обсудить потребности вашей кошки с вашим ветеринаром.

    Заключение

    Наряду с вирусным ринотрахеитом кошек (FVR), калицивирус кошек (FCV) является одной из наиболее распространенных вирусных инфекций кошек, при этом один или оба вируса вызывают синдром, известный как «кошачий грипп». Болезнь можно предотвратить с помощью прививок, которые следует делать всем котятам и взрослым кошкам по мере необходимости в зависимости от их индивидуального риска.

    Часто задаваемые вопросы

    Можно ли вылечить калицивирус у кошек?

    Смертность от кошачьей калицивирусной инфекции низкая, но, к сожалению, в отдельных случаях болезнь заканчивается смертельным исходом. Большинство кошек полностью выздоравливают от острой формы заболевания, но даже в этом случае вирус не выводится из организма полностью. Кошки часто страдают вялотекущими хроническими заболеваниями (такими как гингивостоматит) и становятся хроническими распространителями вируса.

    Что убивает калицивирус?

    Эффективного препарата, убивающего калицивирус в живом организме, не существует. Вирус также может быть трудно убить в окружающей среде, он выживает на поверхностях до месяца. Специальные дезинфицирующие средства (например, отбеливатель или диоксид хлора) следует использовать для очистки участков, контактировавших с зараженными кошками.

    Калицивирус смертельно опасен?

    Хотя большинство кошек выздоравливают от калицивирусной инфекции, она может привести к летальному исходу, особенно у животных с ослабленной иммунной системой, таких как котята или кошки с ослабленным иммунитетом (например, кошки с ослабленным иммунитетом).г. больные ВИК). Кроме того, есть еще несколько вирулентных штаммов, смертность которых превышает 50% даже у взрослых кошек.

    Усеченный предшественник главного капсидного белка калицивируса кошек: продукт, имеющий значение для репликации, или аберрантный артефакт трансляции? - Полный текст - Интервирусология 2021, Том. 64, № 2


    В недавней статье ОВИ Урбана и Луттерманна [1] для калицивируса кошек (FCV) впервые была обнаружена укороченная версия предшественника VP1 (tLC-VP1), синтезированная непосредственно из геномной РНК (гРНК).С помощью серии всесторонних экспериментов по обратной генетике с использованием 3D Pol /LC-расщепленных мутантов, RIPA, анализов репортеров люциферазы и делеционных мутантов авторы продемонстрировали трансляционную активность, приводящую к синтезу tLC-VP1, начиная с кодона 86 AUG, который, как они утверждают, является второй стартовый кодон во всей последовательности LC-VP1. Авторы предположили, что новый, независимый от сканирования, довольно неизвестный механизм инициации трансляции может отвечать за синтез tLC-VP1, и идентифицировали специфические последовательности выше M86, которые, по-видимому, важны для его эффективности.Например, в репортерном анализе мутант S3S, у которого отсутствует стебель-петля, встречающаяся в природе рядом с первой AUG (M1) LC-VP1, показал резко сниженную экспрессию люциферазы из-за нарушенной инициации трансляции на M86. Кроме того, в многоступенчатом анализе роста мутант S3S показал снижение титров в ранних точках кривой по сравнению с FCV дикого типа, хотя все проанализированные вирусы достигли сходных конечных титров. Основываясь на этих выводах, авторы предполагают, что tLC-VP1 играет роль на ранних фазах репликации вируса, и утверждают, что «все калицивирусы экспрессируют VP1 из гРНК», потому что это необходимо и требуется на ранних стадиях инфекции.Мы ожидали, что авторы обсудят хорошо установленный факт, что все калицивирусы инкапсулируют субгеномную РНК (sgRNA) внутри вирионов [2, 3], которая легко транслируется при заражении, и биологическое значение продукции довольно избыточного tLC-VP1 в этом случае. контекст.

    Авторы основывали свою работу на последовательности вакцинного штамма FCV 2024 (GenBank AF479590.1), не содержащего дополнительного остатка метионина между M1 и M86. Тем не менее, внимательное изучение других последовательностей FCV GenBank показывает, что большинство штаммов FCV имеют другой стартовый кодон AUG внутри рамки считывания в последовательности LC-VP1 в положении 38 (M38), который был упущен из виду в этой работе (рис.1а). Кроме того, когда мы сравнили последовательность LC-VP1 из штамма FCV Urbana с последовательностями нескольких представителей рода Vesivirus , мы не обнаружили внутрирамочного стартового кодона AUG между первой ORF2 AUG (M1) и предполагаемым сайтом протеолитического расщепления, ответственным за для вырезания LC и высвобождения зрелого VP1, за исключением Allston calicivirus (M122, M134, M141) и SMSV-8 (M127, M135), которые кодируют остатки метионина далеко ниже M86 (рис. 1b).

    Рис. 1.

    Множественное выравнивание аминокислотных последовательностей предшественника основного капсидного белка (LC-VP1) из штаммов каливируса кошек (FCV) Urbana, F4, CFI/68 и F65 ( a ) и из везивирусов FCV штамм Urbana, Allston calicivirus ( b ), Везикулярная экзантема свиного вируса штамм A48 (VESV-A48), вирус морского льва Сан-Мигель серотип 1 (SMSV-1), вирус морского льва Сан-Мигель серотип 8 (SMSV-8), калицивирус приматов Pan-1 (Pan-1) и везивирус кролика (RaV). Номера доступа GenBank указаны в скобках. Третий метионин в ORF LC-VP1 (M86), названный Урбаном и Луттерманном вторым, указан зеленой стрелкой. Фактический второй метионин в ORF LC-VP1 (M38) указан красной стрелкой. Сайт протеолитического расщепления LC/VP1 (E124/A125) обозначен черной стрелкой. Обозначение цвета сходства аминокислот: желтый фон = идентичный, голубой фон = консервативный, зеленый фон = блок похожих, зеленый шрифт/белый фон = слабо похожий и черный шрифт/белый фон = не похожие.

    Мы также были обеспокоены выводом о том, что tLC-VP1 необходим для репликации вируса, который мы нашли очень предварительным. Учитывая крайне низкий используемый MOI (0,0003), вариации при пипетировании или очень небольшие различия в количестве клеток в сосуде для культивирования могут иметь большое влияние на титры в ранние моменты времени, особенно когда метод TCID50 используется вместо анализа бляшек.

    Принимая во внимание это, мы хотели бы поблагодарить авторов за их вклад и любезно пригласить их к обсуждению следующих вопросов: Почему tLC-VP1 может быть синтезирован из гРНК, если полный VP1 может быть немедленно получен из инкапсулированной sgRNA после заражения? Может ли tLC-VP1 быть второстепенным продуктом трансляции, за исключением используемого штамма FCV? Может ли более крупная версия tLC-VP1 также экспрессироваться в других штаммах FCV, начиная с M38? Почему продукт гРНК, предположительно важный для инициации репликации калицивируса, отсутствует у большинства везивирусов (за исключением FCV)?

    Заявление о конфликте интересов

    Авторы заявляют об отсутствии конфликта интересов.

    Вклад авторов

    А.Л.А. задумал работу и написал рукопись. Ф.П. разработал концепцию работы, обеспечил надзор и отредактировал рукопись.

    Ссылки

    1. Урбан С, Луттерманн С.Синтез основного капсидного белка из геномной РНК кошачьего калицивируса. Дж Вирол. 2020;94(15).
    2. Мейерс Г., Вирблих С., Тиль Х.Дж. Геномные и субгеномные РНК вируса геморрагической болезни кроликов как связаны с белками, так и упакованы в частицы. Вирусология. 1991;184(2):677–86.
    3. Нил Джей Ди. Субгеномная РНК кошачьего калицивируса упаковывается в вирусные частицы во время инфекции. Вирус Рез. 2002;87(1):89–93.

    Автор Контакты

    Анхель Л.Álvarez

    Departamento de Bioquimica y Biologia Molecular, IUBA

    Universidad de Oviedo, C/ Fernando Bongera sn, Edificio Santiago Gascón

    Campus El Cristo, ES–33006 Oviedo (Испания)

    007

    007

    07

    07

    07

    Информация о статье / публикации

    Получено: 08 октября 2020 г.
    Принято: 17 декабря 2020 г.
    Опубликовано онлайн: 18 марта 2021 г.
    Дата выпуска выпуска: апрель 2021 г.

    Количество печатных страниц: 3
    Количество фигурок: 1
    Количество столов: 0

    ISSN: 0300-5526 (печать)
    eISSN: 1423-0100 (онлайн)

    Для получения дополнительной информации: https://www. karger.com/INT


    Лицензия открытого доступа / Дозировка препарата / Отказ от ответственности

    Эта статья находится под лицензией Creative Commons Attribution-NonCommercial 4.0 International License (CC BY-NC). Использование и распространение в коммерческих целях требует письменного разрешения. Дозировка препарата: авторы и издатель приложили все усилия, чтобы гарантировать, что выбор препарата и дозировка, указанные в этом тексте, соответствуют текущим рекомендациям и практике на момент публикации.Тем не менее, в связи с продолжающимися исследованиями, изменениями в правительственных постановлениях и постоянным потоком информации, касающейся лекарственной терапии и реакций на лекарства, читателю настоятельно рекомендуется проверять вкладыш в упаковке для каждого лекарства на предмет любых изменений в показаниях и дозировке, а также для дополнительных предупреждений. и меры предосторожности. Это особенно важно, когда рекомендуемый агент является новым и/или редко используемым лекарственным средством. Отказ от ответственности: заявления, мнения и данные, содержащиеся в этой публикации, принадлежат исключительно отдельным авторам и участникам, а не издателям и редакторам.Появление рекламы и/или ссылок на продукты в публикации не является гарантией, одобрением или одобрением рекламируемых продуктов или услуг или их эффективности, качества или безопасности. Издатель и редактор(ы) отказываются от ответственности за любой ущерб, нанесенный людям или имуществу в результате любых идей, методов, инструкций или продуктов, упомянутых в содержании или рекламе.

    Идентификация кошачьего интерферон-регуляторного фактора 1 как эффективного противовирусного фактора против репликации кошачьего калицивируса и других кошачьих вирусов

    Интерфероны (ИФН) могут ингибировать большинство, если не все, вирусные инфекции, вызывая транскрипцию сотен интерферон-стимулируемых генов (ИСГ).Калицивирус кошек (FCV) является высококонтагиозным патогеном кошек и суррогатом вируса Norwalk. Интерферон эффективно ингибирует репликацию FCV, но механизм противовирусной активности изучен недостаточно. Здесь мы оценили анти-FCV-активность десяти ISG, о противовирусной активности которых сообщалось ранее. Результаты показали, что регуляторный фактор интерферона 1 (IRF1) может значительно ингибировать репликацию FCV, тогда как другие ISG, протестированные в этом исследовании, оказались неэффективными. Кроме того, мы обнаружили, что IRF1 был локализован в ядре и эффективно активировал IFN- β и промотор ISRE.IRF1 может запускать продукцию эндогенного интерферона и экспрессию ISG, предполагая, что IRF1 может положительно регулировать передачу сигналов IFN. Важно отметить, что уровни мРНК и белка IRF1 были снижены при инфицировании FCV, что может быть новой стратегией уклонения FCV от врожденной иммунной системы. Наконец, была продемонстрирована противовирусная активность IRF1 в отношении вируса панлейкопении кошек, вируса герпеса кошек и вируса инфекционного перитонита кошек. Эти данные показывают, что кошачий IRF1 играет важную роль в регуляции ответа IFN I типа хозяина и ингибировании кошачьих вирусных инфекций.

    1. Введение

    Калицивирус кошек (FCV) является высококонтагиозным патогеном кошек и обычно вызывает легкие или серьезные заболевания полости рта и верхних дыхательных путей [1]. FCV принадлежит к Vesivirus, роду Caliciviridae, который включает малые РНК-содержащие вирусы, имеющие как медицинское, так и ветеринарное значение [2]. Норовирусы человека (HuNoV) и многие другие калицивирусы трудно культивировать in vitro, а отсутствие моделей инфекции in vitro и надежных моделей на мелких животных создает препятствия для разработки вирус-специфических методов лечения и профилактических вакцин [3].Хотя недавние исследования показали, что ограниченная репликация HuNoV может происходить в иммортализованных В-клетках [4, 5], это не может быть идеальной клеточной моделью для исследования характеристик HuNoV. Поскольку FCV может хорошо реплицироваться и вызывать значительный цитопатический эффект (CPE) in vitro, он широко используется исследователями в качестве суррогата вируса Norwalk (NV) [6].

    Лишь недавно был секвенирован геном Felis catus, поэтому мало что известно о врожденном иммунитете кошек и взаимодействии FCV с врожденным иммунитетом кошек, что ограничивает понимание патогенеза FCV и других кошачьих вирусов [7].Неструктурный белок p39 штамма F4 FCV может подавлять продукцию IFN- β , предотвращая активацию IRF3 [8]. Между тем, наше более раннее исследование показало, что заражение FCV-2280 приводит к сильному высвобождению IFN- β , но другие штаммы FCV не действуют [7]. Кроме того, белок протеиназа-полимераза (PP) штамма FCV 2280 подавляет экспрессию репортерного гена люциферазы, управляемую эндогенными и экзогенными промоторами, что способствует ингибированию транскрипции клетки-хозяина [6].

    FCV очень чувствителен к интерферонам, и IFN- β может подавлять инфекцию FCV. Лечение этими ИФН снижало вирусный выход FCV F9 [9, 10]. Кошачий IFN- ω продается в Японии (Toray Industries, Токио, Япония) и используется для лечения кошачьих калицивирусных и собачьих парвовирусных инфекций [11, 12]. Мы сообщали, что кошачий IFN- β может эффективно ингибировать репликацию штамма FCV 2280. Интерфероны (ИФН) являются компонентом раннего ответа на вторжение патогенов и индуцируют экспрессию сотен ИФН-стимулируемых генов (ИСГ) [13].Выявлены механизмы противовирусного действия некоторых ИСГ. Один из ключевых ферментов, участвующих в функционировании интерферонов (ИФН), 2'-5'олигоаденилат-зависимая рибонуклеаза L (РНКаза L), может разрушать одноцепочечные вирусные РНК [14]. Интерферон-индуцированный белок с тетратрикопептидными повторами 3 (IFIT3) ингибирует репликацию вируса РРСС в клетках MARC-145, опосредуя дцРНК-индуцированную продукцию IFN- β [15]. ISG20 представляет собой индуцируемую интерфероном 3'-5'-экзонуклеазу, которая ингибирует репликацию нескольких вирусов с положительной цепью РНК человека и животных, таких как вирус гепатита А, вирус гепатита С, вирус вирусной диареи крупного рогатого скота и вирус желтой лихорадки [16].Интерферон-стимулируемый ген 15 (ISG15) представляет собой убиквитин-подобный белок, который сильно индуцируется интерфероном I типа и действует как противовирусная и иммунорегуляторная молекула. Интерферон-индуцированный GTP-связывающий белок Mx1 может ингибировать различных представителей Rhabdoviridae, Paramyxoviridae, Orthomyxoviridae и Bunyaviridae, а также вирусы двухцепочечной ДНК, включая вирус гепатита B (HBV) и вирус африканской чумы свиней (ASFV) [17]. SAMHD1 ограничивает вирус простого герпеса 1 в макрофагах, ограничивая репликацию ДНК [18], и ограничивает обратную транскрипцию ВИЧ-1 в покоящихся CD4+ Т-клетках [19].Кроме того, ВИЧ чувствителен ко многим ISG, таким как APOBEC3G, TRIM5 α , тетерину и MX2 [20].

    В то время как FCV чувствителен к интерферонам, ISG, которые могли бы ингибировать репликацию кошачьего калицивируса, не были идентифицированы. Здесь мы оценили противовирусную активность десяти кошачьих ISG (IRF1, РНКаза L, SAMHD, ISG15, ISG20, IFIT3, MX-1, GBP6, OASL и IRF2) против FCV с использованием метода транзиторной трансфекции и обнаружили, что кошачий IRF1 может эффективно подавляют репликацию FCV.Кроме того, мы обнаружили, что кошачий IRF1 может запускать выработку эндогенного интерферона и экспрессию ISG, предполагая, что IRF1 может положительно регулировать передачу сигналов IFN. Важно отметить, что уровни мРНК и белка IRF1 были снижены при инфицировании FCV, что может быть новой стратегией уклонения FCV от врожденной иммунной системы. Наконец, также была продемонстрирована противовирусная активность IRF1 в отношении вируса панлейкопении кошек, вируса герпеса кошек и вируса инфекционного перитонита кошек.

    2.Материалы и методы
    2.1. Вирусы и клетки

    Клетки почек кошек Crandell Rees (CRFK) поддерживали в модифицированной минимальной основной среде Дульбекко (DMEM) (Gibco), содержащей 10% фетальной бычьей сыворотки (FBS, Gibco), 100 ЕД/мл пенициллина и 100 мк г/мл стрептомицина. Штамм F9 FCV, штамм HR-1 FHV-1, штамм VR-638 FPV и штамм 2034 FPV размножали и титровали в клетках CRFK.

    2.2. Плазмиды Конструкция

    p3×Flag-IRF1, p3×Flag-РНКаза L, p3×Flag-SAMHD, p3×Flag-ISG15, p3×FlagISG20, p3×Flag-IFIT3, p3×Flag-MX-1, p3× Плазмиды Flag-GBP6, p3×Flag-OASL и p3×Flag-IRF2 экспрессируют кошачий IRF1, помеченный Flag (номер доступа: XM_003980752. 4), RNase L (номер доступа: XM_006942762.2), SAMHD (номер доступа: XM_003983547.3), ISG15 (номер доступа: NM_001130843.2), ISG20 (номер доступа: XM_019831901.1), IFIT3 (номер доступа: XM_011287196 .2), MX-1 (номер доступа: XM_006935851.2), GBP6 (номер доступа: XM_0039

    .3), OASL (номер доступа: XM_003994734.3) и IRF2 (номер доступа: XM_019828250.1) соответственно. Плазмида pMyc-IRF1 экспрессирует IRF1 с Myc-меткой. Плазмида p3×Flag-IFN- β кодирует меченный Flag кошачий IFN- β , а плазмида pIFN- β -Luc содержит экспрессионную кассету люциферазы (Luc), управляемую промотором кошачьего IFN- β . как описано ранее [7].Плазмида pISRE-TA-Luc экспрессировала репортерный ген люциферазы, находящийся под контролем элемента ответа на стимуляцию интерферона (ISRE). Плазмиду pRL-TK (Promega, Мэдисон, Висконсин, США), которая кодирует люциферазу Renilla, использовали в качестве внутреннего контроля для нормализации эффективности генной трансфекции. Плазмида pEGFP-IRF1 экспрессирует кошачий IRF1 с меткой EGFP. Грунтовки для построения IRF1 показаны в таблице 1.

    9048 9
    atttctagaCTACGGTGCACAAGGAATGGCCTGGAT attctcgaggtATGCCCATCACTCGGATGCG attctcgagATGCCCATCACTCGGATGCGC attgaattcgCGGTGCACAAGGAATGGCCT TGGGGCTRTCCATGTTGAT

    Primer Sequence (5'-3 ') Использование

    Флаг-irf1-F attgcggccgcgATGCCCATCACTCGGATGCGCATGAGA Амплификация irf1
    Флаг-irf1-R
    Myc- irf1-F
    Myc- irf1-R attgcggccgcCTACGGTGCACAAGGAATGG
    GFP- irf1-F
    GFP- irf1-R
    Q-GAPDH-F TGACCACAGTCCATGCCATC QRT-ПЦР для обнаружения GAPDH
    Q-GAPDH-R GCCAGTGAGCTTCCCGT ТСА
    Q-FCV-F ATGATTTGGGGTTGTGATGT QRT-ПЦР для обнаружения FCV
    Q-FCV-R
    Q-irf1-F GGAAGTGAAGGACCAGAGC qRT- ПЦР для обнаружения irf1
    Q-irf1-R TCCATCGGAGAAGGTATCA
    qIFITM1 F CACCACCGTGATCAACATCCA QRT-ПЦР для обнаружения IFITM1
    qIFITM1 R GACTTCACGGAGTAGGCAAAG
    qViperin Р CATGACCGGGGCGAGTACCTG QRT-ПЦР для обнаружения Viperin
    qViperin R GCAAGGATGTCCAAATATTCACC
    qISG15 F TCCTGGTGAGGAACCACAAGGG QRT-ПЦР для обнаружения ISG15
    qISG15 R TTCAGCCAGAACAGGTCGTC

    2.
    3. Тест на люциферазу

    Протокол этого анализа на люциферазу был описан ранее [7]. Вкратце, клетки CRFK (5×10 4 /лунку), выращенные в 48-луночных планшетах, котрансфицировали 0,5 мк мкг/лунку репортерной плазмиды, 0,02 мк мкг/лунку плазмиды pRL-TK (Promega) (в качестве внутренний контроль для нормализации системы анализа) или указанную экспрессионную плазмиду. Клетки инфицировали SeV (100 единиц гемагглютинирующей активности на лунку) через 12 ч после котрансфекции. Клетки лизировали через 8-10 часов после инфицирования и измеряли активность люциферазы светлячка и Renilla с помощью системы репортерного анализа двойной люциферазы (Promega) в соответствии с протоколом производителя.Относительную активность люциферазы в каждом образце определяли по соотношению активностей люцифераз светлячка и Renilla.

    2.4. Оценка противовирусной активности кошачьих ISGS

    Вкратце, клетки CRFK (2×10 5 на лунку) высевали в 24-луночные культуральные планшеты на 24 ч, а затем трансфицировали 1 мкг мкг экспрессионных плазмид ISG или имитация трансфекции 1 мк мкг p3×Flag-CMV-10. Штамм F9 FCV с множественностью заражения 0,01 инокулировали в клетки через 24 ч после трансфекции.Клеточный супернатант и клетки собирали для исследования вирусных титров и вирусной РНК, соответственно, через 24 ч после заражения.

    2.5. Количественный анализ ОТ-ПЦР в реальном времени

    Протокол количественной ОТ-ПЦР в реальном времени был описан ранее [21]. кДНК готовили с помощью набора для обратной транскрипции AMV (Takara, Япония) в соответствии с протоколом производителя. Количественную ПЦР в реальном времени, нацеленную на ген FCV и ген IRF1, проводили с использованием Agilent Mx3005P в соответствии с инструкциями производителя.Относительные уровни экспрессии мРНК рассчитывали методом 2-ΔΔCT с использованием GADPH в качестве внутреннего контроля для нормализации. Праймеры представлены в таблице 1.

    2.6. Тест на титр вируса

    Протокол титрования вируса был описан в нашем предыдущем исследовании [1]. Вкратце, с помощью DMEM без сыворотки готовили десятикратно разбавленные штаммы вируса, и 0,1 мл каждого разведения инокулировали в клетки, высеянные в 96-луночный культуральный планшет. После 1 ч адсорбции супернатант удаляли и 0.В каждую лунку добавляли 1 мл свежей DMEM, содержащей 1% FBS и 1% пенициллин-стрептомицин. ЦПД наблюдали через 72 ч после инокуляции, а титры вируса выражали как среднюю инфекционную дозу культуры ткани (TCID50)/мл по методу Рида и Мюнха [22].

    В эксперименте по заражению FPV выход вируса определяли с помощью прямого флуоресцентного анализа (DFA) с использованием моноклональных антител против собачьего парвовируса, конъюгированных с FITC (CJ-F-CPV-MAB, VMRD).

    2.7. Вестерн-блот-анализ

    Клетки промывали холодным PBS и лизировали лизисным буфером RIPA (Институт биотехнологии Beyotime, Наньтун, Китай) с 0.1 мМ ФМСФ, затем лизаты очищали центрифугированием при 12 000 g в течение 5 мин при 4°С. Равные количества образцов белка разделяли с помощью 10% SDS-PAGE и переносили на нитроцеллюлозные мембраны (Millipore). Мембраны блокировали 5% обезжиренным молоком в течение 1-2 часов при комнатной температуре, а затем инкубировали в течение 1 часа при комнатной температуре с мышиным анти-FLAG M2 MAb (1804, Sigma), кроличьим поликлональным антителом против Myc (ab9106, Abcam). , кроличье моноклональное антитело против IRF1 (ab186384, Abcam), кроличье антитело против GADPH (ab22555, Abcam) и мышиное моноклональное антитело против FCV VP1 (произведено в нашей лаборатории).

    После трех промываний в буфере TBST мембраны инкубировали при комнатной температуре в течение 1 ч с конъюгированным с IRDye 800DX антикроличим IgG или конъюгированным с IRDye 800 антимышиным IgG (1:8000; Rockland Immunochemicals), разбавленным TBST в качестве вторичного антитело. После третьей промывки мембраны визуализировали и анализировали с помощью системы инфракрасной визуализации Odyssey (LI-COR Biosciences).

    2.8. Статистика

    Значимые различия между экспериментальными группами определяли с помощью парного t -теста и однофакторного ANOVA с Prism 5.0 (программное обеспечение GraphPad). Значение p <0,05 было выбрано для обозначения значимости.

    3. Результаты
    3.1. Скрининг кошачьих ISG, которые могут ингибировать репликацию FCV

    Чтобы выяснить, какие кошачьи ISG могут ингибировать репликацию FCV, десять описанных кошачьих ISG с противовирусной активностью были клонированы в вектор p3×Flag-CMV10. Экспрессию этих кошачьих ISG с флаговой меткой идентифицировали вестерн-блоттингом с использованием антитела против флага (рис. 1(а)).Затем клетки CRFK трансфицировали пустым вектором или экспрессионной плазмидой ISG в течение 24 ч, а затем в клетки инокулировали штамм F9 FCV еще на 24 ч. Сначала мы проанализировали уровни вирусной РНК между группами трансфекции вектора и ISG. Экспрессия кошачьего IFN- β (положительный контроль), IRF1, РНКазы L и SAMHD значительно снижала уровни вирусной РНК по сравнению с таковыми в группе с векторной трансфекцией (рис. 1(b)). Среди этих ISG IRF1 был наиболее эффективным ингибитором и снижал продукцию вирусной РНК по меньшей мере на 80% (рис. 1(b)).Результат анализа титра вируса также показал, что экспрессия IRF1 значительно ингибировала выход вируса, но экспрессия РНКазы L и SAMHD не влияла на титры вируса в клеточных супернатантах (рис. 1(с)). Эти данные показали, что кошачий IRF1 (fe-IRF1) является мощным ингибитором FCV.

    3.2. Сверхэкспрессия Fe-IRF1 ингибирует репликацию FCV дозозависимым образом

    Чтобы исключить влияние вектора на репликацию FCV, fe-IRF1 был клонирован в другую эукариотическую экспрессионную плазмиду pCMV-Myc, названную pMyc-IRF1. Клетки CRFK трансфицировали pMyc-IRF1 или пустым вектором. Через 24 часа после трансфекции клетки инокулировали FCV F9 при MOI 0,01 в течение 24 часов. Были проанализированы уровни вирусной РНК (рис. 2(а)) и титры (рис. 2(б)). Действительно, оба уровня были значительно подавлены, а также было обнаружено снижение экспрессии капсидного белка FCV VP1 с помощью fe-IRF1 (рис. 2(c)). Кроме того, IRF1 является важным ISG, и трансфицированная плазмида Fe-IFN- β может значительно увеличить экспрессию мРНК fe-IRF1 с 7.в 5 раз (рис. 2(г)). Более того, ингибирующий эффект IRF1 проявлялся дозозависимым образом (рис. 2(e)).

    Затем мы сравнили кривую роста FCV в контрольных клетках и клетках, трансфицированных fe-IRF1. По сравнению с ложно-трансфицированными клетками выход вируса в клетках, трансфицированных fe-IRF1, был значительно ниже, чем в ложно-трансфицированных клетках в каждый момент времени (рис. 2(f)). Через 60 ч после заражения экспрессия fe-IRF1 приводила к снижению примерно на 2 log10TCID50/мл (рис. 2(f)).

    На основании этих результатов мы пришли к выводу, что fe-IRF1 является эффективным антагонистом FCV.

    3.3. Fe-IRF1 имеет общий консервативный ДНК-связывающий домен

    IRF-1 является фактором регуляции транскрипции, и его N-концевые 125 аминокислот (N-125), кодирующие ДНК-связывающий домен (DBD), являются структурно и функционально консервативными среди Семейство белков IRF [23]. Мы проанализировали N-концевые 125 аминокислотных последовательностей IRF1 человека, мыши, свиньи, крупного рогатого скота, собаки, крысы и кошки с использованием MEGA5.0. Как показано на рис. 3(а), N-125 fe-IRF1 имеет 100% сходство с таковым человека, свиньи и собаки, предполагая, что N-125 fe-IRF1 консервативен.

    Для изучения субклеточной локализации fe-IRF1 CDS fe-IRF1 были вставлены в pEGFP-N1 и названы pEGFP-IRF1. Конфокальная микроскопия показала, что слитый белок fe-IRF1 был локализован в ядре, что является той же субклеточной локализацией, что и другие IRF1.

    3.
    4. Сверхэкспрессия Fe-IRF1 активирует IFN- β и промоторы ISRE

    В качестве важного сигнального фактора регуляции транскрипции IRF1 играет ключевую роль в активации ответов IFN I типа во время инфекций, вызванных вирусами и бактериями, а также в связи с другими реакциями [24]. ].Чтобы выяснить, активирует ли fe-IRF1 сигнальный путь IFN- β , клетки CRFK котрансфицировали плазмидой fe-IRF1 и IFN- β (рис. 3(c)) или промотором ISRE (рис. 3(d)). репортер. Результаты показали, что сверхэкспрессия fe-IRF1 значительно повышала активность люциферазы по сравнению с клетками, трансфицированными пустым вектором, что свидетельствует о том, что fe-IRF1 активировал IFN- β и промотор ISRE. Фактически, трансфицированный fe-IRF1 может значительно повышать экспрессию мРНК ISG15 (в 500 раз), IFITM1 (в 40 раз) и Viperin (в 300 раз) (рис.С1).

    Результаты показали, что fe-IRF1 является фактором положительной обратной связи в ответе IFN типа I, запуская IFN- β и нижестоящий сигнальный путь.

    3.5. Инфекция FCV снижает экспрессию Fe-IRF1

    IRF1 может индуцироваться вирусной инфекцией для элиминации вирусной инфекции [23]. Поскольку сверхэкспрессия fe-IRF1 может ингибировать пролиферацию FCV F9, мы хотели узнать, может ли инфекция FCV индуцировать экспрессию IRF1. Чтобы определить, увеличивалась ли экспрессия IRF1 при инфицировании FCV, клетки инфицировали различными MOI в диапазоне от 0.001 к 1, а затем через 24 часа после заражения оценивали уровни белка клеточного IRF1 и FCV VP1. Результат показал, что уровень белка эндогенного fe-IRF1 снижался при вирусной инфекции в зависимости от дозы вируса (рис. 4(а)).

    Затем, чтобы выяснить, снижает ли инфекция FCV также снижение мРНК fe-IRF1, уровни мРНК fe-IRF1 проверяли с помощью количественного анализа RT-PCR в реальном времени. Мы обнаружили, что мРНК IRF1 также подавлялась при заражении FCV (рис. 4(b)).Эти результаты показали, что инфекция FCV приводила к снижению уровней как белка fe-IRF1, так и мРНК.

    3.6. Fe-IRF1 может также ингибировать другие кошачьи вирусы

    Чтобы выяснить, может ли fe-IRF1 также ингибировать репликацию других кошачьих вирусов, клетки F81, трансфицированные fe-IRF1, инокулировали с множественностью заражения 0,01 кошачьего герпесвируса (FHV), кошачьего вирус инфекционного перитонита (FIPV) и вирус панлейкопении кошек (FPV). Через 48 ч после инокуляции проверяли выход вируса. Результаты показали, что сверхэкспрессия fe-IRF1 может эффективно препятствовать репликации FPV (рис. 5(a)), FIPV (рис. 5(b)) и FHV (рис. 5(c)).Выход вируса снизился примерно на 1, 2,2 и 2 log (TCID50/мл) соответственно, что свидетельствует о том, что fe-IRF1 обладает противовирусной активностью широкого спектра.

    4. Обсуждение

    Система IFN играет важную роль в индукции экспрессии антивирусных белков, кодируемых интерферон-стимулируемыми генами [25]. Продукты этих ISG обладают многочисленными противовирусными эффекторными функциями, многие из которых до сих пор полностью не описаны [26]. В этом исследовании десять кошачьих ISG были клонированы и успешно экспрессированы, и с помощью скринингового анализа мы обнаружили, что эктопическая экспрессия только fe-IRF1 может значительно ингибировать репликацию FCV.IRF1 является не только важным ISG, но и ключевым транскрипционным регуляторным фактором [27] в регуляции транскрипции гена IFN- β [23]. Что еще более важно, заражение FCV может подавлять эндогенную экспрессию fe-IRF1, что предполагает новую стратегию уклонения от противовирусного ответа хозяина.

    IRF1 — транскрипционный фактор, регулирующий врожденный и адаптивный иммунный ответ [28]. Семейство IRF включает факторы транскрипции, которые регулируют экспрессию интерферона (IFN) и IFN-стимулированных генов (ISG), связываясь с элементами их промоторов [29, 30].IRF1 был первым известным членом семейства IRF, активирующим промотор IFN- β , и было обнаружено, что он конститутивно экспрессируется на низком базальном уровне в большинстве типов клеток [31]. Идентифицированный IRF1 млекопитающих конститутивно локализован в ядре [32, 33], но некоторые гомологи IRF1 рыб не локализованы строго в ядре [34].

    Мышиный IRF1 содержит две сигнальные последовательности ядерной локализации (NLS): 120RKERKSK и 132KSKTKRK. Было обнаружено, что последовательность из 24 аминокислот, содержащая обе последовательности, обеспечивает ядерную транслокацию IRF1 [35].N-концевые 125 аминокислот, кодирующие ДНК-связывающий домен (DBD), структурно и функционально консервативны среди белков семейства IRF [23]. Мы обнаружили, что fe-IRF1 имеет сигнальные последовательности для NLS и его домена DBD, которые также были консервативными. Мотив связывания консенсуса IRF1 (5'-G(A)AAA G/CT/C GAAA G/CT/C-3' [36]) появляется в восходящем направлении от нескольких IFN-стимулируемых генов (ISG) и может сильно активировать IFN- β и промотор ISRE своим доменом DBD, который может повышать экспрессию многих генов, таких как IFN- α / β , и многих генов ISG, таких как 2', 5'-OAS, протеинкиназа R [ 23] и Виперин [37]. Легко понять, почему IRF1 может эффективно ингибировать репликацию многих вирусов.

    мРНК IRF1 повышается в ответ на интерфероны, двухцепочечную РНК (дцРНК), цитокины, некоторые гормоны [23] и вирусную инфекцию [38], а затем способствует экспрессии антивирусных белков и ограничивает репликацию многих вирусов [28, 38, 39]. Однако, чтобы подорвать врожденный иммунитет, многие вирусы развили стратегию подавления экспрессии IRF1 [40]. В этом исследовании мы обнаружили, что инфекция FCV приводила к снижению уровней как белка fe-IRF1, так и мРНК, что не согласовывалось с предыдущим сообщением о том, что свиной IRF1 постоянно увеличивался в клетках, инфицированных TGEV [38].Члены многих различных семейств вирусов ингибируют экспрессию генов-хозяев в процессе репликации вируса, влияя на транскрипцию, процессинг, транспорт и трансляцию мРНК [41]. Калицивирусы также разработали различные стратегии, чтобы подорвать или отрегулировать механизм синтеза белка хозяина в своих интересах [42]. Было показано, что штамм F9 FCV отключает синтез белка-хозяина путем расщепления эукариотических факторов инициации трансляции eIF4GI и eIF4GII [43], что может быть одним из факторов снижения экспрессии fe-IRF1. Тем не менее, ни в одном сообщении не описывается подавление мРНК гена хозяина, опосредованное инфекцией FCV, что является новой стратегией FCV для подавления противовирусного ответа хозяина. Точный механизм еще предстоит изучить.

    В заключение мы впервые демонстрируем, что fe-IRF1 ингибирует репликацию FCV и других кошачьих вирусов. Мы также предоставили доказательства того, что инфекция FCV подавляет экспрессию IRF1 за счет снижения уровня мРНК fe-IRF1, что подчеркивает потенциальную стратегию уклонения от иммунитета для FCV.

    Доступность данных

    Данные, использованные для поддержки результатов этого исследования, можно получить у соответствующего автора по запросу.

    Конфликт интересов

    Авторы заявляют об отсутствии финансовых или коммерческих конфликтов интересов.

    Вклад авторов

    Юнсян Лю и Сяосяо Лю внесли равный вклад в эту работу.

    Благодарности

    Эта работа финансировалась Национальным фондом естественных наук Китая (грант №. 31770172).

    Дополнительные материалы

    Рисунок S1 : fe-IRF1 повышает экспрессию мРНК ISG15, IFITM1 и Viperin. Клетки CRFK трансфицировали 500 нг/лунку pMyc-IRF1. Через 24 ч после трансфекции экспрессию мРНК ISG, IFITM1 и Viperin определяли методом qRT-PCR. Столбики погрешностей представляют собой стандартные отклонения, и каждый образец анализировали в трех экземплярах: P<0,05; : Р<0,01. (Дополнительные материалы)

    Протокол вакцинации кошек | Больница для домашних животных и оздоровительный центр Westridge

    Действительно ли кошкам нужна вакцинация против FVRCP?

    Это плановая вакцинация, которую ежегодно делают бесчисленному количеству кошек и котят.Прививка FVRCP борется с тремя кошачьими вирусами: ринотрахеитом, калицивирусом и панлейкопенией. Вакцина названа в честь вирусов: «FVR» для кошачьего вирусного ринотрахеита; «С» — калицивирусная инфекция и «П» — панлейкопения (чумка). Зная больше об этих болезнях и угрозах, которые они представляют для вашей кошки, вы поймете, почему кошки нуждаются в защите от них. Вот почему прививка FVRCP так важна для здоровья вашей кошки:

    Ринотрахеит , вызываемый вирусом кошачьего герпеса, является распространенным вирусом, поражающим слизистую оболочку носа, придаточные пазухи, горло, трахею и глазные оболочки.Признаки включают чихание, выделения из носа, слюнотечение, лихорадку, вялость и заметную потерю аппетита. Кошка также может щуриться, из глаз выделяется слизь. Если у кошки разовьется герпесная язва в глазах, ему потребуется интенсивное лечение, включая внутривенное введение жидкости и возможное принудительное кормление, чтобы предотвратить смерть от обезвоживания и голодания.

    Калицивирус — это распространенная респираторная инфекция, поражающая горло, глаза, носовые ходы, рот и иногда легкие, кишечник и опорно-двигательный аппарат кошек.Симптомы включают насморк, чихание, выделения из носа, лихорадку, слюнотечение и язвы на языке или небе. В тяжелых случаях может развиться пневмония. Котята и пожилые кошки подвержены большему риску смерти от калицивируса, чем здоровые взрослые кошки.

    Панлейкопения , также называемая чумой кошек, представляет собой высококонтагиозный вирус, поражающий клетки крови в кишечном тракте, костном мозге, головном мозге и развивающемся плоде. Панлейкопения чаще всего наблюдается у котят в возрасте от четырех до шести месяцев. Панлейкопения может поразить любую непривитую кошку.Симптомы включают лихорадку, вялость, отсутствие аппетита и рвоту. Диарея с кровью или слизью в сочетании с рвотой вызывает сильное обезвоживание, и кошка может умереть в течение 12 часов после начала.

    Насколько распространены эти заболевания?

    Ринотрахеит чаще всего встречается у кошек с ослабленной иммунной системой или у кошек с физическим или эмоциональным стрессом. Кошки в приютах часто болеют ринотрахеитом, испытывая стресс от скученности, но генетически более предрасположены чистокровные и длинношерстные кошки.Они заражаются от инфицированных кошек, которые чихают или кашляют в окружающей среде, или от людей, которые не моют руки между контактами с кошками.

    Калицивирус также чаще всего встречается в приютах, а также в питомниках и домах с несколькими кошками. Плохо проветриваемые помещения способствуют распространению калицивируса. Отсутствие вакцинации или пониженный иммунитет подвергают кошку риску, и хотя кошки любого возраста восприимчивы, наиболее уязвимы молодые котята. Возникновение калицивируса происходит внезапно, и поскольку он настолько заразен, что если им заразится одна кошка, все кошки в доме или приюте, скорее всего, заразятся им.

    Панлейкопения широко распространена и может привести к летальному исходу. Почти каждая кошка, дома или на улице, вступает в контакт с ним через выделения других животных или от людей, которые контактируют с инфицированными кошками. Невакцинированные кошки наиболее уязвимы, особенно опасны котята, поскольку их иммунная система неразвита.

    Почему домашним кошкам нужны прививки от FVRCP:

    Все кошки, даже живущие в помещении, которые никогда не выходят на улицу и не взаимодействуют с другими кошками, должны получать прививки FVRCP. Эти заболевания передаются воздушно-капельным путем, поэтому каждая кошка должна быть вакцинирована от них. Первые прививки, сделанные котятам, помогают им выработать иммунитет. Ежегодные бустерные прививки FVRCP, обычно проводимые при кошачьей лейкемии (FeLV) и бустерах против бешенства, помогают иммунной системе кошки оставаться готовой реагировать на заболевание. Если домашняя кошка — единственная кошка в вашем доме, ее никогда не держат в питомнике, она не выходит на улицу и не контактирует с другими кошками, в том числе с кошками ваших друзей, ваш ветеринар может определить, что ревакцинация каждые два-три года будет продолжаться. кот здоров.

    Калицивирус у кошек - Cat-World

    Последнее обновление 6 июня 2021 г., автор: Джулия Уилсон


    Краткий обзор

    О: Калицивирус — это распространенная вирусная инфекция, вызывающая симптомы гриппа у кошек. Наибольшему риску подвержены котята, пожилые и ослабленные кошки.

    Передача: Прямой контакт с воздушно-капельным путем от инфицированной кошки и зараженных поверхностей, таких как миски для корма и подстилки (фомиты).

    Симптомы: Калицивирус вызывает у людей симптомы, сходные с симптомами обычной простуды, в том числе; лихорадка, выделения из носа и глаз, чихание, язвы во рту, потеря аппетита, вялость, красные десны и хромота.

    Диагноз: Полный медицинский осмотр, сопутствующие симптомы и анамнез. Базовые тесты, такие как биохимический профиль, общий анализ крови и анализ мочи, чтобы оценить общее состояние здоровья вашей кошки. В большинстве случаев диагноз калицивируса ставится на основании имеющихся симптомов.

    Лечение: Поддерживающий уход, такой как жидкости и питание, пока ваша кошка борется с инфекцией. Антибиотики при наличии вторичной инфекции. Не допускайте попадания выделений из глаз и носа.

    Что такое кошачий калицивирус?


    Калицивирус кошек

    Калицивирус (FCV) — это распространенная вирусная инфекция, обнаруживаемая у кошек, которая характеризуется наличием гриппоподобных симптомов, таких как инфекция верхних дыхательных путей. Он является членом семейства Caliciviridae.

    80 – 90% всех респираторных заболеваний кошек вызваны кошачьим калицивирусом или вирусом кошачьего ринотрахеита (вирусом кошачьего герпеса). Двойная инфекция как кошачьим калицивирусом, так и кошачьим герпесвирусом встречается относительно часто.[1] Калицивирус обычно поражает горло, глаза, полость носа и ротовую полость у кошек, хотя иногда также могут поражаться легкие, опорно-двигательный аппарат и кишечник.

    У здоровой взрослой кошки уровень смертности относительно низок; однако котята, пожилые кошки и кошки с ослабленным иммунитетом подвергаются повышенному риску. Кошачий калицивирус часто встречается в приютах и ​​местах с большим скоплением людей. Географическое распространение калицивируса у кошек распространяется по всему миру.

    Передача

    Заражение происходит через прямой контакт , аэрозоль или фомиты (например, полы, миски для еды, одежда, лица, осуществляющие уход).

    Прямой контакт и аэрозоль:

    Наиболее распространенным путем передачи инфекции является прямая передача от инфицированной кошки. Вирус размножается в дыхательных путях и тканях полости рта и выделяется с выделениями из полости рта, глаз и носа, а также с мочой и фекалиями.

    Непрямой контакт и кошки-носители:

    • Загрязненные миски для корма, лотки для туалета, полы, постельные принадлежности, лица, осуществляющие уход, и т. д. Калицивирус устойчив ко многим дезинфицирующим средствам и может жить в окружающей среде в течение нескольких недель.
    • Кошки могут оставаться носителями в течение многих лет после заражения, а это означает, что даже если они заразились вирусом, заболели и выздоровели, вирус все еще выделяется с выделениями, и есть возможность заразить других кошек.

    После того, как кошка выздоровеет от калицивируса, она либо перестанет выделять вирус через две-четыре недели, либо станет хроническим носителем и время от времени выделяет вирус, особенно в стрессовые периоды или во время болезни. Эти кошки-носители могут проявлять или не проявлять симптомы во время линьки.

    Симптомы


    Инкубационный период калицивируса составляет от 2 до 6 дней.

    Некоторые штаммы калицивируса могут поражать кошек, и симптомы различаются в зависимости от вирулентности конкретного вируса, вызывающего инфекцию. Некоторые штаммы могут вызывать только легкие симптомы, другие — тяжелые.

    • Sheezing

      0

    • Sheezing
    • CONASTIVITINE
    • Назальный разряд
    • Оцеляционный (глаз)
    • Окумулярный (глаз)
    • Rhinitite (воспаление слизистых оболочек Nasal)
    • Salativate
    • Изъяварование языка и вкуса
    • воспаление десен
    • Пневмония может развиваться при наличии более вирулентных штаммов калицивируса
    • Калицивирус может вызывать транзиторный артрит суставов у некоторых инфицированных кошек, приводящий к хромоте (известный как синдром хромоты ), который наблюдается как при калицивирусе, так и после вакцинации. [2]

    Вторичные бактериальные инфекции могут осложнять кошачий калицивирус. У кошки нередко развивается анорексия (потеря аппетита) и обезвоживание, которые могут еще больше ослабить уже больную кошку.

    Вирулентный системный калицивирус кошек

    Существует особенно вирулентная форма, известная как « вирулентный системный калицивирус кошек или VS-FCV » со смертностью 40%.

    Многие симптомы также включают поражение верхних дыхательных путей, а также выделения из глаз, отек лица и конечностей, выпадение волос и изъязвление ушей, лица и стоп, желтуху и, в конечном итоге, полиорганную недостаточность.

    Диагностика


    Герпесвирус кошек и калицивирус кошек составляют 80–90% всех респираторных заболеваний кошек.

    • Если имеются язвы во рту, наиболее вероятен калицивирус.
    • Если в глазах присутствуют язвы роговицы, наиболее вероятен герпесвирус.

    Для выявления возбудителя могут потребоваться специальные тесты. Не все ветеринары рекомендуют эти тесты, так как лечение вирусных инфекций верхних дыхательных путей в основном одинаковое.

    • Полимеразная цепная реакция и/или выделение вируса.
    • Серология для выявления антител к коронавирусу. Однако это создает две проблемы. 1) Если ваша кошка в прошлом подвергалась воздействию коронавируса (и помните, существует много штаммов), у него будут антитела. 2) Выработка антител кошкой после заражения может занять до семи дней, поэтому тест может дать ложноотрицательный результат.

    Лечение


    Лечение обычно является поддерживающим, пока иммунная система вашей кошки борется с инфекцией.В настоящее время нет доступных противовирусных препаратов для лечения калицивируса. Госпитализация будет необходима для сильно пораженных кошек; однако большинство кошек получают амбулаторное лечение.

    Медицинская терапия:
    • Антибиотики широкого спектра действия для лечения вторичных инфекций.
    • Противовоспалительные средства для снижения температуры и облегчения симптомов хромоты и язв.
    • Кортикостероиды для снятия воспаления, связанного с транзиторным артритом.
    • Глазные капли с антибиотиком.
    • Интерферон — противовирусный препарат, который показал снижение тяжести и продолжительности клинических признаков, связанных с вирусом.
    Поддерживающая терапия:
    • Жидкости для предотвращения или лечения обезвоживания.
    • Кислородная терапия для кошек с затрудненным дыханием.
    • Очистите выделения из носа и глаз влажной марлей, смоченной физиологическим раствором.
    • Если у кошки есть язвы во рту, предлагайте мягкую пищу, перегруженные кошки часто не могут чувствовать запах, подогрейте пищу, чтобы стимулировать аппетит, если у кошки началась анорексия, может потребоваться принудительное кормление.
    • Повышенная влажность может помочь перегруженной кошке.

    Обновление, январь 2019 г. : Winn Feline Foundation недавно опубликовал отчет об использовании двух препаратов, подавляющих репликацию вируса. Нитазоксанид является противопаразитарным и противовирусным препаратом широкого спектра действия и аналогом нуклеозида, 2'-C-метилцитидином (2CMC). Оба препарата имеют желудочно-кишечные побочные эффекты; тем не менее, комбинация двух препаратов в более низких дозах, чтобы избежать побочных эффектов, является многообещающей в качестве будущего лечения FCV.

    Кошки могут выделять вирус в течение 30 дней после заражения, а в некоторых случаях и до конца жизни.

    Дезинфекция


    Дезинфекция жизненно необходима, поскольку калицивирус может оставаться заразным в окружающей среде до 28 дней.

    Продукт Bleach Виркон Trifectant9 полигексанид 9 0488
    Активный ингредиент Скорость Разбавление Время контакта
    гипохлорит натрия 1:32 1 минуту
    Калий peroxomonosulfate 1:10 10 минут
    калия peroxomonosulfate 1: 100 10 минут

    спасательные Ускоренное Перекись водорода
    Ускоренное Перекись водорода 1:16 (концентрат) 2 минуты 2 минуты
    этанол 75% - 10 минут
    1:50 10 минут
    Безопасность
    • Дезинфицирующие средства могут раздражать дыхательные пути, глаза и кожу. Всегда применяйте в хорошо проветриваемом помещении и надевайте защитную одежду.
    • Следуйте инструкциям производителя по правильному разбавлению и времени воздействия.
    • Промойте там, где люди и/или кошки будут вступать в непосредственный контакт с поверхностью, такой как клетки и миски для корма.
    • Некоторые дезинфицирующие средства дезактивируются при контакте с органическими веществами; поэтому необходимо физически удалить органический материал перед дезинфекцией поверхностей.
    • Дайте поверхности полностью высохнуть.
    • Не смешивайте дезинфицирующие средства без соответствующих указаний.

    Профилактика

    • Плановая вакцинация вашей кошки. Вакцины могут помочь уменьшить тяжесть заболевания, но не смогли снизить его распространенность. Давать в возрасте 8, 12 и 16 недель.
    • Избегайте перенаселенности кошачьих популяций и снижайте уровень стресса. Чем больше кошек в окружающей среде, тем выше риск возникновения калицивируса.

    Добавить комментарий

    Ваш адрес email не будет опубликован.