Перейти к содержимому

Овцы курдючные: Ошибка 404. Страница не найдена — Объявления на сайте Авито

Содержание

описание с фото, содержание и разведение породы

Основной целью разведения овец в Казахстане, Средней Азии, на Кавказе и в некоторых регионах России является получение мяса и сала. Поэтому особенной популярностью в этих местностях пользуются курдючные овцы и бараны. Эти породы имеют особенное строение тела. Жировые отложения формируются у них в задней части шарообразной формы – курдюке.

Содержание статьи

История происхождения

Первые упоминания о породах курдючных овец относятся к 3 веку до нашей эры. Разведением этих животных занимались жители территорий современной Средней Азии. В Европе овец, способных стать поставщиками не только мяса, но и сала, в те времена не было. Существовали курдючные бараны в суровых условиях. Даже при скудном питании, минимальном количестве воды эти породы вырабатывали способность набирать вес, и эти черты закреплялись у них на генетическом уровне.

 

Кочевые народы отдавали предпочтение именно этим породам овец, поскольку они не только служили источниками мяса и большого количества сала, но и обладали повышенной выносливостью. Курдючные овцы выдерживали многодневные переходы и практически не уставали, могли жить в условиях значительных перепадов температуры.

Особенности и внешний вид породы с фотографиями

Описание породы курдючных овец следует начать с самой яркой черты – жирового мешка, расположенного на крупе животных – курдюка. Эта часть тела от природы выполняет функции, аналогичные верблюжьему горбу. В курдюке откладывается жир, предназначающийся для накапливания питательных веществ, которые животные могут использовать в случае засухи. Благодаря курдючному жиру бараны этой породы могут существовать и нормально чувствовать себя без пищи и воды до трёх суток.

[adsp-pro-4]

Всё строение тела курдючных баранов отличается от мясо-шерстных и мясных пород овец:

  • Маленькая голова с висячими ушами, без рогов. Голова такого размера выглядит не пропорциональной по отношению к достаточно массивному телу.
  • Корпус коренастый. Высота в холке – 100-110 сантиметров.
  • Окрас шерсти разнообразный: от белого до тёмно-коричневого. Шерсть однородная. Без вкраплений другого цвета. Наиболее распространены овцы рыжей и коричневой окраски.
  • Хвост длиной около 9 сантиметров, покрыт шерстью.
[Not a valid template]

По характеру курдючные овцы пугливые. Отара может разбежаться от громкого звука или появления посторонних людей или животных. Собирать отару должен вожак. Это может быть собака, лошадь или человек. Среди животных вожаков не бывает.

Разновидности курдючных овец

Количество разновидностей курдючных овец не особенно изменилось со времён их первоначального появления.  Объясняется это специфичностью продукции, которую можно получить от этой породы. Курдючное сало практически не используется в кулинарии европейцев, поэтому смысла выведения новых разновидностей не было.

В настоящее время существуют следующие основные разновидности курдючных баранов:

Какую продукцию дают овцы и бараны

Курдючные овцы – животные универсальной продуктивности.

От них можно получить:

  • Мясо. Курдючные овцы набирают массу тела быстрыми темпами. К 6-7 месяцам ягнята вырастают до половины размера взрослого животного. Мясо у породы диетическое, активно используется в повседневной кухне.
  • Сало (курдючный жир). Традиционно используется в азиатской кухне и как лечебное средство при кашле, болезнях суставов, простуде, при ослабленном иммунитете. Курдючный жир – отличный консервант, традиционно использовавшийся для сохранения продуктов в условиях повышенных температур воздуха.
  • Шкура.
    Используется в производстве обуви и одежды.
  • Шерсть. Жёсткая и грубая, поэтому пригодна для производства ковров, войлока, одеял.
  • Молоко. Матка в среднем за период лактации даёт 100-110 килограммов молока. Из него изготавливают сыр, масло, кисломолочные напитки.

Важно. Продуктивный период курдючных овец составляет максимум 10 лет. Хотя животные являются долгожителями (25 лет), больше 10 лет их держать в стаде не рекомендуется, так как продуктивность, начиная с восьмого года жизни, резко снижается.

От курдючных овец получают мясо, сало, молоко, шкуру и шерсть.

Правила ухода и содержания

Курдючные овцы традиционно содержатся стадами от 20 голов, что является экономически выгодным. Для выращивания стада необходима пастбищная территория, на которой животные проводят основное время в течение дня. Для выпаса этой породы подходит любая территория, но болотистая и лесная местность для них противопоказана.

[adsp-pro-5]

На свободном выпасе курдючные овцы находятся 200 дней в году: с ранней весны до поздней осени.  На месте выпаса отара может находиться круглосуточно. Для ночёвки для них сооружается дощатый загон, по возможности с навесом для защиты от дождя. Для выпаса отаре необходима охрана. Пастухи часто в качестве помощника используют обученных собак.

В зимний период овцы содержатся в кошаре или овчарне. Главные требования к помещению – тепло (не ниже 8 градусов) и сухость. При влажном воздухе у животных развивается болезнь суставов и простуды. Подстилка в помещении всегда должна быть сухая и чистая. Кошару необходимо периодически проветривать, не допуская сквозняков. Окна и двери помещения располагают на южной, юго-западной или юго-восточной стороне.

В теплое время года овцы весь день проводят на пастбище.

Важным моментом ухода за курдючными баранами является поддержание чистоты тела и шерсти. Животным необходима ежегодная стрижка, которую проводят весной или в середине лета. Перед стрижкой животных купают из садового шланга или загоняют в неглубокий водоём.  2-3 раза в год овцам подрезают копыта.

Не реже 2 раз в год овцам необходимы профилактические осмотры ветеринара. С той же периодичностью проводится глистование и обработка шерсти от паразитов.

Правила кормления и рацион питания

Основу рациона курдючных баранов составляет свежая луговая трава. Зимой овец кормят сеном (2 кг в сутки) и зерновых смесей (500 граммов). Сено можно заменить соломой. Питание овощами способствует росту веса животных, укреплению их иммунитета, улучшает состояние зубов. Животным полезно скармливать картофель, морковь, свёклу.

Примерное зимнее меню овец состоит из следующих компонентов:

  • Сено из бобовых и злаковых растений – 2-2,5 кг.
  • Сочный корм, силос – 1-1,5кг.
  • Концентрированные корма – 600-800 гр.

Важно. Курдючным баранам нельзя давать траву, которая скошена в лесной или болотистой местности.

Основной пищей курдючных баранов является трава.

Некоторая разница существует в особенностях кормления овец и баранов:

  • Маткам в период лактации дают 300 гр концентрированного корма.
  • Баранам необходимо повышать питательность корма и одновременно снижать его количество, чтобы самец не зажирел. Во время спаривания бараны должны получать повышенное количество белка, поэтому в его рацион включают молоко и яйца. Дополнительно корм для барана витаминизируют.

Особенности разведения

Разведение курдючных овец не вызывает никаких трудностей. Главное условие – спаривать особей достигших половой зрелости (8-9 месяцев) и не имеющих проблем со здоровьем. Для оплодотворения самок в отаре держат 2-3 половозрелых барана и 2 запасных. Производителей отбирают дважды: в 3 месяца и в год.

[adsp-pro-6]

Оптимальное время для случки – поздняя осень. Беременность матки длится 145 дней. В помёте бывает от 2 до 5 ягнят. Окот происходит легко и без постороннего вмешательства. После рождения ягнят их не забирают от матери, но необходимо тщательно очистить мордочку от слизи.

Выживаемость ягнят этой породы высокая. Малыши выходят на пастбище вместе с матерью уже на вторые сутки после окота. При создании условий для правильного питания уже к 6 месяцам ягнёнок набирает вес в 50-60 килограммов.

Ягнята курдючных пород выходят на пастбища уже на второй день жизни.

Важно. Если в помёте более 2 ягнят, матки часто не справляются с их кормлением. В этом случае некоторых ягнят передают другой овце, к примеру, которая потеряла ягнят во время окота. При отсутствии подходящей кандидатуры ягнят вскармливают искусственно.

Преимущества породы

Курдючные бараны и овцы отличаются от остальных пород следующими преимуществами:

  • Повышенная выносливость – в день эти животные могут пройти до 500километров.
  • Неприхотливость в питании – животные могут постоянно питаться исключительно подножным кормом и прибавлять вес. Недостаток питания абсолютно не сказывается на здоровье и плодовитости овец, благодаря запасам сала в их курдюке.
  • Повышенная плодовитость самок – за один окот матка приносит не менее 2 ягнят. Окот проходит без проблем и участия человека не требуется.
  • Быстрый набор веса.
  • Приспособленность к любому температурному режиму.

Минусов у породы практически нет. Единственным недостатком является полное отсутствие навыка ориентации на местности. Если овца или баран отобьются от стада, самостоятельно дорогу домой они не найдут.

Овцы курдючных пород плохо ориентируются на местности.

Популярность в России

В России курдючные породы овец не особенно популярны, поскольку использование их сала свойственно исключительно азиатским народам. Но в последнее время овцеводы оценили повышенную продуктивность животных этой породы, и курдючные бараны становятся популярными. Чаще всего их разводят в южных регионах страны.

Однако порода идеально подходит для климата северных регионов. Быстрые темпы роста животных в сочетании с качеством мяса и молока и приспособленностью к неблагоприятному климату делает разведение этой курдючных овец выгодным в экономическом плане.

Предлагаем к просмотру видео, на котором рассказывается о курдючных породах овец.

КУРДЮЧНЫЕ ОВЦЫ • Большая российская энциклопедия

  • В книжной версии

    Том 16. Москва, 2010, стр. 403

  • Скопировать библиографическую ссылку:


Авторы: А. М. Жиряков

Курдючная овца.

КУРДЮ́ЧНЫЕ О́ВЦЫ, груп­па гру­бо­шёр­ст­ных и по­лу­гру­бо­шёр­ст­ных по­род овец мя­со-саль­но­го на­прав­ле­ния, ха­рак­те­ри­зую­щих­ся на­ли­чи­ем кур­дю­ка. Кур­дюк (от тюрк. kuyruk – хвост) пред­став­ля­ет со­бой под­кож­ные жи­ро­вые от­ло­же­ния у кор­ня хво­ста, на кре­ст­це в ви­де «по­душ­ки» мас­сой 15–20 кг и бо­лее (макс. ок. 50 кг). Спо­соб­ность К. о. в бла­го­при­ят­ные по кор­мо­вым ус­ло­ви­ям пе­рио­ды ре­зер­ви­ро­вать жир в кур­дю­ке вы­ра­бо­та­лась как при­спо­соб­ле­ние к оби­та­нию в ус­ло­ви­ях су­хих сте­пей, по­лу­пус­тынь, пус­тынь и вы­со­ко­го­рий. Кур­дюч­ный жир рас­хо­ду­ет­ся ов­ца­ми при не­дос­тат­ке кор­ма (ко­гда тра­ва вы­го­ре­ла или по­кры­та сне­гом), а так­же во вре­мя пе­ре­бо­ев с во­до­по­ем. К. о. круп­ные (напр., жи­вая мас­са ба­ра­нов гис­сар­ской по­ро­ды мо­жет пре­вы­шать 190 кг), креп­кой кон­сти­ту­ции, с глу­бо­кой и ши­ро­кой гру­дью, креп­ки­ми но­га­ми и хо­ро­шо раз­ви­той мус­ку­ла­ту­рой.

Го­ло­ва уз­кая, час­то гор­бо­но­сая. К. о. ско­ро­спе­лы: яг­ня­та к отъ­ё­му (в 4 мес) ве­сят 35–40 кг, а по­сле от­кор­ма (в 6 мес) – 55–60 кг. Шёр­ст­ная про­дук­тив­ность низ­кая, шерсть не­од­но­род­ная, низ­ко­го ка­че­ст­ва. К. о. рас­про­стра­не­ны в рес­пуб­ли­ках Ср. Азии, Ка­зах­ста­не и ря­де др. стран Азии и Аф­ри­ки. В РФ К. о. (гл. обр. эдиль­ба­ев­ской по­ро­ды) раз­во­дят в Ас­т­ра­хан­ской, Вол­го­град­ской, Са­ра­тов­ской об­лас­тях и в Кал­мы­кии.

Результаты создания новой породы курдючных мясосальных овец с шерстью белого и светло-серого цветов | Жумадиллаев

Актуальность. Увеличение спроса на внутреннем и внешнем рынках на  высококачественную, экологически чистую баранину и ягнятину, а также на грубую  осветленную шерсть, особенно дефицитных белого и светло-серого цветов, шубно- меховую овчину, определяет актуальность научного обеспечения отечественного курдючного овцеводства в целом.

Материал и методика. В статье приведены результаты исследований по созданию  новой породы курдючных мясо-сальных овец в восточном, юго-восточном и западном регионах Казахстана. Животные новой породы удачно сочетают высокие мясные качества с неоднородной белого и светло-серого цветов шерстью, отличаются хорошей приспособленностью к условиям пастбищного содержания в зонах пустынь, полупустынь и предгорно-сухостепных зон.

Результаты. Средняя живая масса баранов производителей селекционных стад, в зависимости от хозяйств разведения составляет 95,4–97,8 кг, настриг шерсти — 3,34–3,38 кг, у маток — соответственно 66,0–66,8 и 2,28–2,32 кг. Средняя живая масса баранчиков при рождении, колеблется в пределах 4,8–5,0 кг и при отбивке — 37,7–38,6 кг, среднесуточный прирост живой массы за подсосный период развития составляет 274–280 г, эти показатели у ярочек равняются соответственно 4,6–4,8 кг, 36,0–36,7 кг и 262–266 г. В возрасте 4 месяца масса туши с курдюком у баранчиков создаваемой породы составляет 18,49–19,03 кг, в 16 месяцев — 33,46–33,77 кг, убойный выход колеблется соответственно в пределах 52,3–53,1 и 52,5–52,9%, выход мякоти в туше — 79,3–79,8 и 80,2–80,6%. Эти данные показывают, что по убойным и мясным качествам баранчики  новой создаваемой породы не уступают сверстникам таких пород, как едилбайская, сарыаркинская и т. д. Исследования, проведенные в лаборатории шерсти НИИ  овцеводства им. К.У. Медеубекова, показали, что осветленная шерсть овец создаваемой породы по физико-механическим свойствам имеет некоторые различия в сравнении с казахскими курдючными грубошерстными овцами. Их шерсть можно отнести к новой 
разновидности грубой шерсти овец, разводимых в Казахстане. Такая шерсть по сравнению с шерстью курдючных грубошерстных овец имеет лучшие технологические свойства.

Сравнительная характеристика продуктивных особенностей курдючных овец Калмыкии Текст научной статьи по специальности «Животноводство и молочное дело»

УДК 636.32/38 СРАВНИТЕЛЬНАЯ ХАРАКТЕРИСТИКА ПРОДУКТИВНЫХ ОСОБЕННОСТЕЙ КУРДЮЧНЫХ ОВЕЦ КАЛМЫКИИ Ю.А. Юлдашбаев Б.К. Салаев

РГАУ-МСХА имени К.А.Тимирязева

Изучена продуктивность курдючных овец Калмыкии в сравнительном аспекте по основным хозяйственно полезным признакам (новой калмыцкой курдючной породы и местными эдильбаевскими

курдючными овцами). Курдючные бараны имели массу от 83,7 до 89,6кг, а матки - 59,1-63,5 кг. Настриг немытой шерсти по баранам калмыцкой курдючной породы составил 3,1 кг, что на 0,5кг больше, чем по сверстникам. По группе маток (2,2кг) разность составила 0,4 кг, по яркам - 0,3 и баранчикам - 0,4 кг соответственно. Воспроизводительные свойства калмыцких курдючных маток несколько выше, чем по эдильбаевским местным

курдючным маткам. Курдючные овцы соответствуют высоким требованиям инструкции по бонитировке и относятся к классам элита и первый. Курдючные овцы, разводимые в условиях Калмыкии, имели высокие показатели по продуктивным и воспроизводительным качествам и соответствовали требованиям стандарта для грубошерстных мясосальных овец.

Ключевые слова: курдючные овцы, живая масса, настриг шерсти,

UDC 636.32/.38.086.2 COMPARATIVE CHARACTERISTIC OF PRODUCTIVE FEATURES IN FAT-RUMPED SHEEP OF kALMYKIA

Yuldashbaev Yu.A. Salayev B.K.

PSAU-MAA named affer K.A. Timiryazev

It was studied the productivity of fat-rumped sheep of Kalmykia in a comparative perspective on major economic useful features (the new Kalmyk fat-rumped sheep breed and local edilbaevskaya fat-tail sheep). Fat-rumped rams had weight from 83,7 to 89.6 kg, and the ewes' weight was 59.1-63.5 kg.

Clipped greasy wool on the rams of Kalmyk fat-rumped breed was 3.1 kg, 0.5 kg more than on the herd mates. In the group of ewes (2.2 kg) the difference was 0.4 kg, in ewe lambs 0.3 and in the young rams 0.4 kg, respectively.

Reproductive features of the Kalmyk sheep ewes are higher than in edilbaevskaya local sheep ewes. Fat-rumped sheep meet the high requirements of the animal judging instruction and belong to the elite and first class.

Fat-rumped sheep bred in Kalmykia had high indicators on productive and reproductive qualities and meet the requirements of the standard for coarse mutton-fat sheep.

Key words: fat-rumped sheep, live weight, wool clip, reproductive

воспроизводительные показатели, indicators, survival rate, sex and age

сохранность, половозрастная group

группа

Овцеводство Калмыкии - это традиционная, исторически сложившаяся отрасль животноводства. По данным Федеральной службы статистики, поголовье овец в хозяйствах всех категорий составило 2346,1 тыс. голов. Развитию ведущей в республике отрасли животноводства способствует наличие обширных естественных кормовых угодий, расположенных в зоне сухих степей и полупустынь площадью 5,2 млн га.

Разведение курдючных овец в Калмыки имеет важное народнохозяйственное значение. Содержание и разведение таких овец даёт возможность использовать овцеводческим хозяйствам этого региона пастбища, не используемые или плохо поедаемые мериносами [1].

В современных экономических условиях развития овцеводства одним из перспективных путей повышения производства баранины является развитие грубошерстного мясосального овцеводства [3,7].

Научная разработка и изучение общих закономерностей онтогенеза представляют большой интерес и будут способствовать не только увеличению производства ягнятины, но и совершенствованию пород овец, в том числе калмыцкой курдючной и местной эдильбаевской, потенциальные генетические возможности которой еще недостаточно изучены, а также позволят оптимизировать сроки убоя с пищевой и экономической точки зрения.

Комплексное изучение продуктивных особенностей новой калмыцкой курдючной породы (апробирована в 2012 году), в сравнительном аспекте с исходными местными эдильбаевскими курдючными овцами, актуально и имеет как научную, так и практическую значимость.

Цель исследований. Основной целью разведения курдючных овец является получение высокой мясной продуктивности в сочетании с хорошей шерстью [2,4]. Именно у животных новой калмыцкой курдючной породы удалось закрепить оптимальное сочетание мясной и шерстной продуктивности с их хорошей устойчивостью к суровым климатическим условиям, нежели у местных эдильбаевских овец [6].

В процессе создания и консолидации овец новой породы курдючных овец с белой шерстью большое внимание уделялось изучению признаков и свойств, характеризующих мясные, сальные и шерстные качества животных [5].

Методика и материал исследований. Экспериментальная часть работы проводилась в ОАО СПК «Кировский» Яшкульского района и учхозе Калмыцкого государственного университета.

Материалом для исследований послужили животные курдючных пород: калмыцкой курдючной, эдильбаевской (местной популяции). На протяжении всего эксперимента подопытные животные находились в

одних хозяйственных условиях кормления и содержания. Поголовье баранов-производителей представлено типичными животными, которые при бонитировке были оценены классом элита, матки в возрасте 3-4 лет - первого класса.

Основной кормовой базой овец в хозяйстве являются естественные пастбища, на которые приходится 70-80% годового рациона, около 7-10 % составляют концентрированные корма и 12-17 % грубые корма. В хозяйстве используется пастбищно-стойловая система содержания животных, пастбищный период в Калмыкии составляет 285 дней в году.

Результаты исследований. Живая масса, уровень шерстной продуктивности и ее качество, показатели воспроизводства являются важнейшими селекционируемыми признаками при отборе. Полученные данные при бонитировке продуктивных особенностей овец разного происхождения и половозрастных групп и представлены в таблице.

Бараны-производители калмыцкой курдючной породы имеют хорошую живую массу - 89,6 кг, а матки - 63,5 кг. Живая масса ярочек составляет 50,4 кг, что равняется 79,4% от массы взрослых маток, т.е в возрасте одного года ярки почти достигают уровня продуктивности взрослых животных. Живая масса баранчиков составила 63,3кг, что соответствует 70,6% от массы взрослых баранов.

Эдильбаевские местные курдючные овцы несколько уступали по живой массе сверстникам по всем половозрастным группам. Так, бараны имели массу 83,7кг, что на 5,9 кг, или 6,6 % меньше, чем у сверстников калмыцкой курдючной породы овец. Матки уступали сверстницам на 4,4 кг, или на 7%. Такая же тенденция и по молодняку сравниваемых групп животных.

В целом необходимо отметить, что сравниваемые группы курдючных овец - это крупные животные, имеющие хорошие показатели продуктивности по живой массе и соответствующие по данному признаку требованиям стандарта для грубошерстных мясосальных овец.

Таблица - Показатели продуктивности и воспроизводства курдючных овец__

Показатель Порода

калмыцкая курдючная эдильбаевские местные

Живая масса, кг

Половозрастная группа:

бараны 89,6±0,46 83,7±0,41

матки 63,5±0,23 59,1±0,24

баранчики 63,3±0,24 58,3±0,24

ярочки 50,4±0,26 46,5±0,25

Настриг шерсти, кг

Половозрастная группа:

бараны 3,1±0,06 2,6±0,05

матки 2,2±0,03 1,9±0,03

баранчики 2,3±0,02 1,9±0,03

ярочки 1,9±0,03 1,6±0,03

Воспроизводительные качества маток:

Число маток на начало ягнения 150 151

Кол-во объягнившихся маток, гол. % 135 90 130 86,1

Получено ягнят, гол. 170 158

Падеж ягнят за период ягнения, гол. % 8 4,7 7 4,4

Получено живых ягнят, гол. 162 151

На 100 маток:

на начало ягнения, % 113,3 104,6

на объягнившуюся матку, % 125,9 121,5

Сохранность к отъему, гол. % 160 98,8 149 98,7

В курдючном овцеводстве шерстная продуктивность и качество шерсти играют не столь определяющую роль, нежели мясная продуктивность. Однако количественные и качественные показатели, имея определенную корреляцию с продуктивными особенностями, имеют место быть изучены, особенно при создании овец новых пород и типов.

Наибольшими настригами шерсти, по сравнению с другими половозрастными группами, характеризуются взрослые бараны-производители. Настриги немытой шерсти по животным калмыцкой курдючной породы выше, нежели по сверстникам эдильбаевских местных овец.

Так, настриг немытой шерсти по баранам калмыцкой курдючной породы составил 3,1 кг, что на 0,5 кг больше, чем по сверстникам эдильбаевских местных курдючных баранов. По группе маток разность составила 0,4 кг, по яркам 0,3 и баранчикам 0,4 кг соответственно.

Анализ полученных данных бонитировки по настригу шерсти показал, что животные всех половозрастных групп по калмыцкой курдючной породе превосходят местных курдючных овец по настригу и обладают белой по цвету шерстью, кроме головы и шеи, что для перерабатывающей промышленности и предприятий народного творчества намного ценнее, чем шерсть цветная темная, получаемая от местных курдючных овец.

Воспроизводительная способность зависит от биологических особенностей овец и указывает на степень адаптации породы к условиям ее разведения.

Для проведения случки овец в СПК «Кировский» применяется искусственное осеменение маток, обычно в октябре - ноябре, с таким расчетом, чтобы ягнение их приходилось на конец марта и начало апреля. С целью повышения плодовитости в хозяйстве проводится

подготовка к случке как маток, так и баранов. За 1,5 месяца до осеменения бараны переводятся на усиленный рацион и лучшие пастбища. Во время осеменения к использованию допускалась сперма густая и с активностью 0,9-1,0. В эти же сроки в маточных отарах заканчивают отбивку ягнят, проводят выбраковку старых и больных животных, а также ветеринарно-санитарные обработки. Маток нагуливают на хороших естественных пастбищах.

Плодовитость животных является одним из наиболее важных видов продуктивности, так как повышение ее способствует увеличению числа животных, производящих молоко, мясо, смушки, шерсть и другие продукты.

Высокая плодовитость маток и выход «деловых» ягнят к отбивке позволяют ускорить воспроизводство стада, повысить товарность и, следовательно, доходность (рентабельность) отрасли.

Известно, что плодовитость овец является породным признаком и определяется наследственностью, хотя проявление ее в значительной мере зависит от климатических условий, уровня кормления и содержания, упитанности, возраста и других. Естественная плодовитость курдючных овец варьирует в широких пределах. М.Ф.Иванов отмечал, что выход двоен у курдючных овец не превышает 10%.

Результаты ягнения маток разного генотипа, содержащихся в одной опытной отаре, позволяют отметить преимущество маток желательного типа по сравнению с местными курдючными матками.

Воспроизводительные свойства маток калмыцкой курдючной породы несколько выше, чем по исходным местным эдильбаевским курдючным маткам. Так, количество объягнившихся маток в группе калмыцких курдючных маток составило 90,0 %, аборты маток -1,3 %, отход маток за период ягнения -2,0%, яловость - 6,7 %. В итоге на 100 маток, имевшихся на начало ягнения, получено по 113,3 и 104,6 %, на каждые 100 объягнившихся маток - по 125,9 %; это на 8,7 и 4,5 % больше, чем в среднем по местным эдильбаевским курдючным маткам и в большей степени отражает биологическую плодовитость и возможности маток калмыцкой курдючной породы.

В воспроизводстве стада, наряду с плодовитостью маток, большое значение имеет получение здорового и жизнеспособного приплода и его сохранение. В ОАО «Кировский» проводится комплекс организационно-хозяйственных мероприятий, обеспечивающих повышение резистентности молодняка на всех стадиях его выращивания. Так, по данным таблицы, в расчете на объягнившихся маток отбито в среднем 160 и 149 ягнят соответственно. Это стало возможным благодаря хорошей подготовке маток к осеменению (своевременность отбивки ягнят, выбраковка непригодных к воспроизводству, выпас перед осеменением по зеленым кормам и т.д.), что в конечном итоге снизило перегул и яловость маток.

Выводы. Эдильбаевские местные курдючные бараны имели массу 83,7кг, а матки - 59,1 кг, что на 6,6 и 7,0 % меньше, чем у сверстников новой породы курдючных овец. Настриг немытой шерсти по баранам калмыцкой курдючной породы составил 3,1 кг, что на 0,5кг больше, чем по сверстникам эдильбаевских местных курдючных баранов. По группе маток (2,2кг) разность составила 0,4 кг, по яркам - 0,3 и баранчикам - 0,4 кг соответственно.

Воспроизводительные свойства калмыцких курдючных маток несколько выше, чем по эдильбаевским местным курдючным маткам. На 100 калмыцких курдючных маток, на начало ягнения, получено по 113,3%, на объягнившихся маток - по 125,9%; это на 8,7 и 4,5 % больше, чем по эдильбаевским местным курдючным маткам.

Таким образом, изученные группы соответствуют высоким требованиям инструкции по бонитировке и относятся по основным хозяйственно полезным признакам к классам элита и первый.

Список литературы:

1.Арилов, А.Н. Состояние и перспективы развития овцеводства Республики Калмыкия / А.Н. Арилов, И.В. Церенов, Ю.С. Богзыков // Зоотехния. - 2013. - № 6. - С. 2-4.

2.Гаряев, Б.Е. Племенное животноводство - стратегия успеха / Б.Е. Гаряев // Зоотехния. -2010. - № 5. - С. 11-12.

3. Пахомова, Е.В. Мясная продуктивность овец калмыцкой курдючной, грозненской тонкорунной пород и их помесей / Е.В. Пахомова // Овцы, козы, шерстное дело. - 2013. - №4. - С. 58-59.

4.Юлдашбаев, Ю.А. Курдючное овцеводство - фактор увеличения мясных ресурсов Калмыкии / Ю.А. Юлдашбаев, А.Н. Арилов и др. // «Зоотехния». - №5. - 2010. - С. 12-13.

5.Юлдашбаев, Ю.А. Новая порода овец-калмыцкая курдючная/ Ю.А. Юлдашбаев , А.Н. Арилов, М.С. Зулаев, Б.Е. Гаряев // Известия ТСХА, выпуск 3, 2013.- С.109-113.

6.Юлдашбаев, Ю.А. Мясная продуктивность баранчиков калмыцкой курдючной породы разных конституционально-продуктивных типов/ Ю.А. Юлдашбаев, И.В. Церенов // Зоотехния.-2013.-№6.-С.5-8.

7.Юлдашбаев, Ю.А. Сравнительная характеристика живой массы и развития внутренних органов калмыцких и эдильбаевских баранчиков/ Ю.А. Юлдашбаев, И.В. Церенов, С.С. Ванькаев // Зоотехния. -2013.-№6.-С.8-9.

Курдючные овцы: характеристики и история происхождения

Курдючные породы овец получили свое название благодаря особому наросту на задней части тела — курдюку. Овцы данного вида разводились специально для получения уникального качественного жира, который широко использовался в средневековой арабской и персидской кухне.

Описание и характеристики

Овцы данного типа характеризуются очень коротким (около 9 см) непокрытым шерстью и свободным от жировых отложений хвостом. На крестце и на ляжках у них отлагаются жировые запасы, масса которых, в зависимости от породы, может составлять — 4 — 12 кг., в редких случаях — 16—18 кг. Хвост обычно состоит из 5—6 позвонков, большинство пород этой группы рогаты, но встречаются и комолые. Профиль головы и особенно носовая часть сильно изогнуты.

Овцы гиссарской породы

У типичной курдючной овцы жировые отложения разделяются на две симметричных жировых подушки, в углублении которых находится покрытый длинным жестким волосом хвост. Жировые подушки покрыты шерстью только сверху, нижняя их часть почти бесшерстная.

Наиболее распространенные курдючные породы:

  • Афганская;
  • Армянская;
  • Ван Рой;
  • Гиссарская:
  • Сомалийская;
  • Калмыцкая:
  • Эдильбаевская.

Овцы курдючных пород хорошо переносят жар, холод, жажду и голод, не требовательны к кормам и в состоянии выдерживать очень большие переходы. Их содержат, главным образом, для получения мяса, сала и молока, так как их шерсть, изобилующая большим количеством грубого волоса, пригодна лишь для производства войлока.

Калмыцкая порода овец

Некоторые породы этой группы имеют хорошую молочность, за что особенно ценятся среди некоторых народов Кавказа и Азии.

История происхождение вида

Указанные выше особенности шерсти курдючных овец дали ученым повод предполагать, что эти овцы произошли от гибридизации овечьих маток с козлами. Судя по очень типичным представителям этой группы в северном Египте, Саудовской Аравии и Эфиопии, некоторые ученые предполагают, что эти африканские государства являются первоначальной родиной курдючной овцы.

В настоящее время известно, что различные породы курдючных овец разводились по всей Азии, во многих странах Африки и Мадагаскаре, а также в некоторых южных регионах России. В СССР больше всего курдючных овец встречалось в Киргизии, Калмыцкой автономной области, в Сибири, в Казахстане, Узбекистане и на северном Кавказе. Раньше овцеводы называли курдючные породы по местам их происхождения: киргизскими, калмыцкими, и даже по названию реки — Манычу—манычскими, а завезенные в Россию с татарскими ордами — ордынскими. Профессор и краевед И. В. Синицын дополнительно указывал на породы: «харчи», «сарык», ардаганскую и алтайскую курдючную овцу.

Эдильбаевская порода овец

Имеются лишь отрывочные сведения относительно русских пород курдючной овцы и районов, в которых она разводилась. Историк и энтограф А. Добромыслов путешествуя по Тургайской области, написал следующее: «Эти овцы отличаются большим ростом, крепким телосложением, грубой низкого качества шерстью, имеют различную расцветку и жирные раздвоенные наросты на крестце, известные под названием курдюков (по-киргизски «куйрюк»). У этих овец высокие и крепкие ноги, животные хорошо сложены, голова невелика, нос узкий и горбатый, уши висячие, рога (небольшие) встречаются только у очень немногих баранов, но иногда можно видеть и многорогих баранов — с двумя-тремя парами рогов на голове. Молочные железы у самок хорошо развиты. При скрещивании киргизских баранов с овцами, не имеющими курдюков, потомки уже во втором или третьем поколении получают такой же нарост, при скрещивании гладко-хвостых баранов с курдючными овцами наблюдается противоположное явление».

Животновод Александр Айрапетович Калантар в своем сообщении о калмыцкой и кара-ногайской породе Терской области и других районов Кавказа писал: «Курдючных овец на Кавказе насчитывается до 350 тысяч голов, большинство из них грубошерстные».

Из сведений, доставленных Московскому съезду овцеводов специалистом по животноводству Н. В. Михайловым об овцеводстве в Астраханской губернии, стало известно, что в Киргизской орде насчитывалось более миллиона, а в Калмыцкой степи до 656 тысяч голов курдючных овец.

Калмыцкое и киргизское население в дореволюционные годы разводило преимущественно именно курдючную овцу и лишь небольшое количество мериносов. Калмыцкая овца внешне похожа на киргизскую, различие выражается в весе и росте. Вес калмыцкого барана 90-100 и более килограмм, а киргизский — 70-80 кг.

Используются исключительно мясные качества овец, необходимо сохранить курдючные породы в чистоте и стараться улучшить их положительные стороны, исправив недостатки.

достоинства породы, описание с фото

Курдючные овцы считаются одними из самых продуктивных пород. Они выносливые и устойчивы к различным климатическим условиям. Овцы этой породы не привередливые и отличаются своей скороспелостью. Об особенностях этого типа мы расскажем ниже. Также поговорим об условиях содержания и продукции.

Особенности экстерьера

Курдючная порода овец была выведена еще в XVIII веке. Разводили эту породу, как правило, в азиатских странах в жарких климатических условиях. Путем скрещивания местных курдючных овец с другими типами вывели такие породы мясо-сального направления:

  • гиссарская;
  • эдильбаевская;
  • калмыцкая.

Особенностями этого типа овец считается крепкий костяк, относительно длинные ноги, которые являются признаком того, что эти породы можно перегонять на большое расстояние. Туловище растянутое. Грудь – широкая и глубокая. Уши длинные и висячие.

Природно-географическая зональность относится к полупустынным и пустынным районам. Максимальное расстояние, которое могут преодолевать курдючные овцы, составляет 500 км. Особи этого типа прекрасно чувствуют себя как в пустынной, так и на горной местности. При этом могут находиться на пастбищах круглый год, даже если выпас с изреженной растительностью. Могут содержаться даже в самых экстремальных условиях.

Все эти особенности являются генетическими, так как веками курдючным овцам приходилось приспосабливаться к типичной для них местности. Само название «курдючные» они получили благодаря свойственным только этому типу овец жировым отложениям в хвосте, а точнее, в крестце. Курдючный жир — это словно верблюжий горб, который при благоприятных условиях накапливается для того, чтобы расходоваться в послушливые периоды или когда трава на пастбищах непригодна к употреблению. Форма и вес жировых отложений зависит от породы. Это могут быть аккуратные полушария, сосредоточенные в хвосте, либо в виде подушки, которая может свисать аж до земли. Вес курдюка колеблется от 12 до 30 кг и зависит от породы, а также рациона животного.

Высокими качествами шерсти курдючная порода овец похвастаться не может. У некоторых пород она более качественная (эдильбаевских) и имеет меньшее количество мертвых волосков. У гиссарских и калмыцких овец настриг используют, как правило, для изготовления технического волокна. Стригут два раза в год: в весенне-летний период и осенью. Настриги у маток не превышают 2-2,5 кг. У баранов это число может достигать 4 кг. Осенний настриг мягче, чем летний, и считается более качественным.

Максимальный вес курдючной овцы составляет 80-85 кг. Это число одинаково для всех пород этого типа. Живой вес курдючных баранов достигает 130 кг, минимальный — 85-90 кг. Одной из самых крупных пород данного вида считается гиссарская. Хотя вес, которого может достигнуть животное, разнится не только в зависимости от породы, но и от масти. Разновидности масти курдючной породы — бурые, черные и рыжие, а также белые (калмыцкая).

Одной из главных особенностей курдючных овец считается их скороспелость. Они быстро и хорошо откармливаются. Суточный прирост ягненка до 7 месяцев становит от 285 до 300 грамм. Потому этот тип овец считают высокопродуктивным. Вес баранов в семимесячном возрасте составляет около 47 кг. При этом масса туши на выходе – 24 кг. А курдючный жир у особи этого возраста достигает 6 кг.

Плодовитость курдючных овец не превышает 115 процентов. Ягнята рождаются с весом от 4 до 6 кг, и за полгода набирают около 60 % веса взрослых особей. Безусловно, данный тип скота очень выгодный.

Содержание

Преимущество данного типа овец заключается в их способности выпасаться почти целый год. Даже на самых малотравных пастбищах животные могут находить для себя пропитание. А возможность их перемещения на большие расстояния упрощает процесс выпаса. Курдючная порода овец очень выгодна тем, что в период летний и весенний не требует подкормки. На период, когда пастбище является непригодным, очень легко адаптируются к другому рациону. Нетребовательные к дополнительным кормовым добавкам, но они являются необходимыми для более быстрого роста животных, поддержания веса и накопления жиров. В воду для животных добавляют соль.

Содержат отару или нескольких животных, как правило, в сухих помещениях. Этот тип животных любит просторные условия содержания. Очень важно следить за подстилкой в помещение, где находятся животные. Сырая подстилка или плесень на ней неблагоприятно влияет на здоровье стада. Овец также желательно оградить от сквозняков.

За шерстью и копытами следует тщательно ухаживать. Купать животных необходимо не только перед тем, когда остригается шерсть. Желательно это делать несколько раз за весенне-летний сезон. Что касается копыт, то их подрезают 2-3 раза в год. Если данная процедура не будет совершаться, то у животного может развиться хромота. В целом этот тип скота не требовательный и имеет стойкий иммунитет к различным заболевания, потому и ценится во многих странах.

Продукция

Разводят курдючный тип скота для мяса и сала. Благодаря скороспелости этих пород и большому количеству убойного выхода мяса и сала их считают достаточно продуктивными. Мясо данной породы очень вкусное и жирное, особенно в грудине, на спине в области лопаток и в задней части. Мраморностью мясо не обладает. Особо ценится туша ягненка (в возрасте 5-7 месяцев), вес которой может достигнуть 32 кг.

Курдючный жир имеет свои особенности, его издавна использовали как природный консервант. Он не застывает при комнатной температуре. В азиатской кухне его считают универсальным, так как множество национальных блюд приготавливается именно с помощью курдючного жира, от закусок и до сладостей. Более того, этот жир считается полезным для здоровья человека.

Удои маток этого типа составляют от 130 до 156 кг молока. Жирность молока — от 3% до 9%, естественно эти числа непосредственно зависят от рациона животного. Молоко используют для приготовления различных видов сыров и масла.

Шерсть более пригодна для технических волокон. Хотя у некоторых пород курдючных овец волокна достаточно хорошего качества. Остригают животных два раза в год — в начале лета, либо в конце весны и осенью.

Исходя из вышеперечисленных особенностей содержания и продуктивности данного типа овец, можно сделать вывод, что курдючные породы выгодные для разведения. Именно потому они достигают все большей популярности среди заводчиков.

Видео “Курдючная порода овец”

Видеосъемка на ферме по разведению курдючных овец. Демонстрируются половозрелые бараны и даются комментарии о породе.

Короткохвостые, длиннохвостые, жирнохвостые и курдючные овцы

 

 

В результате длительного содержания в неволе, скрещивания и тщательного отбора человек вывел огромное количество (до 150) крайне разнообразных домашних пород овец. Они могут быть сгруппированы в 4 основных типа.

 

Короткохвостые овцы — с хвостом, не доходящим до скакательного сустава, покрытым короткими волосами и имеющим обычно не более 13—14 позвонков. Распространены преимущественно в северных частях Европы и Азии. Среди этого типа нет пород, особенно ценных по шерстным качествам, но некоторые отличаются молочностью и овчинами. К таким овчинно-шубным овцам относится знаменитая пегая романовская овца, разводимая преимущественно в Ярославской области.

 

Длиннохвостые, или тощехвостые, овцы — с хвостом, спускающимся ниже скакательного сустава, содержащим более 14 (до 22— 23) удлиненных позвонков и лишенным жировых отложений. Распространены главным образом в Европе, Австралии и Америке, частью в Африке. Содержатся преимущественно ради шерсти, есть и мясо-шерстные породы. Среди шерстных овец особенно ценятся по своим качествам мериносы. Их шерсть (руно) состоит лишь из одного пуха (подшерстка), отличающегося тонкостью, прочностью, равномерной извитостью и густотой. Шерсть таких овец идет на изготовление самых тонких шерстяных тканей. Из мериносов, разводимых в СССР, особого внимания заслуживают асканийская тонкорунная порода, выведенная академиком М. Ф. Ивановым; овца дает 10—15 (до 21) кг шерсти; кавказская тонкорунная, дающая густую длинную шерсть (до 22 кг). Сюда же относятся казахская тонкорунная, ставропольская. К суровым климатическим условиям приспособлена новая порода алтайских овец, дающих в среднем до 7,3 кг тонкой шерсти. К полутонкорунным относится разводимая у нас на Украине цигайская порода и ряд других.

 

Жирнохвостые, или широкохвостые, овцы — с хвостом, богатым жировой тканью и содержащим не менее 13 и до 22 позвонков. Распространены главным образом по Центральной и Средней Азии, Кавказу и Юго-Восточной Европе. Этот тип содержит разнообразные породы, ценные по своим шерстным качествам, молочные, мясные и смушковые. Из последних особенно ценна каракульская овца, разводимая в равнинной Средней Азии и дающая превосходные смушки ягнят в возрасте до 2 недель с правильными, упругими завитками.

 

Курдючные овцы лишены свободного хвоста, скелет которого содержит лишь 4—7 позвонков, и имеют на задней части тела большие жировые скопления — свешивающийся курдюк. Область распространения — Центральная и Средняя Азия, степи Восточной Европы, Иран, продолжается на Аравийский полуостров и Африку. Этот тип довольно однообразен и содержит мясо-сальные породы, характеризующиеся высокими ногами, горбатой мордой, длинными, повислыми ушами. Для овец, а часто и баранов характерна безрогость.

Еще интересные статьи по теме:

Тысячи лет люди были одержимы толстохвостой овцой

Изображение толстохвостой овцы 17 века. Public Domain

Согласно Геродоту, «отцу истории» пятого века, путешественники в Аравии, без сомнения, встретят летающих змей, птиц, строящих гнезда из корицы, и овец, чьи массивные хвосты волочатся по земле. Чтобы не повредить упомянутые хвосты, пастухи со столярными навыками построили для них поддерживающие колесные телеги. Геродот, который жил в греческих городах, таких как Афины, когда он не путешествовал, наполнил свои истории сказками, которые он слышал.Но толстохвостые овцы вполне реальны.

Мозаика с изображением жирнохвостой овцы 475 года нашей эры. Реми Матис / CC BY-SA 3.0

Этот факт не является сюрпризом для большей части мира, так как около 25 процентов овец в мире - это разновидности с жирным хвостом, согласно Oxford Companion to Food . На протяжении тысячелетий люди разводили овец с огромными толстыми хвостами, которых можно встретить в основном на Ближнем Востоке, в Центральной Азии и Африке. У одних пород тяжелые завитые хвосты, у других они похожи на весла.Хвосты овец Авасси могут весить около 26 фунтов, что довольно скромно по сравнению с 80-фунтовым хвостом барана, описанным летописцем 16 века Лео Африканским.

У овец дополнительный хвостовой жир обеспечивает запасы энергии в суровых климатических условиях. Но для людей это скорее кулинарный интерес: жир из хвоста служит отличным консервантом и кулинарным жиром. Поскольку хвостовой жир чаще подвергается воздействию холода, по словам историка кулинарии Чарльза Перри, он имеет низкую температуру плавления, что способствует маслянистой, а не восковой текстуре.Ливанский awarma , например, состоит из рубленой баранины, консервированной в большом количестве курдючного жира. Конфи часто подают к яйцам или хумусу.

У некоторых толстохвостых овец есть завитые хвосты. Библиотека Конгресса / 2004004537

Художники от Израиля до Индии увековечили толстохвостых овец с наскальными рисунками, мозаиками и великолепными золотыми полотнами. В Библии есть даже упоминание о толстохвостой овце. Но для европейцев и американцев, привыкших к тонкохвостым овцам, эти существа были просто ошеломляющими.Джереми Стронг пишет, что в сочетании с идеей хвостовых повозок, толстохвостые овцы «вызывали восхищение писателей не менее 2500 лет».

Путевые отчеты и фермерские альманахи вплоть до 20-го века, затаив дыхание, описывали толстохвостых овец а-ля Геродот: вместе с прикрепленной к ним повозкой. Такие описания заставили скептиков усомниться в том, были ли овцы с повозками с хвостами мифическими наравне с птицами с корицей. Тем не менее, хотя фотографических свидетельств современных защитных хвостовиков мало, ученый Джон Гудридж утверждает, что они вполне реальны, и цитирует упоминания о повозках с овечьим хвостом в Афганистане в XIX и XX веках.

Тунисская бабаринская толстохвостая овца. Ramagri / CC BY-SA 4.0

Огромные хвосты могут показаться непрактичными. В конце концов, многие фермеры, выращивающие тонкохвостых овец, почти полностью купируют хвосты, чтобы уберечь их от загрязнения или заражения. Но овечий жир долгое время ценился за его вкус и способ приготовления, отмечает Перри. Только сейчас курдючный жир в качестве ароматизатора и угощения постепенно уходит от изящества. В конце концов, тысячелетняя история не сравнится с миром, который боится жира.

Gastro Obscura предлагает самые чудесные блюда и напитки в мире.
Подпишитесь на нашу электронную почту, которая доставляется два раза в неделю.

Овца 101: Хвосты


Базовый Информация об овцах Термины против GoatsKinds овец Породы А-Я SheepHair ОвецОканиеХвостыОвца Поведение глупая овца? Жевать Овцы ЕдятОвцы Товары для выпаса скота от SheepEating Баранина Овцы ШерстьСтрижкаШерсть КачестваОвца ФермерствоХищникиОвцы как домашние животные from Овцы, пастушьи собаки, стражи собак, овцы в историиинтересный Факты - Домашняя страница Sheep101 -


Хвосты ягненка


Правильно купированные барашки


Крысиный хвост
Восточно-фризский


Толстый хвост или крупа
Египетский Рахмани

В двух взмахах хвоста ягненка


Хвосты натуральные
Хвосты - естественная часть овец.Ягнята рождены с хвостами. Длина хвоста ягненка обычно находится на полпути между длина хвоста матери и хвоста отца. Фактически, Длина хвоста - одна из самых наследуемых черт овец. До 84 процентов вариации в длине овечьего хвоста обусловлены генетикой.

Назначение бараньего хвоста - защитить задний проход овцы, вульва и вымя от экстремальных погодных условий.Овцы поднимают хвосты когда они испражняются и в какой-то степени используют свои хвосты, чтобы разбрасывать их фекалии.

Хвостов нет!
В современных системах овцеводства хвосты обычно купированный (укороченный), чтобы предотвратить накопление фекалий на тыльной стороне овцы, что может привести к удару мухи (шерстяные личинки).Если не лечить, удар мухи может привести к летальному исходу, поскольку личинки разъедают овечью плоть. Стыковка хвоста также облегчает стрижку. овец и перемолоть их на мясо. Хвост не мешает ни размножению, ни ягнению.

Существуют разные методы стыковки хвостов ягнят. Самый распространенный метод - надеть резинку (кольцо) вокруг хвост. При использовании этого метода рекомендуется купать ягнят на молодняк. возраст (от 1 до 7 дней), чтобы минимизировать стресс и боль ягненком.Док (хвост) следует оставить достаточно длинным, чтобы покрывают вульву овцы и анус барана. Доки с коротким хвостом могут способствовать возникновению выпадения прямой кишки.

Хотя некоторые животные утверждают, что купирование хвоста является негуманной практикой, необходимой для современной производственной практики, это утверждение просто не соответствует действительности. Когда все сделано правильно, купирование хвоста не является бесчеловечным. Хотя это вызывает некоторую боль, это не влияет на здоровье или рост ягненка.Купирование хвоста сделано для защиты здоровья и гигиены овец и ягнят. Жидкие фекалии (диарея) могут возникать во всех производственных системах; таким образом, подвергая овцу риску забастовки мух.

Волос овец
Обычно не нужно состыковывать хвосты волос породы овец, в том числе катахдин, дорпер, американский блэкбелли, барбадосский блэкбелли, Дамара, ул.Круа (Белый Виргинские острова), Уилтшир-Хорн, Пелибуэй, Санта-Инес, Святой Августин и Royal White®.

Одним из непредвиденных последствий выбора овец для выращивания шерсти были более длинные, толстые и шерстяные хвосты. Хвосты шерсти овец больше похожи на предка современных овец, муфлона, у которого короткий, лишенный шерсти хвост.

Крысинохвостая овца
У некоторых шерстяных пород хвосты от природы короткие или тонкие, бесшерстные. хвосты, которые также не требуют стыковки.Эти породы называются северными. Европейские короткохвостые или «крысинохвостые» овцы. Они включают финских овец, восточно-фризских, шетландских, исландских, романовских, и Soay.

Поскольку восточно-фризские овцы - молочные овцы, их хвосты обычно купируют, чтобы создать более гигиеничные условия для доения.

Толстохвостая овца
У некоторых овец толстый или широкий крестец и / или хвост.Эти виды овец составляют 25 процентов поголовья овец в мире. Они выносливы и легко приспосабливаются, способны пережить тяжелые испытания пустынной жизни и других экстремальных климатических условий.

Это не принято купировать хвосты. На самом деле хвост в некоторых культурах жир считается деликатесом. Овечий жир - это называется «аллях» по-арабски. Исторический религиозный текст (Хадис) утверждает, что жир из овечьего хвоста является «лекарством» от радикулит (боль в пояснице и ногах, вызванная раздражением скайтический нерв).

Жирные хвосты также являются результатом искусственного отбора, поскольку некоторые древние культуры нуждались в источнике жира для приготовления пищи и отобранных овцах, которые могли бы его обеспечить.

N овцы с короткохвостым куполом
Используя короткохвостые породы (например, Finnsheep) в качестве основы, ученые в Австралия и Новая Зеландия пытаются разводить овец естественным путем. короткие хвосты, не требующие стыковки.Много лет назад исследователи из США успешно выведены "бесхвостые" овцы. К сожалению, бесхвостый эта черта была связана со смертельным геном, аналогичным гену мэнских кошек.


<== ОБ ОВЦЕ


Последнее обновление 20-мар-2020
Авторские права © 2020.Овца 101

Черты жирнохвостой овцы под влиянием стыковки

  • Abouheif, M.A., Kraidees, M.S. и Шатат, Р.А., 1992. Влияние стыковки и пола ягненка на характеристики туши жирнохвостой овцы нажда. Журнал прикладных исследований на животных , 1 , 91-101

    Google Scholar

  • Алкас, Дж. Э., Рашид, Н.Х., Исхак М.А. и Талиб Х., 1985. Комбинированное воздействие купирования и кастрации на скорость роста и тушу ягнят Авасси. Мировой обзор животноводства , 21 , 49-52

    Google Scholar

  • Аскер А.А., Эль-Халси И.Г. и Джума, К.Х., 1964. Влияние стыковки на рост и развитие ягнят авасси. U.A.R. Животноводство , 4 , 11-26

    Google Scholar

  • Барроумен, Дж.Р., Бааз, Т. и Тауэрс, К.Г., 1954. Кастрация и купирование ягнят. Использование техники резиновой лигатуры в разном возрасте. Empire Journal of Experimental Agriculture , 22 , 189

    Google Scholar

  • Байсер Д., Пекель Э. и Гунери О., 1992. Влияние стыковки на показатели роста и характеристики туши жирнохвостых ягнят барана авасси. Исследования мелких жвачных , 8 , 353-357

    Статья Google Scholar

  • Кларк, Дж.Н. и Киртон, А.Х., 1976. Купирование и кастрация: они необходимы? Труды 6-го семинара Ветеринарной ассоциации Новой Зеландии и Общества овец , Палмерстон-Норт, Новая Зеландия, Университет Мэсси, стр. 3-11

    Google Scholar

  • Коллинз Р. О., Илс Ф. А. и Смолл Дж., 1985. Наблюдения за водянистым ртом у новорожденных ягнят. Британский ветеринарный журнал , 141 , 135-140

    PubMed CAS Google Scholar

  • Диннис, А.С., Стаффорд, К.Дж., Меллор, Д.Дж., Брюс, Р.А. и Ward, R.N., 1997. Острая реакция кортизола у ягнят, кастрированных и купированных с использованием резиновых колец с зажимом для кастрации или без него. Австралийский ветеринарный журнал , 75 , 494-496

    PubMed CAS Google Scholar

  • Эль-Карим, A.J.A., 1980. Влияние стыковки на рост и характеристики туши овец пустыни Дубаси. Производство тропических животных , 5 , 15-17

    Google Scholar

  • Эпштейн, Х., 1961. Развитие и строение тела купированных и откупоренных ягнят с жирным хвостом Авасси. Empire Journal of Experimental Agriculture , 29 , 110-118

    Google Scholar

  • Гурсой Д. и Озкан Л., 1982. Влияние купирования и кастрации на рост и развитие ягнят авасси. Cukurova Universitesi Ziratt Fakultesi Yilligi , 13 , 49-63

    Google Scholar

  • Гайтон, А.C., 1981. Учебник медицинской физиологии , 6-е изд., (У. Б. Сондерс, Филадельфия), 613

    Google Scholar

  • Хафез Э.С.Е., Бадерелдин А.Л., Шарафельдин М.А., 1958. Исследования термостойкости курдючных овец в субтропиках. Журнал сельскохозяйственных наук , 47 , 280-286

    Google Scholar

  • Хендерсон, округ Колумбия, 1990.забота и благополучие новорожденных ягнят. В: Ветеринарная книга для овцеводов , (Ипсвич: Farming Press), 365

    Google Scholar

  • Hofmeyr, H.S., Manazcynsk, I., Meissner, H.H. и Franck, E., 1974. Влияние стыковки на состав туши, распределение подкожного жира и произвольный прием пищи у жирнохвостых каракульских ягнят. Аграрная , 6 , 1-6

    Google Scholar

  • Джавад, Н.A.J., Alkass, J.E. и Al-Wahab, R., 1986. Влияние сезона окота и стыковки на половое созревание и репродуктивную способность овец породы авасси. Труды четвертой научной конференции Научно-исследовательского совета. Сельскохозяйственные исследования , часть 3, 1 , 1777-1786

    Google Scholar

  • Джонстон, И.Л., 1944. Хвост ягнят: относительная важность обычных процедур на станции. Ветеринарный журнал Асиут , 20 , 286

    Google Scholar

  • Жубер Д.M. и Ueckermann, L., 1971. Заметка о влиянии стыковки на отложение жира у овец с жирным хвостом. Животноводство , 13 , 191-192

    Артикул Google Scholar

  • Juma, K.H. и Dessouky, F., 1969. Характеристики семени барана Awassi. Журнал сельскохозяйственных наук, Кембридж , 73 , 311-314

    Статья Google Scholar

  • Джума, К.Х., Гориб Ф.Х. и Элия Дж., 1971. Заметка об исследованиях термостойкости овец Авасси. Журнал животноводства , 13 , 369-370

    Google Scholar

  • Джума, К.Х., Карам, Х.А.А., Маали, Х.Н.А. и Аль-Баразанджи, Дж., 1973. Влияние стыковки на овец Авасси. Индийский журнал зоотехники , 43 , 931-935

    Google Scholar

  • Кент, Дж.Э., Молони В. и Робертсон И.С., 1993. Изменения концентрации кортизола в плазме у ягнят трех возрастов в первые три часа после трех методов кастрации и купирования хвоста. Исследования в области ветеринарии , 55 , 246-251

    PubMed CAS Google Scholar

  • Кент, Дж. Э., Молони, В. и Робертсон, И. С., 1995. Сравнение методов Бурдиццо и резиновых колец для кастрирования и купирования ягнят с хвоста. Ветеринарная запись , 136 , 192-196

    PubMed CAS Google Scholar

  • Kraidees, M.S., Al-Saiady, M.Y. и Abouheif, M.A., 1995. Влияние купирования хвоста при рождении на использование энергии, а также отложение белков и липидов жирнохвостыми ягнятами Наджди. Журнал прикладных исследований на животных , 7 , 81-90

    Google Scholar

  • Кусина, Н.T., 1995. Купирование хвоста ягненка: влияние ампутации хвоста на продуктивность, состав туши и качество туши интактных самцов аборигенных самцов саби с жирными хвостами. Журнал Общества животноводства Зимбабве , 7 , 187-193

    Google Scholar

  • Marai, I.F.M., Nowar, M.S., Bahgat, L.B. и Оуэн, Дж. Б., 1987. Влияние стыковки и стрижки на рост и характеристики туши жирнохвостой овцы осими. Журнал сельскохозяйственных наук, Кембридж , 109 , 513-518

    Google Scholar

  • Мараи, И.Ф.М., Новар М.С., Эль-Шобокси А.С. и Bahgat, L.B., 1989. Влияние стыковки на составные части крови, стыковки и стрижки на термостойкость жирнохвостых овец в субтропических условиях. Исследования и разработки в сельском хозяйстве , 2 , 83-86

    Google Scholar

  • Marai, I.F.M., El-Gaafary, M.N. и Ахмед, Б.А.К., 1992. Заметка о влиянии стыковки на структуру кожи и характеристики шерсти у рахманистской овцы с толстым хвостом. Животноводство , 55 , 292-294

    Артикул Google Scholar

  • Мэтьюз, Д.Х., Мэтьюз, Д.Дж. и Ogdeb, P.R., 1960. Методы стыковки Лэмба. Государственный университет Юты, фермерское хозяйство и домашние науки , июнь 1955 г.

  • Мирс, Г.Дж. и Браун, Ф.А., 1997. Ответы кортизола и бета-эндорфина на физические и физиологические стрессоры у ягнят. Канадский журнал зоотехники , 77 , 689-694

    CAS Статья Google Scholar

  • Меллор, Д.Дж. И Молони В., 1995. Кастрация и / или купирование хвоста ягнят. Ветеринарный архив , 137 , 227

    PubMed CAS Google Scholar

  • Mellor, D.J. и Мюррей, Л., 1989a. Влияние купирования и кастрации хвоста на поведение и концентрацию кортизола в плазме молодых ягнят. Исследования в области ветеринарии , 46 , 387-391

    PubMed CAS Google Scholar

  • Меллор, Д.Дж. И Мюррей, Л., 1989b. Изменение реакции кортизола ягнят на купирование хвоста, кастрацию и инъекцию АКТГ в течение первых семи дней после рождения. Исследования в области ветеринарии , 46 , 392-395

    PubMed CAS Google Scholar

  • Moharrery, A. и Ziauddin, K.S., 1999. Влияние стыковки и пищевой энергии на состав туши бадгизийских овец. Индийский журнал питания животных , 16 , 171-177

    Google Scholar

  • Молоны, В., Kent, J.E. and Robertson, I.S., 1993. (цитируется по Mellor and Molony, 1995)

    Google Scholar

  • О'Донован, П. Б., Гадаки, М. Б., Бехести, Р. Д., Салех, Б. А. и Rollinson, D.H.L., 1973. Характеристики и состав туши купированных и контрольных ягнят келлакуи с жирным хвостом. Журнал животноводства , 16 , 67-76

    Google Scholar

  • Панопулу, Э., Papadimitriou, T., Deligeorgis, S.G. и Rogdakis, E., 1991. Влияние стыковки на состав туши, размер жировых клеток и активность НАДФ-зависимого фермента в жировой ткани самок ягнят Chios весом 40 кг. Epitheorese-Zootehnikes-Epistemes , 13 , 93-107

    Google Scholar

  • Куреши, М.Дж., 1968. Влияние купирования ягнят с толстым хвостом на отложение жира. Сельское хозяйство Пакистана , 19 , 97-100

    Google Scholar

  • Куреши, М.Дж. И Шоу, А.О., 1968. Влияние купирования жирнохвостых ягнят на продуктивность размножения. Сельское хозяйство Пакистана , 19 , 93-96

    Google Scholar

  • Schalm, O.W., Jain, N.C. и Carroll, E.G., 1975. Veterinary Hematology , 3 edn, (Lea and Febiger, Philadelphia)

    Google Scholar

  • Сефидбахт Н. и Горбан К., 1972.Изменение производительности партии кормов в результате стыковки овец с жирным хвостом. Индийский журнал сельскохозяйственных исследований , 1 , 72-77

    Google Scholar

  • Шелтон, М., 1990. Влияние стыковки курдючных (каракульских) овец на продуктивность ягнят. Исследования мелких жвачных , 3 , 73-76

    Статья Google Scholar

  • Шатт, Д.А., Фелл, Л.Р., Коннелл, Р., Белл, А.К., Уоллес, К.А. и Смит, A.L., 1987. Вызванные стрессом изменения плазменных концентраций иммунореактивного бета-эндорфина и кортизола в ответ на рутинные хирургические процедуры у ягнят. Австралийский журнал биологических наук , 40 , 97-103

    CAS Google Scholar

  • Шатт Д.А., Фелл Л.Р., Коннелл Р. и Белл А.К., 1988. Стрессовая реакция у ягнят, купированных и кастрированных хирургическим путем или с помощью резиновых колец. Австралийский ветеринарный журнал , 65 , 5-7

    PubMed CAS Google Scholar

  • Terrill, C.E. и Stoehr, J.A., 1950. Сравнение резиновых колец с нарезкой для стыковки и кастрации. The Natural Wool Grower , March, 23

  • Wohlt, J.E., Wright, T.D., Sirois, V.S, Kniff, D.M. и Lelkes, L., 1982. Влияние стыковки на здоровье, клетки крови, метаболиты и рост ягнят Дорсет. Журнал зоотехники , 54 , 23-28

    PubMed CAS Google Scholar

  • (PDF) Толстохвостая овца - важный генетический ресурс овец для производства мяса в тропических странах: обзор

    Джафарогли М., Рашиди А., Мохтари М.С. and Shadparvar,

    A.A., 2010. (Co) Компоненты дисперсии и оценки генетических параметров

    для признаков роста у овец Могани.

    Исследование мелких жвачных животных 91: 170-177.

    Джахан М., Тарик М.М., Какар М.А. и Вахид А. 2013.

    Репродуктивная способность белуджских овец в различных экологических зонах

    Белуджистана, Пакистан. Пакистан

    Ветеринарный журнал 33: 37-40.

    Каррас А. 2012. История толстохвостых овец. 2 августа.

    http://www.awassisheep.com. Доступ 10.10.2017.

    Kashan, N.E.J., Alipanah, M. и Eghbaleh, A. 1997. Изучение

    жирных кислот во внутреннем жире хвоста и мясе трех жирнохвостых

    иранских овец.В: 1 Sheep and Goat Congress, Animal

    st

    ScienceResearch Institute, Карадж, Иран, стр. 223-230.

    Кашан, Н.Э.Дж., Манафи Азар, Г.Х., Афзалзаде, А. и

    Салехи, А. 2005. Показатели роста и туша

    Качество откорма ягнят от жирнохвостых и хвостатых

    пород овец. Исследование мелких жвачных 60: 267-271.

    Халифа, Э.И., Ахмед, М.Э., Хафез, Й.Х., Эль-Золаки, О.А.,

    Бахера, К.М. и Абидо, А.А. 2013. Возраст полового созревания и плодовитость

    овец Рахмани, которых кормили биологически инокулированным кукурузным силосом

    .Анналы сельскохозяйственных наук 58: 163-172.

    Ходжастехкей М., Асламинеджад А.А. 2013. Изучение

    экологических, генетических и фенотипических трендов для шкуры

    признаков и признаков живой массы у овец Занди. Журнал

    Прикладные исследования на животных 41: 356-361.

    Киянзад М.Р. 2005. Сравнение состава туши

    иранских курдючных овец. Азиатско-австралийский журнал

    Animal Science 18: 1348-1352.s

    Kiyanzad, M.Р., Панандам, Дж. М., Эмамджомех Кашан, Н.,

    Дже лан З.А. и Дахлан, I. 20 03. Представление iv e

    результатов трех иранских пород овец. Азиатский -

    Австралийский журнал наук о животных 16: 11-14.

    Мацит, М. 2002. Рост и тушка самцов

    ягнят породы Моркараман. Мелкие жвачные животные

    Research 43: 191-194.

    Maleki, E., Kafilzadeh, F., Meng, GY, Rajion, MA и

    Ebrahimi, M. 2015. Влияние породы на жирные кислоты

    Состав подкожной жировой ткани в жире -

    хвостатые овцы под идентичные условия кормления.Юг

    Африканский журнал зоотехники 45: 12-19.

    Мараи, I.F.M. и Бахгат, Л. 2003. Признаки жирнохвостой овцы

    в зависимости от стыковки. Здоровье тропических животных и

    Производство 35: 351-363.

    Матика, О., ван Вик, Дж. Б., Эразмус Г. Дж. и Бейкер Р.Л.

    2003. Оценка генетических параметров овец саби.

    Наука животноводства 79: 17-28.

    Mekuriawa, S., Mekuriawb, Z., Tayeb, M., Mekuriawb, G.,

    Amanea, A., Bimrewa, T. и Hailec, A. 2013. Рост

    производительности и линейные показатели тела

    Washera, Farta и их помеси овец в рамках системы управления

    фермеров в Западном Хайленде региона

    Амхара. Научный журнал ветеринарии

    Advances 2: 132-143.

    Mirhoseinia, SZ, Zarea, J., Hoss ein-Zadeha, NG,

    Khanzadeha, H., Seidavib, A., Laudadioc, V., Darioc,

    C., Tufarellic, V. and Selvaggi, M .2015. Оценка

    генетических параметров по массе тела и шкуре

    баллов качества у иранских каракульских овец. Мелкие жвачные животные

    Исследования 132: 67-71.

    Мохаммади, Й., Рашиди, А., Мокхтари, М. S. и

    Эсмаилизаде, А.К. 2010. Количественный генетический анализ

    признаков роста и коэффициентов Клейбера у овец санджаби.

    Исследование мелких жвачных животных 93: 88-93.

    Мохапатра, А., Де, К., Кумар, Д. и Накви, С.М.К. 2017.

    Влияние сезона на физиологические реакции? F / Fat-

    хвостатых овец в полузасушливых регионах В: 3 International.rd

    Конференция по биоресурсам и управлению стрессом,

    Джайпур. 8-11 ноября, с. 192.

    Moradi, M.H., Nejati-Javaremi, A., Moradi-Shahrbabak, M.,

    Dodds, K.G. и McEwan, J.C. 2012. Геномное сканирование

    выборочных обследований у пород овец с тонким и толстым хвостом для

    , идентифицирующих области-кандидаты, связанные с отложением жира

    .BMC Genetics 13: 10.

    Negussie, E., Rottmann, OJ, Pirchner, F. и Rege, J.E.O.

    2003. Паттерны роста и распределения жировых отложений у

    тропических жирнохвостых овец породы Менз и Хорро. Мясо

    Наука 64: 491-498.

    Нджидда, А.А. и Isidahomen, C.E. 2011. Гематологические параметры

    и характеристики туши отъемышей

    кроликов, которых кормили мукой из семян кунжута () в полузасушливом регионе aSesamum indicum

    . Пакистанский ветеринарный журнал 31: 35-39.

    Пан, Ю., Цзин, Дж., Чжао, Дж., Цзя, X., Цяо, Л., Ан, Л., Ли, Б., Ма,

    ,

    Ю., Чжан, Ю. и Лю . 2018. Паттерны экспрессии микроРНК

    в хвостовом жире овец разных пород. Домашний скот

    Science 207: 7 14. -

    Park, Y.W., Juárez, M., Ramos, M. и Haenlein, G.F.W.

    2007. Физико-химические характеристики козьего и

    овечьего молока. Исследования мелких жвачных животных 68: 88 113.-

    Payandeh, S., Fuente, M.A.de la and Martínez, M.A.L. 2016.

    Паттерны молочной продуктивности, профиль метаболитов в крови и активность ферментов

    у двух пород овец с жирным хвостом. Животное

    Наука о производстве 56: 1469-1474.

    Pourlis, A.F. 2011. Обзор морфологических характеристик

    , относящихся к производству и воспроизводству жирнохвостых

    пород овец. Продукция здравоохранения тропических животных 43:

    1267-1287.

    Райнал-Лютовац, К., Лагриффул, Г., Паккар, П., Гийе, И.

    и Chilliard Y. 2008. Состав козьего и овечьего молока

    молочные продукты: обновление. Исследования мелких жвачных

    79: 57-72.

    Арпита Мохапатра и А.К. Shinde

    16 Индийский журнал мелких жвачных животных 2018, 24 (1): 1-17

    «Вещь для некоторой редкости, заслуживающей доверия» в JSTOR

    Abstract

    Английская георгическая поэма восемнадцатого века представляла собой сборную форму и включала в себя обширную информацию по многим темам, включая сельское хозяйство.В этом эссе рассматривается пример, взятый из одного из этих стихотворений: описание толстохвостой «карменской» овцы из «Руно» Джона Дайера (1757 г.). Сравнивая это с изображениями этого типа овец в других текстах, эссе сосредотачивается на любопытной детали, описанной Дайером и другими, о том, как были построены колесные повозки, чтобы защитить длинные хвосты этих овец от вреда. Это часто считалось рассказом путешественника, но в эссе утверждается, что это действительно правда, и что сомнительная репутация рассказа, вероятно, проистекает из того факта, что писатели от Рабле до Голдсмита использовали его сатирически.

    Информация журнала

    Обзор сельскохозяйственной истории публикует статьи по всем аспектам истории сельского хозяйства, сельского общества и сельской экономики. Обычно обзор посвящен аграрной и сельской истории Британских островов, но также приветствуются статьи по сельской истории Европы, Северной Америки и Австралазии, особенно если они вносят сравнительный вклад в наше понимание британских событий. Формального диапазона дат нет. Обзор открыт для статей, использующих широкий спектр методологий.Наряду с статьями, в которых используется ортодоксальный исторический подход, «Обзор» в равной степени заинтересован в публикации статей, в которых используются археологические и ландшафтные методы, и в которых используются идеи, полученные из количественной истории, современных литературных исследований или гендерных исследований. Однако ожидается, что доклады понравятся широкой аудитории. В «Обзоре» не публикуются статьи, чьи интересы носят исключительно локальный характер.

    Информация для издателя

    BAHS - это национальное общество, изучающее историю сельского хозяйства, сельского общества и ландшафтов Великобритании и Ирландии.Мы издаем журнал «Сельская история сегодня», а также научный журнал «Обзор сельскохозяйственной истории», и наши конференции предоставляют историкам (профессиональным и непрофессиональным) возможность встречаться, общаться и обмениваться мнениями в дружеской и общительной атмосфере.

    Урок № 54 Бедуинские овцы (Рам).

    Имена:

    1. В хадисах он называется Аль-Кабаш Араби.
    2. На урду и хинди это называется думба.
    3. По-английски это называется Толстохвостая овца или Толстохвостая овца.

    Введение: -

    Толстохвостые овцы выносливы и легко приспосабливаются, способные противостоять суровым испытаниям пустынной жизни. Когда корма много, толстохвостые овцы могут быть большими в размерах и росте. Качество туши этих овец довольно хорошее, большая часть жира сосредоточена в области хвоста. Толстохвостых овец разводили специально для получения жирных хвостов, которые использовались в супах и других кулинах.Жир хвоста называется аллях, причем хвост составляет до 15% от всей массы тушки.

    Руководство Наби об Аль-Кабш аль-Араби (الكبش العربي):

    Средство от Arqunisa (ишиаса): -

    1. Хазрат Анас бин Малик رضي الله عنه говорит, что Наби сказал: «Лекарство от Аркун-Ниса (عرق النشاء) (боли в пояснице) находится в жирном хвосте бедуинской овцы, его жиры следует растопить и разделить на 3 части, и каждую часть (следует) принимать каждый день натощак.
    [Ибн Маджа: 3592; Книга. 31; Eng vol. 4; Книга. 31, Hadees. 3463]
    2. Хазрат Анас رضي الله عنه говорит, что он прописал Аль-Кабш Аль-Араби от Аркун-Ниса (боли в пояснице) 300 человек, и Аллах Та'ала исцелил всех.
    [Исламская медицина, страница № 166; книга Юсуфа Аль-Хаджа Ахмада]

    В нем: -

    Липиды, Омега-3 и 6, жирные кислоты, незаменимые и заменимые жирные кислоты и т. Д.

    Science & Hadees о толстохвостых овцах: -

    1.Роль жиров в лечении этого недуга: -

    Наби لى الله عليه وسلم упомянул, что лечение Irqun-Nisa (عرق النساء) (боль в пояснице), в некоторых случаях, является лечением жирного хвоста овцы, что на самом деле верно.

    Современная наука говорит: -

    Простагландин - это большая группа природных ферментов, которые действуют как гормоны, и все тело связано с ними. Есть много функций, которые они выполняют в теле.

    Липидный обмен имеет три ветви, каждая из которых связана с типом жира, потребляемого в большом количестве, что приводит к образованию трех различных химических соединений (простагландин 1, 2 и 3), которые имеют противоположные эффекты друг от друга.Эти соединения, называемые простагландинами, напоминают гормоны и по-разному влияют на боли и воспаления в организме.
    Простагландины типа 1 предотвращают боль и происходят из жирной кислоты, называемой гамма-линолевой кислотой (GLA), которая принадлежит к группе жиров омега-6, обнаруживаемой в ограниченном количестве в некоторых диких растениях. Эти продукты помогают преобразовать линолевую кислоту в гамма-линолевую кислоту, а затем в простагландины типа 3.
    Простагландины типа 2, с другой стороны, усиливают боль. Они также образованы из группы жиров омега-6 и в основном из линолевой кислоты, содержащейся в маргаринах и пирожных, а также в растительных маслах.
    Простагландины 3 типа известны своим успокаивающим действием при болях и воспалениях. Они образованы из альфа-линолевой кислоты (ALA), которая превращается в два соединения EPA и DHA. Альфа-линолевая кислота содержится в маслах натуральных листьев и трав, поэтому это преимущество натуральной растительной пищи, которую едят люди и животные, такие как овцы, живущие в пустыне (оазисе), особенно жирнохвостые овцы. Масла, содержащие альфа-линолевую кислоту, дешевы. Они принадлежат к группе омега-3, известной своими большими преимуществами, и являются жидкими при комнатной температуре.
    Ишиас - это пара больших и толстых (правых и левых) нервов, идущих от крестцового отдела позвоночника.

    Ишиас означает боль в спине, бедре и внешней стороне ноги, вызванную сдавлением корешка спинномозгового нерва в нижней части спины, часто из-за дегенерации межпозвонкового диска.

    Некоторые преимущества жиров омега-3: -

    1. Снижают уровень холестерина, защищают от сердечных заболеваний и инсультов, защищают от артериальной гипертензии, ревматоидов, экземы и рака.Также потеря веса, формирование тканей мозга, глаза, уха, репродуктивных желез и тканей других желез, формирование мембран, окружающих все клетки тела и действующих для защиты клеток, восстанавливая нервные ткани как в случае грыжи межпозвоночного диска, одной из основных причин радикулита, воспаления нервных тканей, которое является второй основной причиной радикулита.
    2. Пустынные овцы питаются натуральными травами, богатыми омега-3 жирами, из которых готовят 700 лекарств.Полезные масла, которые овца получает из этих трав, хранятся в ее хвосте.
    3. Наби сказал, что сначала нужно растопить хвост, чтобы вредные бактерии и микробы были убиты жарой.
    4. Также следует принимать не более трех дней, чтобы избежать окисления жиров и прогорклости.
    5. Его следует принимать натощак, чтобы никакие другие липиды не конкурировали с липидами хвоста за абсорбцию в пищеварительном тракте на уровне пузырьков и поджелудочной железы, в дополнение к клеточному уровню, где ферменты действуют на мембране. преобразовать эти липиды группы омега-3 в полезный простагландин 3-го типа, который уменьшает воспаления и боль, вызванные ишиасом.

    Заключение Hadees: -

    Его хвостовые жиры являются лекарством от радикулита, но многие ученые говорят, что этот совет был дан конкретным людям из определенного региона. В этом уроке 2 Hadees.

    Геномный анализ мировых пород овец показывает, что PDGFD является основной целью селекции жирных хвостов у овец

    Abstract

    Жирный хвост - это особый признак овец, приобретенный во время одомашнивания овец. Несколько геномных анализов было проведено у пород овец из ограниченного географического происхождения для выявления генетических факторов, лежащих в основе этого признака.Тем не менее, в эти исследования попали разные кандидаты. Результаты этих региональных исследований были легко искажены структурой породы. Чтобы свести к минимуму систематическую ошибку и выделить истинных кандидатов, мы использовали расширенный набор данных из 968 овец, представляющих 18 пород с толстым хвостом и 14 пород с тонким хвостом со всего мира, и интегрировали два статистических теста для выявления признаков отбора, включая индекс генетической фиксации. ( F ST ) и разность производных частот аллелей (ΔDAF).Результаты показали, что тромбоцитарный фактор роста D (PDGFD) продемонстрировал самую высокую генетическую дифференциацию между полными и тонкохвостыми породами овец. Дальнейший анализ вариации последовательности выявил, что область размером 6,8 т.п.н. в первом интроне PDGFD , вероятно, является мишенью положительного отбора и содержит регуляторные мутации (и) у овец с жирным хвостом. Гистологический анализ и анализ экспрессии генов продемонстрировали, что экспрессия PDGFD связана с созреванием и гемостазом адипоцитов.Анализы люциферазного репортера показали, что сегмент консервативной последовательности, окружающий ортологичный сайт одной мутации овцы, является функциональным в регуляции экспрессии PDGFD у человека. Эти результаты показывают, что PDGFD является преобладающим фактором фенотипа жирового хвоста у овец, способствуя адиопогенезу и поддержанию гемостаза зрелых адипоцитов. Это исследование дает представление об эволюции толстохвостых овец и имеет важное применение в животноводстве, а также в борьбе с заболеваниями человека, связанными с ожирением.

    Введение

    После одомашнивания в плодородном полумесяце примерно 8000–9000 лет назад [1] овцы распространились и распространились по всему миру в широком географическом диапазоне, в основном благодаря их приспособляемости к рационам с низким содержанием питательных веществ и экстремальным условиям окружающей среды, и таким образом развили существенная изменчивость по многим фенотипическим признакам [2]. Одним из основных морфологических изменений является удлинение хвоста и отчетливые закономерности отложения хвостового жира. Считается, что жирнохвостая овца была выбрана в ответ на условия степей и пустынь в Центральной Азии с 3000 г. до н. север Китая и запад в Южную Африку.

    Однако в настоящее время фенотип жирного хвоста теряет свои прежние преимущества, и уменьшение размера овечьего хвоста желательно как для производителей, так и для потребителей, отчасти потому, что жирные хвосты оказывают значительное влияние на отложение жира в других частях тела [ 4], спаривание и нормальное передвижение животного [5]. Кроме того, потребители во многих случаях все больше отдают предпочтение нежирному мясу. Генетическое улучшение является более привлекательной стратегией для выращивания овец с небольшим размером хвоста, чем традиционные методы на фермах, такие как купирование хвоста, поскольку это надежный, долговечный и гуманный подход.Для этого поиск генов, лежащих в основе фенотипа жирового хвоста, является первым и наиболее важным делом. Более того, выяснение физиологии отложения жира в овечьем хвосте дает существенное представление о проблемах со здоровьем человека, таких как ожирение, которое представляет собой серьезную угрозу для качества жизни человека в современном обществе [6].

    Было предпринято несколько попыток поиска генов или областей генома, связанных с фенотипом жирного хвоста, с помощью полногеномного сканирования [7–12]. Тем не менее, результаты этих исследований остаются противоречивыми, и почти нет единого мнения об их значениях.Это довольно удивительно, поскольку все толстохвостые овцы кажутся одного и того же происхождения с относительно короткой историей, и поэтому ожидается, что они будут иметь сходную генетическую основу, лежащую в основе признака. Кроме того, эти предыдущие исследования имели ряд ограничений, затрудняющих поиск подходящих кандидатов. Во-первых, они исследовали популяции овец из относительно ограниченных территорий, которые могут идентифицировать неправильные кандидатные локусы, которые были выбраны другими смешивающими факторами, такими как географическая изоляция. Во-вторых, в этих исследованиях для идентификации генов-кандидатов в основном применялись методы, основанные на частоте аллелей, такие как метод индекса генетической фиксации ( F ST ). F ST Подход на основе широко используется для выявления регионов с высокой дивергенцией между популяциями; однако ему не хватает возможности указать направление отбора. Чтобы прояснить противоречие, здесь мы выполнили комплексный геномный анализ 18 тонкохвостых и 14 жирнохвостых пород овец со всего мира, объединив два критерия отбора, включая индекс генетической фиксации ( F ST ) и разницу частоты производных аллелей (ΔDAF) (обозначаемых как DAF Fat-tailed Sheep - DAF Thin-Tailed Sheep ), чтобы идентифицировать положительно выбранные гены, специфически у овец с толстым хвостом.Этот анализ выявил PDGFD в качестве основного кандидата, лежащего в основе фенотипа жирового хвоста у овец. Дальнейший гистологический анализ и анализ экспрессии генов продемонстрировали, что экспрессия PDGFD связана с адипогенезом в жировых тканях во время эмбрионального развития овец и остается более высокой в ​​жировых тканях овец с толстым хвостом, чем у овец с тонкими хвостами как на эмбриональной, так и на взрослой стадии. Наконец, мы провели двойные анализы репортерной люциферазы и обнаружили, что сегмент консервативной последовательности, окружающий ортологичный сайт одной мутации овцы, является функциональным в регуляции экспрессии PDGFD у человека.

    Материалы и методы

    Образцы и генотипирование

    Данные SNP для всего генома пяти южноазиатских тонкохвостых пород (, т. Е. ., Тибетские, чангтанги, деккани, индийские и гарутские овцы), шести европейских тонкохвостых овец породы (, т. е. ., овцы Чурра, Леччезе, Комисана, Альтамурана, Макартур-Мерино и Милк-Лакауне), трех американских пород тонкохвостых овец (, т. е. ., Барбадосские овцы BlackBelly, MoradaNova и SantaInes), шесть средневосточных пород курдючных овец. ( и.e ., Afshari, LocalAwassi, Karakas, Norduz, Moghani и Cyprus FatTail), четыре африканских породы овец с жирным хвостом (, т.е. ., эфиопский менц, намаква-африканер, RedMaasai и RonderibAfrikaner) и восемь особей муфлонов (дикие овцы). из проекта Ovine HapMap (http://www.sheephapmap.org/hapmap.php) [13]. Данные SNP четырех китайских пород овец с толстым хвостом (, т. Е. , овцы ху, тонг, большие хвосты хань и лоп) были получены в предыдущем исследовании [10]. Данные SNP четырех непальских тонкохвостых пород овец ( i.e ., Bhyanglung, Baruwal, Lampuchhre и Kage овцы) были получены в нашей лаборатории [14]. Тип хвоста у этих пород был определен либо прямым наблюдением, либо описанием предшествующей литературы. Подробная информация об этих породах овец представлена ​​в дополнительной таблице S1 . Все данные SNP были сгенерированы с использованием микросхемы Illumina Ovine 50K Beadchip и, таким образом, были легко объединены. Окончательный набор данных включал 968 особей овец и 47415 общих аутосомных SNP (на основе генома Oar_v3.1).

    Определение предкового аллеля и контроль качества данных

    Информация об предковом аллеле для подмножества из 33059 SNP была получена из Ovine HapMap [13]. Для остальных SNP предковый аллель был выведен в соответствии с основным аллелем у овец муфлонов. Наконец, в общей сложности 46 540 SNP с доступной информацией об аллелях предков были сохранены для следующего анализа. PLINK v2.05 [15] был применен для дальнейшего контроля качества данных SNP. SNP удалялись, если выполнялось любое из следующих условий: 1) с частотой вызовов ≤90%; 2) с частотой минорного аллеля (MAF) ≤0.05. Особи овец со средней частотой звонков ниже 90% были выброшены. Чтобы гарантировать независимость среди изучаемых особей овец, загадочное родство между особями в пределах каждой породы было выявлено с помощью попарной метрики Identity-By-Descent (IBD) (называемой PI-HAT в PLINK). Один особь из пары особей овец был исключен из следующих анализов, если их значение PI-HAT было более 0,3.

    Филогенетический анализ

    Обрезанный набор из 32 450 SNP был использован для исследования генетической взаимосвязи между этими породами овец из разных географических регионов.Анализ основных компонентов (PCA) был выполнен с помощью программного обеспечения GCTA [16], и люди за пределами ожидаемых групп населения были исключены из дальнейшего анализа. Дерево объединения соседей было построено с использованием PHYLIP 3.68 (http://evolution.genetics.washington.edu/phylip.html) на основе данных частоты аллелей. После анализа PCA в общей сложности 45 337 SNP для 828 особей из 30 различных пород овец были сохранены для последующего анализа ( Supplementary Table S1 ).

    Геномный скрининг положительно отобранных генов у овец с толстым хвостом

    В трех предыдущих исследованиях сравнивались геномные вариации между средневосточными / европейскими тонкохвостыми овцами и (v.s.) средневосточными толстохвостыми овцами [11], европейскими тонкохвостыми и европейскими тонкохвостыми овцами. Ближневосточные овцы с толстым хвостом [12] и китайские тонкохвостые овцы [10] соответственно. Поэтому мы использовали породы овец из Южной Азии, Ближнего Востока и Европы, чтобы идентифицировать положительно отобранные гены у овец с жирным хвостом. Были рассмотрены три групповых сравнения овец с толстым и толстым хвостом, в том числе средневосточных овец с толстым хвостом (MEF) v.с. Южноазиатские тонкохвостые овцы (SAT), MEF v.s. Европейская тонкохвостая овца (EUT) и китайская толстохвостая овца (CHF) против. СИДЕЛ.

    Две статистики, включая F ST и ΔDAF, были применены для оценки генетической дифференциации каждого SNP между популяциями овец с тонкими и толстыми хвостами. Анализ F ST проводили с использованием программы Genepop 4.3 [17]. ΔDAF рассчитывали как полученную частоту аллелей у овец с толстым хвостом за вычетом DAF у овец с толстым хвостом (DAF овцы с толстым хвостом - DAF овцы с тонким хвостом ) с использованием R версии 3.3.3 (https://www.r-project.org/). Для каждого сравнения групп и пар, F ST и ΔDAF на каждом маркере SNP были рассчитаны между каждой породой с тонким хвостом в сравнении с каждой породой с толстым хвостом и усреднены по парам пород для получения общего значения для каждого SNP. Первые 1% SNP с большим общим значением F ST или ΔDAF считались значимыми SNP в каждом тесте, а значимые SNP, перекрывающиеся в обоих тестах, рассматривались как положительно выбранные SNP у овец с жирным хвостом.Наконец, положительно выбранные SNP, которые были идентифицированы во всех трех сравнениях пар групп, рассматривались как локусы при положительном отборе у овец с толстым хвостом, а гены в пределах 150 т.п.н. этих локусов были извлечены из базы данных Ensembl BioMart (http: //useast.ensembl .org / biomart / martview / 625a397ecca62a421509935f099cdaa7).

    Поскольку высокое среднее значение F ST или ΔDAF может быть результатом чрезвычайно больших значений в нескольких конкретных парных породах из-за структуры популяции, мы дополнительно исследовали DAF SNP-кандидатов у трех тонкохвостых овец. пород из Америки и трех пород овец с толстым хвостом из Африки и дополнительно отфильтровали список многообещающих кандидатов, удалив SNP с DAF> 0.5 у более чем пяти пород овец с тонким хвостом или DAF <0,5 у более чем четырех пород овец с толстым хвостом (> 30% от общего числа пород овец с тонким или толстым хвостом).

    Анализ вариаций последовательностей в топовых генах

    Геномные вариации, хранящиеся в файле Variant Call Format (VCF), для 16 особей тонкохвостых овец и 13 особей жирнохвостых овец из 17 различных пород со всего мира были загружены с NextGen of Ensembl Проекты (http://projects.ensembl.org/nextgen/) ( Дополнительная таблица S2 ).Файл VCF был преобразован в файл PLINK PED с помощью VCFtools [18]. PLINK [15] использовался для контроля качества SNP (удаление SNP с частотой вызовов ≤90% или MAF ≤0,05) и для расчета частоты аллелей каждого SNP в группе овец с тонкими и толстыми хвостами. Абсолютная разница частоты аллелей (ΔAF) каждого SNP между группой толстохвостых и тонкохвостых овец была рассчитана с использованием R.

    Проверка лучших SNP в расширенных выборках с использованием Sequenom MassARRAY

    Всего 13 интронных SNP из PDGFD ген с наибольшим значением ΔAF (> 0.8) и полученная частота аллелей более 0,8 у овец с толстым хвостом были отобраны для дальнейшей проверки в расширенной когорте, содержащей 200 тибетских овец (тонкохвостые овцы) и 184 овцы Tan (толстохвостые овцы). Генотипирование этих 13 SNP проводили с помощью системы Sequenom MassArray. Вкратце, праймеры для ПЦР и для локус-специфичного одноосновного удлинения были разработаны с помощью MassArray Assay Design 4.0. Продукты ПЦР применяли для локус-специфичных реакций удлинения одного основания. Конечные продукты обессоливались и переносились на матричный чип.Полученные масс-спектрограммы и генотипы анализировали с помощью программного обеспечения MassArray Typer.

    Срезы, окрашивание гематоксилином и эозином (HE), окрашивание Oil Red O

    Ткани эмбрионального хвоста были собраны у желто-коричневой овцы (жирнохвостой овцы) на четырех различных эмбриональных стадиях, включая эмбриональный день 60 (E60), E70, E80 и E90 , каждый из которых содержит четыре образца. Ткани фиксировали 4% параформальдегидом в течение ночи при 4 ° C, а затем заливали парафином. Срезы были нарезаны толщиной 8 мкм.Для окрашивания НЕ срезы депарафинизировали с помощью двух замен ксилола (по 10 минут каждая) и регидратировали с помощью промывок 100%, 95% и 80% этанолом (по 5 минут каждая). После непродолжительной промывки в дистиллированной воде срезы окрашивали в растворе гематоксилина в течение 5 минут, промывали в проточной водопроводной воде в течение 5 минут, дифференцировали в 1% кислотном спирте в течение 30 секунд и снова промывали проточной водопроводной водой в течение 1 минуты. После воронения в 0,2% -ном растворе аммиака в течение 30 секунд и промывки в проточной водопроводной воде в течение 5 минут срезы промывали 95% спиртом и окрашивали в растворе эозин-флоксина в течение 30 секунд.Затем срезы обезвоживали серией полосканий в 80% спирте (5 секунд), 95% спирте (дважды по 10 секунд каждый), 100% спирте (дважды, по 5 минут каждое), а затем закрепляли. Для окрашивания Oil Red O 0,5 г порошка Oil Red O (Sigma) равномерно растворяли в 100 мл изопропанола для приготовления исходного раствора, который затем разбавляли дистиллированной водой в соотношении 3: 2 и фильтровали для получения рабочего раствора. Срезы промывали 60% изопропанолом и затем окрашивали рабочим раствором Oil Red O в течение 15 минут.Затем срезы были смонтированы и отображены для оценки образования капель.

    РНК-секвенирование и биоинформатический анализ

    Были собраны жировые ткани хвоста от Тан овцы (жирнохвостой) и Саффолкской (тонкохвостой) овцы на трех различных стадиях развития, включая E60, E70, E80. Полную РНК экстрагировали с помощью набора RNeasy Lipid Tissue Mini (Qiagen), а библиотеку РНК-seq конструировали с помощью набора Dynabeads mRNA DIRECT (invitrogen) для анализа последовательности РНК полного транскриптома. Парное секвенирование РНК проводили на системе X-ten (Illumina) длиной 150 п.н.

    После удаления последовательности адаптера и считывания низкого качества прошедшие фильтрацию считывания были затем сопоставлены с эталонным геномом овец Ensembl Oar_v4.0 с помощью Tophat 2.1.1 [19]. Гены, аннотированные в Ensembl, были количественно определены с помощью Cufflinks [20]. FPKM (количество фрагментов на килобазу экзона на миллион картированных фрагментов) вычисляли из необработанных подсчетов и использовали для количественной оценки относительной экспрессии гена для каждого образца.

    Количественный анализ ПЦР с обратной транскрипцией (qRT-PCR)

    Ткани хвоста коричневой овцы (жирнохвостой) на разных стадиях развития, включая E60, E70, E80, E90 и взрослую стадию (около 2 лет, самка), как а также от суффолкской овцы (тонкохвостой овцы) на E70 и взрослой стадии (Bhyanglung) (возраст около 2 лет, самка).Тотальную РНК из тканей хвоста выделяли с помощью набора RNeasy Lipid Tissue Mini (Qiagen). 0,8 мкг тотальной РНК использовали в качестве матрицы для RT со случайными гексамерными праймерами с использованием набора реагентов PrimeScript RT (Takara). qRT-PCR выполняли с соответствующими ген-специфичными праймерами ( PD GFD: вперед: GGGAGTCAGTCACAAGCTCT, обратное: AGTGGGGTCCGTTACTGATG; ACTB : вперед: TCTGGCACCACACTCCGTGTTCTC; обратное: Все образцы амплифицировали в трех экземплярах, и все эксперименты повторяли по крайней мере 3 независимых раза.Относительная экспрессия гена была преобразована с использованием метода 2 -ΔΔCT против гена внутреннего контроля ACTB, где ΔΔCT = (CT экспериментальный ген - CT экспериментальный ACTB ) - (CT контрольный ген - CT контрольный ACTB ). Относительная экспрессия гена в контрольной группе была установлена ​​на 1.

    Экспрессия PDGFD в жировых тканях / клетках мыши и человека

    Данные микромассивов различных типов клеток, выделенных из белой жировой ткани человека путем сортировки клеток с активацией флуоресценции ( FACS), включая CD45- / CD34 + / CD31- (предшественники), CD45 + / CD14 + / CD206 + (общее количество макрофагов), CD45 + / CD14 + CD206 + / CD11c + (макрофаги M1), CD45 + / CD14 + / CD206 + / CD11c- (макрофаги M2), CD45 + / CD3 + (общее количество Т-клеток), CD45 + / CD3 + / CD4 + / CD8- (Th T-клетки), CD45 + / CD3 + / CD4- / CD8 + (Tc T-клетки) (GSE100795) [21] были получены из базы данных GEO и повторно -анализируется с помощью встроенного онлайн-инструмента GEO2R.Необработанная матрица подсчета генов, созданная из РНК-seq для преадиопоцитов 3T3-L1 мыши и дифференцирующихся клеток через 24 часа после индукции с помощью коктейля дифференцировки DHA, была получена из базы данных GEO (GSE118471) [22], а FPKM был использован для количественной оценки уровня экспрессии гена. Микромассив данных паховой жировой ткани от мышей, демонстрирующих высокий или низкий набор веса через 4 недели на диете с высоким содержанием насыщенных жиров (GSE4692) [23], адипоцитов от недиабетических худых и недиабетических тучных субъектов индейцев пима (GSE2508) [ 24] были получены из базы данных GEO и проанализированы с помощью встроенного онлайн-инструмента GEO2R.

    Двойной репортерный анализ люциферазы

    Используя геномную ДНК человека в качестве матрицы, два фрагмента (WT, 222 п.н .; Del, 202 п.н.), охватывающие промоторную область гена PDGFD , были синтезированы непосредственно компанией BerryGenomics (Пекин, Китай), а затем продукты клонировали в сайт между сайтами рестрикции Kpn1 и EcoRV репортерного вектора люциферазы pGL4.23 (Promega). Все плазмиды секвенировали для проверки целостности вставки. Трансфекцию проводили реагентом Lipofectamine 3000 (ThermoFisher) по существу в соответствии с инструкциями производителя.Активность промотора оценивали путем измерения активности e luciferas e светлячков относительно минимальной управляемой промотором TK активности - активности Renilla luciferas внутреннего контроля с использованием системы двойного анализа люциферазы, как описано производителем (Promega). Было выполнено как минимум четыре независимых трансфекции, и все анализы были повторены как минимум дважды.

    Результаты

    Идентификация генов, лежащих в основе жирового хвоста у овец

    Данные SNP Beadchip для всего 968 особей овец были собраны и использованы в этом исследовании.Эти образцы содержали восемь особей диких овец муфлонов, 18 пород тонкохвостых овец и 14 репрезентативных пород овец с толстым хвостом из разных стран или регионов внутри стран ( рис. 1A; дополнительная таблица S1 ). Географическое распределение пород овец, включенных в этот отчет, включает Южную Азию, Восточную Азию, Ближний Восток, Европу, Африку и Америку ( Рис. 1A; Дополнительная таблица S1 ). После серии фильтров контроля качества в общей сложности 45 337 SNP и 828 особей из 30 различных пород овец по всему миру были сохранены для дальнейшего анализа.

    Рисунок 1. Идентификация положительно выбранных локусов у овец с жирным хвостом.

    (A) Географическое распределение пород овец, используемых в этом исследовании, каждая из которых представлена ​​точкой на карте мира. (B) Число положительно выбранных локусов, идентифицированных в трех различных сравнениях пар групп. MEF: Ближневосточная овца с толстым хвостом с Ближнего Востока; SAT: Южноазиатские тонкохвостые овцы; EUT: европейская тонкохвостая овца; CHF: Китайская толстохвостая овца. (C) Число положительно выбранных локусов, идентифицированных во всех трех сравнениях пар групп. (D) Производная частота аллелей (DAF) 16 положительно отобранных локусов, идентифицированных во всех трех сравнениях групп и пар у всех изученных пород овец. SNP были отсортированы в соответствии со средним значением F , ST и ΔDAF среди трех сравнений пар групп, указанных на рисунке 1b, от высокого к низкому. Важные аннотированные гены каждого SNP были помечены справа.

    Поскольку дикий предок домашних овец, муфлон, является тонкохвостым, ожидается, что современные тонкохвостые овцы сохранят исходное состояние аллелей, в то время как овцы с толстым хвостом будут демонстрировать производные аллели в локусах, связанных с фенотипом жирного хвоста.В рамках этого сценария мы объединили две статистические меры, F ST и ΔDAF, чтобы повысить эффективность идентификации геномных локусов, специально отобранных у пород овец с толстым хвостом. Для сравнения с предыдущими исследованиями [7–12] мы отдельно выполнили анализ F ST и ΔDAF в трех сравнениях пар групп, включая MEF против SAT, MEF против EUT и CHF против SAT. В целом, 213, 202 и 157 положительно выбранных SNP были идентифицированы как F ST , так и тестом ΔDAF в трех сравнениях, соответственно ( Рис.1b ) (полный список значимых SNP см. В дополнительных таблицах S3-S5 ). Среди них 16 локусов были общими для всех трех пар групповых сравнений ( Fig. 1c ).

    Восемь из 16 наиболее значимых SNP были исключены из нашего списка кандидатов, так как они имеют DAF> 0,5 (или DAF <0,5) более чем у 30% пород овец с тонкими (или толстыми) хвостами после изучение DAF этих SNP у дополнительных трех американских пород овец с тонким хвостом и трех пород африканских овец с толстым хвостом (см. Методы) ( Дополнительный рис.S1 ). Остальные восемь SNP сильно различаются между тонкохвостыми и толстохвостыми овцами и сохраняют наследственный аллель у большинства пород тонкохвостых овец, в то время как производный аллель у большинства пород толстохвостых овец во всем мире ( Рис. 1d ), что указывает на многообещающие кандидаты. связаны с фенотипом жирного хвоста. Анализ PCA и филогенетического дерева с использованием этих восьми SNP показал четко разделенные клады между тонкохвостыми и откормленными овцами, что существенно отличается от результатов, полученных на основе полногеномных вариантов, показывающих географическую кластеризацию ( Дополнительный рис.S2 ) и дополнительно подтвердил сильную дивергенцию этих локусов. Генная аннотация геномной области длиной 150 т.п.н., окружающей восемь SNP, выявила 24 гена и PDGFD. , соответствующий SNP OAR15_30 среди них, расположенный на хромосоме 15, был наиболее высокодифференцированным ( Fig. 1d ).

    Анализ вариаций последовательностей области

    PDGFD

    Чтобы лучше исследовать эти отобранные гены, мы извлекли варианты их геномных последовательностей из 16 особей с тонкими хвостами и 13 особей с толстыми хвостами с различным географическим происхождением из проекта NextGen ( Дополнительная таблица S2 ).Всего в выбранных регионах среди этих особей овец было идентифицировано 17 124 SNP (MAF> 0,05). Мы рассчитали ΔAF каждого SNP и подтвердили, что ген PDGFD является наиболее дивергентным локусом между толстыми и тонкохвостыми овцами (, рис. 2A, ), что снова означает, что PDGFD , вероятно, является наиболее многообещающим кандидатом на роль расхождение овечьего хвоста. PDGFD является одним из членов семейства факторов роста тромбоцитов (PDGF), которые играют важную роль в регуляции развития и функции адипоцитов [25, 26].Паттерн экспрессии по множеству проблем, полученный из базы данных Human Protein Atlas (http://www.proteinatlas.org/), показал, что PDGFD относительно более широко экспрессируется в жировой ткани, чем в других тканях ( Supplementary Fig. S3 ) . Это уже известное участие PDGFD в метаболизме липидов является дополнительным подтверждением гипотезы о том, что этот ген является идеальным кандидатом на жировой хвост у овец.

    Рисунок 2. Анализ вариаций последовательности гена PDGFD .

    (A) Распределение абсолютной разницы частоты аллелей ΔAF вариации последовательности в пределах 24 идентифицированных генов с селекционными сигнатурами между 13 особями толстохвостых овец и 16 особями тонкохвостых овец из разных регионов. Варианты последовательности были загружены из проекта NextGene. Красная пунктирная линия указывает пороговое значение (ΔAF> 0,6). На нижней панели показано распределение абсолютной разницы частоты аллелей ΔAF вариации последовательности в пределах гена PDGFD .Красная пунктирная линия указывает пороговое значение (ΔAF> 0,6), а красные точки представляют SNP с ΔAF> 0,9. (B) Гаплотип сочувствия между тонкохвостыми и толстохвостыми овцами, полученный на основе всех вариаций в пределах высокодифференцированного геномного интервала 6,8 т.п.н. (Chr15: 3 854 063–3860 894 п.н.). Каждый столбец представляет собой полиморфную геномную локацию (всего 122), каждая строка представляет собой поэтапный гаплотип (16 тонкохвостых овец и 13 особей жирнохвостых овец), а альтернативные аллели помечены синим цветом. (C) Полученная частота аллелей 13 основных кандидатных SNP у дополнительных овец с толстым хвостом (китайская овца Тан) и тонкохвостой овцы (китайская тибетская овца), полученная с помощью Sequenom MassARRAY.

    Кроме того, отмечено, что ΔAF особенно повышен в области 6,8 т.п.н. (Chr15: 3 854 063 - 3 860 894 п.н.) в гене PDGFD , содержащем 51 наиболее дифференцированный SNP (ΔAF> 0,6) ( Дополнительная таблица S6 ). Сравнительный анализ гаплотипов с использованием всех SNP (n = 122) в этом регионе выявил последовательную дифференциацию между породами овец с разными типами хвоста ( рис.2Б ). Следовательно, вероятно, что эта область размером 6,8 т.п.н. является мишенью положительного отбора для жирного хвоста и является лучшим кандидатом для функциональной мутации (мутаций). Эта область расположена в первом интроне PDGFD ( Fig. 2B , снизу), что указывает на то, что мутации, вызывающие ассоциацию с фенотипом жирного хвоста, являются регуляторными. Затем мы генотипировали в общей сложности 13 SNP, которые демонстрируют наивысшее значение ΔAF (> 0,8) между тонкохвостыми и откормленными овцами и частоту больших производных аллелей у овец с толстым хвостом (> 0.8) на основе результатов повторного секвенирования генома с использованием Sequenom MassARRAY в расширенной когорте, содержащей 200 тибетских овец (тонкохвостые овцы) и 184 желтых овцы (жирнохвостые овцы). Этот анализ подтвердил, что все эти SNP сильно расходятся (, рис. 2C, ). В совокупности эти наблюдения убедительно свидетельствуют о том, что идентифицированная здесь область размером 6,8 т.п.н. заслуживает дальнейшего исследования для выявления причинной мутации (ов).

    В дополнение к PDGFD , несколько других выбранных генов, идентифицированных в этом исследовании, обладают известными функциями, которые связаны с метаболизмом липидов, например ENPP2 [27], ANAPC5 [28], RNF34 [29], KDM2B [30], CAMKK2 [31], TSHR [32] и CDh2 [33].Генетическая дифференциация для этих генов не была столь выраженной, как для локусов PDGFD , подразумевая, что эти локусы, вероятно, вносят вклад в фенотипические различия с относительно небольшими эффектами. Мы также изучили распределение DAF лучших SNP-кандидатов, которые были предложены в предыдущих исследованиях, и результаты показали, что большинство этих SNP не всегда расходятся между популяциями овец с тонкими и толстыми хвостами [7–12] ( Supplemental Fig. S4 ).

    Экспрессия PDGFD связана с адипогенезом

    В качестве начального шага для выяснения роли PDGFD в развитии жирного хвоста у овец, ткани хвоста от толстохвостой китайской породы овец, а именно Тан овцы, в четыре года. различные эмбриональные временные точки, включая эмбриональный день 60 (E60), E70, E80 и E90, собирали и подвергали гистологическому анализу.Окрашивание HE показало, что липидная вакуоль отсутствует в клетках на E60 и E70, в то время как накапливается в клетках на E80 и E90, о чем свидетельствует наблюдение, что одна большая вакуоль присутствовала в клетке, а ядро ​​было упаковано в угол ( Рис. 3A. ), что характерно для зрелых адипоцитов. В соответствии с этим окрашивание Oil Red O, которое позволяет визуализировать жиросодержащие капли, показало, что большая часть клеток на E80 и E90 показала распределение липидных капель (, фиг. 3B, ). Эти наблюдения предполагают, что коммитированные преадиоциты присутствуют в тканях хвоста на E60 и E70, которые дифференцируются в зрелые адипоциты на E80 и E90.

    Рисунок 3. Экспрессия PDGFD связана с адиопогенезом.

    (A) Окрашивание гематоксилином и эозином (HE) тканей хвоста овец с жирным хвостом на 60-е сутки эмбриона (E60), E70, E80 и E90. Области, выделенные рамкой, снизу увеличиваются. Красные стрелки указывают на типичные липидные капли. (B) Окрашивание масляным красным О для тканей хвоста овец с жирным хвостом на E60, E70, E80 и E90. Области, выделенные рамкой, снизу увеличиваются. (C) Экспрессия нескольких маркерных генов, участвующих в адипогенезе, в тканях хвоста овец с жирным хвостом на разных стадиях эмбрионального развития, выявленная с помощью RNA-seq.Экспрессия PDGFD в тканях хвоста овец с жирным хвостом на разных стадиях эмбрионального развития, выявленная с помощью (D), RNA-seq и (E) кПЦР. (F) Тепловая карта, показывающая матрицу корреляции между экспрессией PDGFD и указанными маркерами адипогенеза. (G) Экспрессия PDGFD в различных фракциях клеток подкожной жировой ткани человека. Макрофаги были подразделены на M1 и M2 (GSE100795). (H) Экспрессия Pdgfd во время адипогенеза преадиопоцитов 3T3-L1 мыши, индуцированного DHA жирной кислоты ω-3, выявленного с помощью RNA-seq (GSE118471).

    Дальнейший анализ РНК-seq показал, что экспрессия некоторых маркерных генов, которые, как известно, подавляются (FKBP5, BMP5 и PDGFRA) и повышаются ( LPL , FABP4 и OPLAH) во время адипогенеза не имел очевидной разницы между E60 и E70, но значительно уменьшался и увеличивался на E80 по сравнению с более ранними стадиями, соответственно ( Рис. 3C ), подтверждая гистологические результаты, что клетки в тканях хвоста откормленных овец подвергаются адипогенезу от E60 / 70. к E80 / 90.Интересно, что экспрессия PDGFD неотличима между E60 и E70, но резко снижается на E80 ( Fig. 3D ). Последующий анализ qRT-PCR подтвердил значительное снижение экспрессии PDGFD на E80 с последующим продолжительным, но не значительным снижением на E90 по сравнению с таковым на E60 и E70 ( Фиг. 3E ). Другие гены-кандидаты, включая BMP2 , которые были предложены в нескольких исследованиях [8, 9, 12], не показали специфических колебаний в экспрессии, отражающих процесс созревания адипоцитов в тканях хвоста вместе с эмбриональным развитием ( Supplemental Fig.S5 ). Анализ корреляции экспрессии генов показал, что экспрессия PDGFD высоко положительно коррелирует с маркерами, обогащенными преадипоцитами, в то время как обратно коррелирует с маркерами, активируемыми в зрелых адипоцитах ( Fig. 3F ). Соответственно, ретроспективный анализ общедоступных наборов транскриптомных данных показал, что экспрессия PDGFD выше в предшественниках жировой ткани, чем в других типах клеток, выделенных из белой жировой ткани человека ( рис. 3G ), и резко снижается во время адипогенеза мыши 3T3- L1 ( Рис.3H ). Эти результаты вместе предполагают, что экспрессия PDGFD обогащена в преадипоцитах и ​​подавляется во время адипогенеза.

    PDGFD не регулируется между жировыми тканями тощих и толстых особей у разных видов

    Дальнейший анализ qRT-PCR показал, что экспрессия PDGFD выше в тканях хвоста откормленных овец, чем у тонкохвостых овец как на E70, так и у взрослых ступени ( фиг. 4A и B). Интересно, что повторный анализ общедоступных наборов данных показал, что PDGFD также более широко экспрессируется в жировой ткани у людей с ожирением, чем у худых, у обеих мышей ( рис.4C ) и человека ( фиг. 4D и E ), что предполагает эволюционно законсервированную роль PDGFD в гемостазе зрелых адипоцитов.

    Рисунок 4. Экспрессия PDGFD выше в жировой ткани у тучных людей, чем у худых у разных видов.

    (A) Экспрессия PDGFD выше в жировых тканях тонкохвостых и жирнохвостых овец на E70 и (B) стадии взрослой особи, выявленной с помощью кПЦР. * P <0,05. (C) Экспрессия Pdgfd выше в паховом жире у мышей с высоким набором веса, чем у мышей с низким набором веса, выявленная с помощью анализа microArray (GSE4692).* P <0,05 (n = 3). Экспрессия PDGFD выше в адипоцитах худых индейцев, чем у индейцев с ожирением, как у (D), мужчин, так и у (F) женщин, выявленных с помощью микроматрицы (GSE2508).

    Сегмент консервативной интронной области влияет на экспрессию

    PDGFD у человека

    Далее мы попытались изучить регуляторную роль наиболее высокодифференцированных SNP, обнаруженных в первом интроне PDGFD ( рис. 2 ).Было отмечено, что мутация (SNP OAR15_3859314) имеет высокую частоту у овец с толстым хвостом ( фиг. 5A, ) и встречается в чрезвычайно консервативной области между видами, включая человека ( фиг. 5B ). Поэтому мы заподозрили, что он может иметь решающее значение для регуляции экспрессии PDGFD , и выбрали его для дальнейшего исследования. Вместе с предыдущими результатами, показывающими, что аналогично наблюдениям на овцах, экспрессия PDGFD также повышена в преадипоцитах человека и выше у людей с ожирением ( рис.3G и рис. 4E-F ), мы намеревались распространить наши открытия у овец на человека, исследуя ортологическую область PDGFD человека. Для этого мы клонировали фрагмент последовательности человека (WT, дикий тип), а также мутированный фрагмент с истощением консервативной области длиной 20 п.н., окружающей сайт, ортологичный овечьему SNP OAR15_3859314 (Del), в репортерный вектор люциферазы и выполнили двойные люциферазные репортерные анализы ( фиг. 5C, ). Сначала мы трансдуцировали векторы в клетки человека A549, и результаты показали, что активность репортера, несущего человеческую последовательность WT, значительно подавлена ​​по сравнению с холостым вектором люциферазы ( фиг.5D ), предполагая, что вставленная последовательность WT играет роль ингибирования в регуляции экспрессии PDGFD . Интересно, что активность мутантного репортера была восстановлена ​​относительно репортера, несущего последовательность WT ( фиг. 5D, ), что указывает на то, что консервативная область является функциональной и способна транскрипционно активировать экспрессию PDGFD . Эти наблюдения были дополнительно подтверждены анализом люциферазного репортера, проведенным на преадипоцитах 3T3-L1 мышей ( рис.5E ). Более интересно, что анализ eQTL (локусы количественных признаков экспрессии) показал, что мутация, расположенная на 532 п.н. непосредственно ниже соответствующего локуса мутации OAR15_3859314 овцы в геноме человека, значительно увеличивает экспрессию PDGFD в жировых тканях человека ( рис. .

    Фигура 5. Мутация, встречающаяся в консервативном сайте промотора PDGFD , регулирует экспрессию PDGFD .

    (A) Частота наследственных аллелей интронного SNP chr15: 3 859 314 у пород овец с тонкими и толстыми хвостами, определенная с помощью повторного секвенирования генома (у 29 особей овец) и massARRAY (в расширенных выборках). (B) Схематическая диаграмма структуры гена PDGFD человека, показывающая сайт, соответствующий интронному SNP овцы OAR15_3859314 (красный), консервативный у многих видов. Последовательность дикого типа и последовательность, которая удаляет фрагмент длиной 20 п.н., содержащий консервативную мутацию (делецию), использовали для конструирования люциферазного репортера. Локус зеленого цвета (rs11226207) указывает SNP, описанный в « F ». (C) Схематическая диаграмма, показывающая стратегию конструирования люциферазного репортера.Фрагмент длиной 222 п.н. в первом интроне человека, содержащий гомологичную область интронного SNP овцы chr15: 3 859 314 и мутированную версию с истощением последовательности 20 п.н., несущей консервативную мутацию, клонировали в репортерный вектор люциферазы Pgl4.23. Пустой вектор служил контролем. (D) Результаты анализов репортера люциферазы, проведенных в клетках A549 и ( E ) 3T3-L1. Значения пустого вектора были установлены равными 1. ( F ) Мутация, проксимальная к SNP chr15: 3 859 314, значительно изменяет экспрессию PDGFD в жировых тканях человека, выявленную анализом eQTL в базе данных GTEx.Местоположение этого SNP указано в « B ».

    Обсуждение

    Для точного картирования генов-кандидатов, лежащих в основе фенотипа жирного хвоста овец, в данном документе мы всесторонне проанализировали данные геномных вариаций большой когорты пород овец с разными типами хвоста со всего мира и интегрировали два различных критерия отбора. для обнаружения участков генома с сигналами отбора. Мы продемонстрировали, что локусы гена PDGFD демонстрируют самую высокую генетическую дифференциацию между толстыми и тонкохвостыми овцами, а также обнаружили, что потенциальные причинные мутации локализуются в регуляторной области.Кроме того, мы показываем, что экспрессия PDGFD отрицательно связана с созреванием адипоцитов и выше в жировых тканях у полных людей, чем у худых у разных видов. Наконец, мы представляем доказательства, показывающие, что мутация, происходящая в консервативной области первого интрона, функциональна для транскрипционной активации экспрессии PDGFD у человека.

    По сравнению с несколькими существующими работами, в которых изучались породы овец из ограниченных географических областей и сообщалось о совершенно разных кандидатах, связанных с фенотипом жирного хвоста [7–12], в этом исследовании была проанализирована самая большая когорта образцов до сих пор, насколько нам известно. , происходящие со всего мира.Такая практика позволяет избежать предвзятости, связанной с географической изоляцией или структурой населения, и, таким образом, представляет собой более однозначную и действенную стратегию. Фактически, наш анализ репликации лучших SNP, предложенный в предыдущих исследованиях в нашей большой когорте, показывает, что большинство из этих SNP демонстрируют генетическую дифференциацию только между некоторыми региональными популяциями овец, включая SNP, соответствующие BMP2 , о которых сообщалось в нескольких независимых исследованиях [8, 9, 12]. Например, три SNP, OAR13_51852034.1, ORA13_51886803.1 и s27419.1, в локусе BMP2 , показали относительно более высокий DAF у овец с толстым хвостом, чем у овец с тонким хвостом ( Supplemental Fig. S4 ). К сожалению, уровень генетической дифференциации первых двух SNP ниже порога для всего генома в одном (MEF против SAT) и двух парах групповых сравнений (MEF против SAT, MEF против EUT), соответственно ( Supplemental Table S3 -5 ), которые, вероятно, вызваны низкой распространенностью производного аллеля в некоторых популяциях жирнохвостых овец, таких как Afshari, LocalAwassi и EthiopianMenz ( Supplemental Fig.S4 ). Следовательно, BMP2 имеет более низкий приоритет, чем локус PDGFD , как кандидат на фенотип с жирным хвостом. Кроме того, недавнее исследование, основанное на данных повторного секвенирования всего генома, показало, что PDGFD является наиболее высоко дифференцированным локусом между популяциями толстохвостых овец из Китая и Ближнего Востока и тонкохвостыми тибетскими овцами, за которыми следует BMP2 в качестве локуса. второй верхний высокодивергентный ген [9], что еще раз подтверждает наши выводы о том, что PDGFD является преобладающим кандидатом на жировой хвост у овец, хотя наше исследование имеет ограничение, заключающееся в том, что исследовались только гены, покрытые чипом Ovine 50K Beadchip.

    Развитие жировой ткани связано со спецификацией и дифференцировкой клеток-предшественников (преадипоцитов) в зрелые адипоциты, а также с увеличением размера адипоцитов [34]. Этот хорошо организованный процесс включает изменения в экспрессии ряда молекулярных регуляторов, которые еще предстоит открыть. Наш гистологический анализ и анализ экспрессии генов показывают, что экспрессия PDGFD отрицательно связана с накоплением адипоцитов в жировых тканях во время эмбрионального развития у овец ( рис.3A-F ). Соответственно, повторный анализ данных, полученных из предыдущих исследований на человеке и мышах, показывает, что экспрессия PDGFD обогащена преадипоцитами и снижается во время адипогенеза из клеток-предшественников ( Fig. 3G-H ) [21, 22]. Эти наблюдения убедительно подтверждают, что PDGFD играет критическую роль в инициации и / или обязательстве преадипоцитов, и эта функция сохраняется и универсальна для разных видов. Несмотря на постоянное снижение экспрессии во время развития, мы обнаружили, что PDGFD поддерживает более высокую экспрессию в тканях хвоста овец с жирным хвостом, чем у овец с тонким хвостом, от эмбриональной (E70) до взрослой стадии ( Рис.4A и B ). Подтверждая это, предыдущее исследование показало, что экспрессия PDGFD значительно усиливается в жировой ткани хвоста у толстохвостой овцы Хулун Буир по сравнению с тонкохвостой тибетской овцой [35]. Более того, другое исследование показало, что PDGFD по-разному экспрессируется в жировой ткани хвоста самки овцы Хулун Буир с разными уровнями накопления жира в хвосте [36]. Что еще более интересно, этот паттерн экспрессии сохраняется у мышей и людей, у лиц с ожирением наблюдается более высокий уровень экспрессии PDGFD в жировой ткани ( рис.4C-E ) [23, 24]. Вместе с недавним исследованием, в котором сообщается, что экспрессия PDGFD связана с количеством адипоцитов в белой жировой ткани человека [37], мы предполагаем, что PDGFD является новым регулятором адипогенеза и гемостаза адипоцитов. Для подтверждения этой потенциальной функции необходимы дальнейшие анализы усиления / потери функции.

    Мы обнаружили список мутаций, которые расположены в первом интроне PDGFD и демонстрируют высокую частоту у овец с толстым хвостом, а низкую - у овец с тонким хвостом ( рис.2 и Дополнительная таблица S6 ). Поскольку интронные мутации в основном влияют на эффективность транскрипции генов, создавая или разрушая сайты связывания для транскрипционных факторов [38, 39], вероятно, что повышенная экспрессия PDGFD у овец с толстым хвостом связана с некоторыми / одной из этих мутаций. . Мы сосредотачиваемся на одной мутации, которая возникает в эволюционно консервативной области ( Fig. 5A-B ), и исследуем регуляторную функцию консервативного сегмента у человека.Интересно, что мы доказываем, что фрагмент ортологической последовательности человека подавляет экспрессию PDGFD , в то время как удаление последовательности, окружающей эту мутацию, ослабляет эффект ингибирования ( Фиг.4A-D ). Это предполагает, что консервативный сегмент, окружающий сайт мутации (SNP OAR15_3859314 овцы), транскрипционно активирует экспрессию PDGFD и объясняет более высокую экспрессию PDGFD в тканях хвоста овцы с жирным хвостом. Следует отметить, что эта мутация отсутствует у человека и других видов, что отражает тот факт, что фенотип жирного хвоста уникален для овец, а также предполагает консервативную роль интронной области в регуляции экспрессии PDGFD .Интересно, что мутация, расположенная на 532 п.н. ниже по течению и предположительно находящаяся в одном и том же неравновесном блоке сцепления соответствующего сайта SNP OAR15_3859314 овцы, значительно увеличивает экспрессию PDGFD в жировых тканях человека ( Fig. 5F ). В сочетании с наблюдениями, что экспрессия PDGFD в жировой ткани у людей с ожирением выше, чем у худых людей как у овец, так и у людей ( Рис. 4 ), мы считаем, что мутации, происходящие в интронной области, ортологичной области-кандидату, мы выявили у овец ( рис.2 ) склонны к повышению экспрессии PDGFD и способствуют накоплению жира.

    В заключение мы продемонстрировали, что ген PDGFD является преобладающим фактором, лежащим в основе фенотипа жирового хвоста у овец, и является новым регулятором адиопогенеза и поддержания гемостаза зрелых адипоцитов. Мутации, происходящие в первом интроне PDGFD , вероятно, связаны с транскрипционной активностью PDGFD и отложением жира. Эти результаты важны для понимания эволюции жирового хвоста у овец и полезны для улучшения животных на основе генома, а также болезней, связанных с ожирением, у человека.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *