Перейти к содержимому

Мыши как плодятся: как быстро плодятся, как рождаются новорождённые мышата и как выглядят детёныши с фото, сколько длится беременность мышки


как быстро плодятся, как рождаются новорождённые мышата и как выглядят детёныши с фото, сколько длится беременность мышки

Декоративные мыши — плодовитые существа, достигнув половой зрелости, они способны приносить потомство в течение всего года. О том, как размножаются грызуны в домашних условиях, сколько дней длится их беременность, а также как ухаживать за новорождёнными животными, читайте далее.


Что влияет на размножение мышей

В дикой природе на размножение домовой мышки могут повлиять только внешние факторы, такие как холод, голод и прочие погодные катаклизмы, ведь беременная самка должна хорошо питаться, быть в тепле и безопасности, что невозможно создать в столь экстремальных условиях. Но не стоит полагать, что дома легче получить приплод от грызунов. Существует масса нюансов, без соблюдения которых не удастся вывести красивых, декоративных животных. Для того, чтобы достичь желаемого результата при размножении мышей, следует правильно выбрать самца и самку.

При их подборе оценивается:

  • плодовитость;
  • окрас и общее состояние шерсти;
  • телосложение;
  • масса.

Для спаривания нельзя выбирать агрессивных животных, а также самок, которые поедают своё потомство. Главное, чтобы пара была здоровой. Самка — в меру упитанная, с блестящей, шелковистой шерстью, также оценивается её способность к выработке молока по предыдущим родам. Самец должен быть крупнее, чем его партнёрша, плотного телосложения. Его шерсть — красивого, ровного цвета, блестящая.

Важно! Мыши, страдающие ожирением, как правило, долго не могут принести приплод, поэтому перед спариванием их необходимо содержать на специальной диете и увеличить их двигательную активность.

Когда мышке можно рожать

Половая зрелость у самок грызунов наступает быстро, на 30–35-й день существования. Но в домашних условиях первое спаривание должно произойти сроком не ранее, чем на 12-й неделе жизни, тогда репродуктивные качества мыши будут более качественными.

Самцы достигают половой зрелости, когда семенники переходят в мошонку, как правило, данное явление происходит в 5–7 недель. Именно данный фактор свидетельствует о том, что животное готово размножаться.

Половой цикл мышей

Определить готовность самки к спариванию можно по наличию течки, фазу которой определяют путём взятия мазка из полового органа. Цикл у мышей составляет 3–9 дней.

В дикой природе самка может приносить приплод до 14 раз в год. Но в домашних условиях, для того чтобы получить качественное потомство, необходимо проводить спаривание 7–9 раз в год. При более частой беременности самка истощается и может родить слабых мышат, которые вскоре погибнут.


При создании оптимальных условий грызуны могут давать потомство в любое время года. Но чтобы исключить внеплановое размножение при содержании одной пары животных, их рассаживают в разные клетки, а подсаживают друг к другу только для случки.

Как происходит спаривание

Самцы проявляют особый интерес к самкам в период течки. Заметить момент, когда представительница слабого пола готова к случке, можно по таким признакам, как: умиротворённость, характерное выгибание спины, растопыривание задних конечностей. Чтобы животные могли продолжить род, их помещают в одну клетку. Спариваться мыши могут в любое время суток, поэтому нет нужды выбирать особый момент.

После соития самку отсаживают в отдельную клетку. Через 2 часа её вновь отправляют к тому же самцу для повторного покрытия. Далее за мышкой женского пола наблюдают до предполагаемой следующей течки, если она не наступит, значит, оплодотворение прошло успешно.

Как проходит беременность

Первым признаком беременности у мыши, конечно, будет отсутствие следующей течки. Также самка может измениться в поведении, стать агрессивнее или, наоборот, ласковее. Её движения станут более плавными и размеренными.

Знаете ли вы? Мышь-малютка достигает в длину всего 5 см и по праву считается самой мелкой представительницей мышиного вида.

Также могут наблюдаться признаки токсикоза:

  • апатичность;
  • отказ от пищи;
  • судороги;
  • опускание век;
  • блёклость шерсти.

В таком случае следует предлагать мышке больше питья и любимых продуктов, сделать комфортными условия пребывания в клетке и помещении, устранить всевозможные стрессовые ситуации. В помещении должна быть комфортная влажность до 70% и температура от +18°С до +20°С. Комнату следует проветривать 2 раза в сутки, но не допускать сквозняков, которые могут привести к простудным заболеваниям.

Не стоит без причин брать беременную самку в руки. При проведении ежедневной прогулки по комнате нужно соблюдать меры безопасности и исключить падение мышки с высоты, соприкосновение с электроприборами, мышке нельзя ходить там, где можно встретиться с другими домашними питомцами или маленькими детьми, которые, играя, могут нанести вред зверю.

В норме беременность у грызуна длится от 19 до 26 суток. Среднее число дней до родов составляет 22 дня, именно в этот период следует ожидать начала родовой деятельности, поэтому следует заранее подготовить для мышки специальный домик, в котором она будет ухаживать за новорождёнными. В течение всей беременности нужно следить за сбалансированностью питания питомца.

В его рацион должны входить такие категории продуктов


  • фрукты;
  • овощи;
  • молочка;
  • мясо;
  • рыба.

В середине беременности и после родов в рацион вводят препараты кальция и продукты, которые также содержат много данного минерала.


В основном мышата рождаются в ночное время суток, начиная с полуночи до 4 часов утра или в вечернее время — с 18:00 до 22:00. Процесс появления потомства на свет практически всегда проходит легко и гладко. Его продолжительность примерно 120 минут. Когда самка будет рожать, самца можно оставить в клетке, он будет заботиться о приплоде, вылизывая и укрывая новорождённых мышат.

Но во время родов могут случиться и осложнения, которые чреваты смертью потомства или самой мышки, поэтому человеку, желающему размножать мышей, необходимо знать, при каких симптомах необходимо незамедлительно вызвать ветеринара:

  • если схватки длятся уже более 15 минут, но роды так и не начались;
  • после рождения одного мышонка прошло более часа, а следующие детёныши не появляются.

Численность помёта

На численность помёта влияют такие факторы, как:

  • видовая принадлежность;
  • телосложение.

У крупных видов мышей и крыс численность одного помёта может быть от 1 до 3 детёнышей. У полевых, домовых и прочих разновидностей мелких мышей самая большая численность новорождённых — до 12.

Как ухаживать за новорождёнными мышатами

Новорождённые мыши не имеют шерсти, у них закрыты глаза и уши. Они не в состоянии самостоятельно двигаться, поэтому в первые дни их роста и развития им во всём помогает мать. Она кормит малышей и вылизывает остатки внутриутробной слизи.

Детёныши, только что появившиеся на свет, имеют массу примерно в 2 г и длину тела в пару сантиметров. Хозяину мышей следует знать, что он ни в коем случае не должен брать новорождённых грызунов в руки, ведь на них останется чужой для самки аромат, и она может загрызть своё потомство или бросить кормить. Но, в свою очередь, владелец должен всё же визуально осмотреть помёт и при выявлении мертворождённых особей аккуратно удалить их из домика.

На 5-й день грызуны могут слышать, через неделю они уже имеют собственную меховую шубку, на 14-е сутки у них открываются глаза. По истечении 21 дня мышата становятся полностью дееспособными, и их можно отселить от родителей. Новорождённые питаются только молоком матери, а по достижении ими самостоятельности (возраст 3 недели) в их рацион постепенно вводят зерновые, молоко, сухофрукты.

Знаете ли вы? При сильном испуге у мышей вместе с мочой выделяется вещество, которое сигнализирует другим особям об опасности.

Мыши способны быстро плодиться, но большое количество помётов может негативно сказаться на здоровье самки и её потомства, поэтому при разведении декоративных мышей следует качественно подбирать партнёров, а также следить за частотой беременностей мыши в год.

Была ли эта статья полезна?



4 раза уже

Как избавиться от грызунов?

В Центре гигиены и эпидемиологии подготовили памятку по организации и проведению дератизационных мероприятий.

Синатропные (живущие  рядом с человеком) грызуны – это серая и черная крыса, домовая мышь, которые в основном постоянно живут в постройках человека. Есть грызуны, которые лишь на неблагоприятное время года вселяются в жилые здания. Причем большинство из них рыжая полевка, лесные мыши, только в некоторых местах используют строения человека, как правило, это дачные постройки, избы рыболовов или охотников в лесу. Будучи всеядными, синантропные грызуны приспосабливаются к питанию самыми разнообразными продуктами.

Серая крыса –  это, несомненно, изо всех грызунов самый злейший враг человека. У нее есть еще несколько названий – пасюк, рыжая амбарная крыса. Взрослая крыса весит 400 - 500 г, но нередко самцы достигают 700 - 800 г. Продолжительность жизни у  них обычно больше (2 -3 года), чем у «диких» крыс. Крысы проникают в здания, используя небольшие выступы стен. Могут подниматься по вертикальному шесту, лазить по деревьям, по вьющимся вдоль стен растениям.

Если на пути крысы, находится какая – либо преграда, то она будет долго и упорно её грызть, пока не преодолеет это препятствие.

Пасюки очень подвижны, они способны перепрыгивать через рвы и канавы. Напуганные, они быстро передвигаются крупными прыжками. Живя в непосредственной близости от человека, крысы стараются делать убежища малозаметными; часто они устраивают их среди различных укрытий, не роя нор. На складах, на свалках, в подвалах многоэтажных домов, в мусорокамерах и прочих местах, где много корма и есть надёжные укрытия, крысы устраивают гнезда из обрывков картона, бумаги, волокон тряпья и успешно маскируют их среди хлама. Кроме того, они устраивают гнёзда в пустотах между строительными блоками, в подвесных потолках, в канализационных сооружениях и т.п. Но там, где они вынуждены рыть норы, крысы проявляют большое искусство.

Над их устройством трудятся несколько поколений крыс. Такие норы бывают глубиной до 2-2,5 метров и их протяженность доходит до 30-35 метров с несколькими входами. В них имеется несколько гнездовых камер, в которых обитают детеныши разного возраста. Размножаются крысы круглый год. Беременные самки крыс встречаются в течение всего года, срок беременности около 25 дней, в одном выводке 7 – 8 крысят. Крысы живут небольшими группами по 5-15 особей. Во главе такой группы стоит самец – «хозяин» (доминант). В состав группы входят самцы «заместители», подчиняющиеся «хозяину», и совсем молодые самцы, которые боятся всех более взрослых самцов. Самки в этих группировках держатся независимо. Преимущество имеют беременные и кормящие особи.

Самка, у которой есть выводок, никого и даже «хозяина» не подпускает к своему гнезду. Самца - доминанта можно отличить от других крыс по его внешнему виду и поведению. Это наиболее сильный и смелый самец. Он широко и несколько косолапо ставит лапы. Когда он агрессивно настроен, шерсть его слегка взъерошена, как бы стоит дыбом. В местах, где много крыс, часть их видна и днем - это, в основном, «изгои» - молодые подчиненные самцы. Они не могут прокормиться в обычное для них время суток (сумеречные и предрассветные часы), так как боятся сильных самцов и выходят из укрытий, когда старшие отдыхают. Поэтому, если крысы видны днем, значит их очень много.

Количество синантропных крыс может понизить только человек, правильно и регулярно проводя дератизацию.

Домовая мышь – массой 15 – 25 грамм широко распространена по земному шару. Численность мышей в постройках всецело зависит от обилия находящегося в них корма. Мыши являются всеядными. Запасов пищи, как и крысы не делают. Они могут устроить гнездо и родить детенышей прямо в пакете с крупой. Беременность самки мыши продолжается до 21 дня. Родятся чаще 6 – 8 детенышей, но их может быть и 12.

Правда, живут мыши недолго, обычно не больше одного года. Гнезда домовых мышей можно найти где угодно. В квартирах они чаще всего устраивают их на кухнях: между плитой и стеной, на полках с посудой (если ею редко пользуются), под отставшими обоями, прямо в сухих продуктах, в цветочных горшках, в диванах, и т. д. Они, как и крысы живут группировками, во главе которых стоит самец – доминант. Люди относятся к домовым мышам гораздо более терпимо, чем к крысам. Однако эти маленькие назойливые существа приносят человеку вред, наверное, не меньший, чем их более крупные сородичи.

Помимо огромного экономического ущерба, который грызуны приносят, уничтожая и портя продукты питания, обгрызая разные ценные предметы велика и эпидемиологическая опасность. Домовая мышь, так же, как и крысы являются носителями целого ряда инфекций, опасных для человека. Это псевдотуберкулез, везикулёзный (оспоподобный) риккетсиоз, лептоспироз, эризипелоид, туляремия и чума. Одни инфекции передаются через различных членистоногих (блох, клещей), другие – через мочу и кал грызунов, попадающие на продукты питания человека.

Профилактической дератизацией в населенных пунктах занимаются специализированные организации с обученным персоналом, имеющим разрешение на данный вид деятельности. В своей работе они используют различные методы борьбы с грызунами: биологический, физический и химический. Большое значение в городах и населенных пунктах имеет дератизация в открытых незастроенных биотопах (свалки ТБО, неорганизованные свалки в черте населенных пунктов, подземные сооружения и коммуникации).

Во всяком случае, полное освобождение города от крыс при правильном выявлении всех поселений грызунов – реальная вещь, если мероприятия проводятся во всех строениях и прилегающей к ним территории. Успех дератизации везде, где бы она ни проводилась, определяется знанием особенностей жизни зверьков в данных условиях.

По информации Центра гигиены и эпидемиологии, фото с сайта pixabay.com

Если заметили ошибку, выделите фрагмент текста и нажмите Ctrl+Enter

У однополой пары мышей появилось потомство

  • Джеймс Галлахер
  • Корреспондент BBC News по вопросам здоровья и науки

Автор фото, Leyun Wang

Подпись к фото,

У двух самок мышей родилось потомство, что дало надежду на генетический прорыв в будущем

У двух самок мышей без участия самца родились дети. Об этом сообщили ученые китайской Академии наук.

Это стало возможным благодаря значительному прорыву в генной инженерии.

Сейчас две дочки двух самок грызунов с измененными генами чувствуют себя хорошо, говорят ученые, и то, что их генетический код изменен, пока не заметно.

При этом такой же эксперимент с парой самцов не был успешным. Потомство от двух отцов прожило после рождения только 48 часов.

Зачем нужно это исследование?

Млекопитающие, в том числе и люди, могут рожать детей только в результате полового акта самки и самца.

Но остальной мир природы не играет по тем же правилам.

Есть другие классы животных, в том числе рептилии, амфибии и рыбы, которые могут воспроизводить потомство, если они одного пола и даже если у них вообще нет партнера. Некоторые из них - гермафродиты, вообще не имеющие разделения на два пола.

Млекопитающие пока на такое не способны.

Китайские ученые решили выяснить, какие правила репродукции им нужно нарушить, чтобы получить потомство от однополой пары мышей.

Это поможет понять, почему эти правила так важны.

Автор фото, Getty Images

Подпись к фото,

Многим рептилиям не требуется партнер, чтобы иметь потомство

Как они это сделали?

Исследователи взяли яйцо от одной мыши и специальный тип клетки - гаплоидную эмбриональную стволовую клетку - от другой.

Просто собрать все это вместе было недостаточно. Чтобы сделать их совместимыми, исследователи должны были использовать технологию, которая называется редактирование генов.

Это сделали для того, чтобы во время развития плода и после рождения у него не начали развиваться генетические аномалии, несовместимые с жизнью.

Две мыши родили 29 живых мышат, которые были нормальными, дожили до взрослого возраста и даже имели потомство.

Эксперимент с двумя самцами был сложнее. Сначала ученые взяли сперму, мужскую гаплоидную эмбриональную стволовую клетку, яйцо без генетической информации, а затем удалили семь генов.

Но все это не сработало.

Автор фото, Leyun Wang

Подпись к фото,

Малыши, родившиеся от отцов, прожили менее 48 часов и погибли

Они взломали гены, и что теперь?

Наш генетический код ведет себя по-разному, в зависимости от того, происходит он от матери или от отца, отметили в Cell Stem Cell.

И без женской копии или мужской никто не родится, говорят ученые.

Как считает профессор Ли, это исследование показывает, что в будущем, возможно, однополые пары смогут иметь детей.

Однако многие исследователи сомневаются в этом методе и его применении к людям.

Мыши - виды, размножение, питание

Мыши относятся к отряду грызунов из семейства млекопитающих. Они обитают повсеместно, большинство видов живет в тропиках и субтропиках. Самые маленькие представители отряда имеют длину тела от 5 см, а самые крупные виды достигают 48 см в длину. В России обитает около 13 видов мышиных:
  • Домовая мышь является самым мелким представителем отряда грызунов. Хвост животного составляет половину всей длины его тела. Домашние мыши могут быть серыми, белыми, черными, желтыми и других оттенков. Обитают они практически повсеместно и довольствуются небольшим количеством корма – им достаточно 5 г зерна в день.
  • Мышь-малютка достигает 13 см в длину. Шерсть имеет ярко-рыжую окраску, а брюхо и лапки белые. Грызун неприхотлив в еде, может питатьсязерновыми кормами, свежей зеленьюи насекомыми.
  • Мышь белая или мышь-альбинос – это разновидность домашней мыши. Эти животныечасто выращивается для опытов и научных работ, за что их прозвали лабораторными мышами. Питается белая мышь овощами, зерновыми культурами, зеленью и животным кормом. Эти грызуны легко поддаются дрессуре.
  • Полевки обитают в лесолуговых зонах, рядом с человеком селятся редко.Зверек достигает 12 см в длину. Окраска рыжевато-коричневая с четкой черной полосой на спине. Питаясь насекомыми и растительной пищей, полевки наносят огромный вред в сельском хозяйстве.
  • Песчанки обитают в пустынях и полупустынях. Они достигают 18 см в длину, на хвостеестьнебольшая кисточка. Грызуны имеют серо-бурую, желтую и черную окраску. Сельскому хозяйству они не вредят и легко адаптируются к жизни у человека.
  • Лесные мыши селятся в норах, на лугах и около рек. У маленьких зверьков крупные ступни и небольшое тело с коротким хвостом. Питаются грызуны зерновыми кормами и насекомыми.
Другими представителями отряда являются малая лесная, иглистая, горная, желтогорлая, долгохвостая мыши и т.д.

Домовая мышь

Этот грызун обитает рядом с человеком практически во всех странах мира, выбирая в качестве жилья дома и хозяйственные постройки. Активность зверьков усиливается к концу лета и осенью, когда они начинают массово переселяться в те места, где им легче будет найти корм (овоще- и зернохранилища, дома, склады). Иногда эти грызуны зимуют в скирдах и стогах. Весной мыши покидают места зимовки и возвращаются на поля, в сады и огороды.

Гнезда грызунов можно найти в кучах мусора, под полом, на чердаках. Для создания гнезда зверьки используют ткань, бумагу, перья, шерсть, искусственные волокна – все, что им удается найти. Мыши заботятся о чистоте в своем жилище и нередко покидают гнездо, если в нем загрязнилась или намокла подстилка, а также, если оно сильно заражено паразитами. Свои постоянные маршруты они метят мочой.

Мыши селятся семейными группами или небольшими колониями, в которых живут несколько самок с потомством и один доминантный самец. Внутри колонии наблюдается особая иерархия. Взрослые самцы нередко проявляют друг к другу агрессию, а самки мирнососуществуют с другими самками.

6 Размножение мышей. Мыши


Размножение мышей

Декоративные мыши, как и большинство грызунов, имеют одну особенность – они способны размножаться круглогодично.

Разведение этих животных в домашних условиях требует особого внимания и предполагает возникновение различного рода трудностей.

Для достижения успеха в этой области следует строго соблюдать рекомендации и общепринятые принципы разведения.

При подборе пары производителей оценивают по следующим показателям:




качество шерстного покрова;


Подбираемые для разведения самки декоративных мышей должны быть здоровыми, упитанными, с блестящей шерстью. При подборе самок следует учитывать также их плодовитость и материнские качества. Очень важно подбирать самок, у которых во время предыдущих периодов размножения было достаточно молока, так как это качество передается по наследству. Нельзя спаривать самок, поедающих свое потомство, а также агрессивных зверьков.

Самцы должны быть несколько крупнее самок, с блестящей шерстью хорошо выраженного цвета.

Спаривать самку декоративной мыши больше 2 раз в год не рекомендуется, поскольку при частых родах она ослабевает и приносит потомство, которое плохо развивается и часто гибнет, не достигнув половой зрелости. Что касается самцов, то их репродуктивные способности тоже ослабевают при частом спаривании, и самки нередко остаются неоплодотворенными.

Случаи рождения ослабленных или мертвых детенышей у здоровых самок декоративных мышей крайне редки. Как правило, такое случается при неполноценном питании беременной самки, когда в кормах недостаточно витаминов и микроэлементов, а также при некоторых тяжелых инфекционных заболеваниях.

Слишком упитанные или ожиревшие зверьки, как правило, бывают бесплодными. Таким самцам и самкам во время подготовки к размножению необходимо в течение недели дать возможность больше двигаться. Кроме того, из рациона страдающих ожирением мышей надо исключить продукты, богатые жирами и углеводами, заменив их сочными, богатыми витаминами и минералами корма. Так, в период подготовки к спариванию желательно скармливать производителям корма, богатые витамином Е (проросшее зерно и сочная зелень).

Плодовитость декоративных мышей зависит от запаса половых клеток в яичниках самок.

Одним из самых важных и основных показателей являются продолжительность беременности и возраст мыши, в котором происходили первые роды.

В совокупности это позволяет определить скорость цикла воспроизведения.

В нижеприведенной таблице содержатся данные о плодовитости различных видов грызунов.

Для декоративных мышей, как правило, минимальная продолжительность беременности самок составляет примерно 18 дней.

При разведении следует учесть, что величина выводка у декоративных мышей намного выше, чем у грызунов, живущих в естественных условиях. Это объясняется тем, что плодовитость увеличилась в результате длительного искусственного отбора.

Специалисты по разведению декоративных грызунов иногда сталкиваются со случаями, когда правильно подобранные производители с хорошей родословной приносят потомство низкого качества. Из-за этого не следует расстраиваться, так как стандартные признаки породы, как правило, восстанавливаются в следующих пометах.

Таблица 5

Плодовитость грызунов в домашних условиях

Данный текст является ознакомительным фрагментом.

Продолжение на ЛитРес

«Как размножаются летучие мыши?» – Яндекс.Кью

Летучие мыши размножаются с помощью секиса, в "почти классической" миссионерской позе, если бы классикой считалось спать на потолке.

Сексуальная активность отряда рукокрылых изучена довольно плохо, но, в общих чертах процесс размножения происходит по следующим этапам:

Брачный период у летучих мышей, из средних широт случается, раз в год, в редких случаях дважды (осень и весной). Исключением являются обитатели тропической местности, размножение которых может происходить круглый год.
Начинается с ухаживания самцов за самками: первые завлекают объект своей будущей страсти – серенадами. Самцы поют индивидуальные песни, сочетая слоги в разных вариациях.

Бразильский складчатогуб может включать в собственный зов от 15 до 20 слогов.

Когда особенно хорошие певцы сходятся в пары с самками, наступает активный этап продолжения рода.

У разных представителей отряда рукокрылых, не менее разные представления и о сексе:

  • Летучие мыши средней полосы вообще не создают пар: самец, как настоящий альфа, ерзает, приближается к ближайшей самке и в полу спящем состоянии спаривается с ней.
  • У индийских коротконосых крыланов и летучих лисиц в почете оральный секс.
  • До 70 % самок крыланов, орально стимулируют пенис самца. Это приводит к увеличению времени полового акта примерно в два раза (а соответственно и шансы к потомству).
  • Самцы лисиц, поступают аналогично самкам крылана, к своим партнершам дабы удалить из тела самки сперматозоиды, оставленные прошлыми сексуальными партнерами

Процесс оплодотворения и дальнейшего вынашивания потомства происходит не менее разнообразно.

Рукокрылые живородящие, беременность у самки длится ~16 недель, и помет содержит не более одного "потомка". У определенных видов максимальное количество новорожденных может достигать 3 щенят.

Но непосредственно рождение потомства, самки летучих мышей, стараются оттянуть до весеннего сезона года.

Особенно это характерно для умеренных широт:

  • У ночниц (Myotis) спаривающихся осенью, оплодотворение яйцеклетки происходит позже. Сперма сохраняется в матке в течение примерно пяти месяцев, до следующей весны,
  • У пальмового крылана (Eidolon helvum) яйцеклетка оплодотворяется сразу же после спаривания, но затем ее развитие останавливается, и она имплантируется в стенку матки только через 3–5 месяцев.
  • У ямайского фруктоядного листоноса (Artibeus jamaicensis) остановка развития примерно на 2,5 месяца наступает уже после имплантации бластоцисты в матку.

Причины кроются в способе их жизни: беременной самке нужно продолжать активные поиски пропитания, а малыш появляется на свет немаленьким: его размер составляет 25% от материнского организма.
Когда же наступает время воспроизвести потомство на свет, самки предпочитают рожать детеныша, так же, как предпочитают спариваются или спать: вверх ногами.
Это позволяет новорожденному попасть сразу в материнскую сумку, что увеличивает его шансы на выживание.

Все потому, что детёныш рождается голым, слепым, без шерсти, с узкой щелочкой вместо рта и скомканными в комок ушами.

Как размножаются мыши

Автор yanavazari На чтение 4 мин Просмотров 292 Опубликовано

Спаривание и беременность грызунов
Мышь и мышата

Как размножаются мыши, интересно знать не только владельцам домашних питомцев, но и особам, которые ведут беспощадную борьбу с грызунами. Мышиное потомство привлекает к себе повышенное внимание и доброжелателей, и противников.

Физиологические способности

В дикой природе процесс беременности, рождения регулируется самостоятельно, напрямую зависит от климатических условий, наличия пищи. В домашних условиях многое зависит от человека.

Мышь становится половозрелой в возрасте от 30 до 50 дней в зависимости от разновидности и условий проживания. Однако окончательное формирование зверька заканчивается к 12 месяцам. Раннее оплодотворение может нанести существенный вред организму, животное рискует погибнуть во время родов.

Допускается спаривать домашнюю мышь в 6 месяцев, в природе этот момент наступает несколько раньше. За год самка способна воспроизвести до 8 потомств. Но происходит это редко, по нескольким причинам.

  1. В природе завершается размножение мышей с наступлением холодов.
  2. В домашних условиях беременность контролирует человек.

В среднем одна мышь за год рожает 4 раза. Способность к оплодотворению появляется через 14 часов после родов. Период течки длится 18 часов. Весь брачный период очень быстрый – 5 дней.

Спаривание и беременность грызунов


В домашних условиях особи противоположного пола проживают в разных клетках, вместе живут в период брачных игр. Дикие мыши спариваются сразу с несколькими самцами, это увеличивает шансы на «успех».

Вынашивают детенышей мелкие грызуны около 24 дней. Домашнему питомцу увеличивают рацион на 1/3 часть на первом этапе беременности, наполовину до наступления родов. От того, чем питается мышь, зависит общее самочувствие самки, благополучие беременности.

На заметку!

Мыши страдают токсикозом на любом этапе вынашивания детенышей. Внешние признаки – опущенные веки, повышенное слюноотделение, плохой аппетит, сниженная активность. Лечению токсикоз не поддается. Необходимо обеспечить беременной самке покой, меньше брать на руки.

На протяжении беременности необходимо в клетке поддерживать чистоту, оставлять бумагу, кусочки ткани, сено. Чтобы мама-мышка готовила гнездышко, место для родов.


Как рождаются мыши, увидеть удается мало кому, поскольку процесс происходит ночью. Длится около 2 часов. Перед родами необходимо почистить клетку, продезинфицировать, положить свежее сено.

Сколько мышей рождается за один раз – от 5 до 14. В дикой природе количество детенышей в среднем 11 штук. Среди них могут быть мертвые, слабые. Мышь съедает их, давая возможность получать больше молока сильному потомству.

Мышь и мышата


Если самец жил в клетке вместе с самкой до самых родов, накануне следует его убрать. Поскольку отец способен съесть своих же детенышей. Очень часто такое явление происходит в природе, если самка на время отлучится из гнезда. Самец в выращивании потомства не участвует.

Если схватки длятся долго, а родить самка не может, вызывают ветеринара. Когда же пришло время родов, схваток нет, но мышь ведет себя активно, хорошо ест предложенный корм – волноваться нет причин. Разведение каждого вида имеет свои особенности, продолжительность беременности способна варьироваться в большую, меньшую сторону.


Рождаются мыши голыми, слепыми, глухими, с неразвитыми конечностями. Но имеют отличный аппетит, ежедневно в физическом развитии происходят существенные преобразования:

  • через неделю – это уже милые пушистые создания;
  • спустя 14 дней появляется слух, открываются глазки;
  • в 3 недели своей жизни мышата выползают из гнезда, обследуют пространство.

Брать на руки маленьких детенышей не рекомендуется, поскольку мышь может от них отказаться. Но с 20 дней жизни делать это нужно, чтобы мышонок рос ручным. В 30 дней потомство становится самостоятельным, можно отдавать в другие руки.

Плодятся мыши быстро, при комфортных условиях процесс может продолжаться постоянно. Но самка много затрачивает сил на выкармливание мышат, беременность, роды. Поэтому, чем выше рождаемость, тем слабее здоровье взрослой особи.

Все о жизненном цикле мыши

Сколько живут мыши?

Если вы думаете, что можете избежать общения с этой мышью у себя дома, просто дождавшись ее смерти, подумайте еще раз. Жизненный цикл мыши позволяет легко понять, почему эти грызуны являются такими распространенными вредителями. Дело не в том, что продолжительность жизни мышей неестественно велика, а скорее в том, что мыши являются печально известными заводчиками. Всего одна самка мыши в вашем доме может дать в среднем от 25 до 60 потомков за один год. На этом этапе у вас больше нет проблемы с мышью - у вас есть заражение мышью.

Селекционные машины

Когда самка мыши беременеет, ей требуется от 19 до 21 дня, чтобы родить помет. Каждый помет обычно состоит из пяти или шести щенков мышей, хотя нередко можно увидеть до 12 в помете.

Типичная самка мыши может рожать от пяти до 10 пометов в год. Она может спариваться сразу после родов, то есть мыши могут родить второй помет всего через 25 дней после первого. Этот цикл продолжается до тех пор, пока мышь не умрет.К тому времени потомки ее потомства, вероятно, также родили несколько пометов, которые начинают размножаться.

Рождение мыши

Щенки рождаются без меха, ушей и зрения. Поскольку они слепые и беззащитные, мышь-мать кормит своих детенышей 21 день. Эти первые дни жизненного цикла мыши наполнены быстрым прогрессом. На четвертый день их уши полностью развиты. Волосы начинают расти примерно на шестой день, а к 10-му они покрываются защитным мехом.

Щенки по-прежнему не открывают глаза примерно до 13 или 14 дня, но после этого они становятся почти взрослыми особями. На двадцать первый день происходит отлучение от груди. Большинство щенков мужского пола покидают территорию своей матери, но многие молодые самки остаются на некоторое время. В любом случае, для обоих полов кормление закончено, и они готовы начать пережевывать вашу еду и пожитки.

Сколько живут мыши?

В возрасте 6 недель самка домашней мыши становится половозрелой и готова начать производить собственных детенышей.Этот быстрый процесс созревания дает мышам огромные возможности для размножения. Проживание в помещении увеличивает эти возможности, так как они могут размножаться круглый год. На открытом воздухе размножение происходит только весной, летом и осенью. Зимние месяцы слишком суровы для успешного размножения.

И так же, как увеличивается продуктивность размножения, если мышь укрывается в вашем доме, увеличивается и продолжительность их жизни. В то время как средняя продолжительность жизни мышей на открытом воздухе составляет всего около 12 месяцев, в помещении это число может возрасти до 2–3 лет.Это связано с тем, что в помещении мыши не подвергаются суровым условиям окружающей среды или естественным хищникам. В результате им ничего не остается, как поедать ваши ценности, распространять болезни среди вашей семьи и воспитывать будущие поколения, которые несут бедствие.

Остановите жизненный цикл мыши, прежде чем у вас возникнет какая-либо из этих проблем. Позвоните в Terminix®, профессионалам, которые знают, как значительно сократить срок службы мыши.

Центр животноводства и развития

Ниже поясняется метод разведения, используемый для наибольшего количества мышей, выращенных в помещении для животных (метод естественного спаривания).

(В зависимости от конкретной мыши или породы размер помета и время отъема могут отличаться)


Схема разведения мышей методом естественного спаривания выглядит следующим образом.
  • Самцы мышей и самки мышей живут вместе в клетке, где они спариваются, а затем после периода беременности около 20 дней рождаются детеныши мышей.
  • От одной самки можно получить от 5 до 10 детенышей мышей (это зависит от вида).
  • Детенышей мышей отлучают от груди через четыре недели после рождения, и затем их можно выращивать самостоятельно.
  • Через 8 недель после рождения они становятся половозрелыми, после чего самцы и самки могут быть спарившимися, чтобы произвести потомство.

Важным моментом является понимание следующего: когда произошло спаривание, было ли спаривание успешным и какая мышь родила мышей.
Без этого знания могут возникнуть следующие побочные эффекты:
  • - спаривание самки мыши, которая уже была повязана, не увеличивает скорость размножения
  • - самка мыши, которую постоянно спаривают, будет уставать, и, таким образом, скорость размножения не увеличится.
  • - Более одного самца мыши могут вызвать драку из-за самки и привести к травмам
Ниже объясняются моменты, которые необходимо соблюдать.

Метод спаривания

Разделение клетки

  1. Получены самки и самцы мышей и помещены в отдельные клетки, где они выращиваются.
  2. За несколько дней до начала спаривания самцов мышей будут содержать индивидуально (1 мышь на клетку), а самок мышей будут содержаться в стаде (5 мышей на клетку).

Создание нового поколения через селекцию

  1. Принимая во внимание следующие моменты, самцов и самок мышей объединяют и спаривают.
    • Половая зрелость: как самцы, так и самки мышей достигают половой зрелости в возрасте 8 недель, могут спариваться и рожать.
    • Половой цикл: наблюдается вульва самки мыши, и когда она становится опухшей и красной (это показывает, что половой цикл находится в точке проэструса), ее выбирают для спаривания, и, таким образом, скорость размножения увеличивается.
      (Информацию о набухании вульвы см. На фото [proestrus] на этой странице)
    • Эффект аборигенов: когда самку помещают в клетку мышей-самцов, скорость размножения увеличивается.
    • Количество мышей: на каждую мышь-самца приходится от одной до двух мышей-самок.
    • Время: Самцов и самок мышей собирают вечером.
  2. На следующее утро проводится осмотр женской вульвы, и, если наблюдается вагинальная пробка, происходит спаривание.
    Поскольку вагинальная пробка отпадает к полудню, наблюдение следует проводить утром.
    Затем ведется журнал, в котором записывается информация о самцах и самках мышей, которые должны стать родителями, и о дате подтверждения вагинальной пробки.
  3. Самки мышей, у которых подтверждена вагинальная пробка, содержатся вместе в одной клетке
  4. За несколько дней до даты доставки (20 дней после подтверждения наличия вагинальной пробки) каждой мыши предоставляется собственная клетка, и на клетку помещается сообщение, которое гласит: «Дата доставки близка, поэтому, пожалуйста, не заменяйте эту клетку», таким образом устранение лишнего волнения от замены клеток и т. д.
  5. В течение одной недели после родов клетки не меняют, пока мать кормит детенышей.
  6. Через четыре недели после родов детенышей мышей отлучают от груди.
    Затем самцов и самок мышей разделяют на отдельные клетки.
    Чтобы обеспечить достаточно места для одного животного, мышей разделяют так, чтобы не превышало 5 мышей на клетку.
  7. Через 8 недель после рождения мышей можно вязать для получения потомства.

Эффективная селекционная технология

В Зале для животных мы разработали эффективную технологию разведения мышей с использованием экстракорпорального оплодотворения вместо естественного спаривания.Используя эту технологию, можно вывести большое количество щенков, можно оплодотворить около 100 яиц на самку.

Заинтересованным лицам следует связаться с персоналом системы Mouse Bank.


Обращение с генетически модифицированными организмами строго определено законом. По этой причине, если что-то произойдет, например, если генетически модифицированные животные сбегут из учреждения, учреждения и исследователи будут наказаны по закону.
Даже в комнате для разведения, пожалуйста, сообщите персоналу учреждения, когда мышь сбежала из клетки.У нас есть специализированные инструменты для отлова мышей, и мы будем сотрудничать, чтобы обеспечить возвращение животных в их клетки.

-> Список контактов (только для внутреннего использования в университете)

Разведение и содержание мышей

Как обращаться с мышами?
Большинство мышей довольно послушны и не кусаются, если их не спровоцировать. Если мыши расстроятся, займитесь чем-нибудь другим и вернитесь к ним, когда они успокоятся.

Перевод мышей из клетки в клетку. Осторожно возьмите мышь за хвост рукой в ​​перчатке. Взяв мышь за основание хвоста, вы получите больший контроль. Бесхвостых мышей можно схватить за шиворот. Расслабьтесь и осторожно прикасайтесь к мышам. В большинстве случаев, если вы расслаблены, если мышь попытается вас укусить, это будет легкий исследовательский поклев, который не повредит. Некоторые штаммы, особенно штаммы дикого происхождения, очень активны и могут создавать проблемы при обращении. С этими штаммами могут помочь длинные щипцы (Fisher 10-316C).Не следует использовать щипцы, за исключением случаев, когда это необходимо для защиты оператора.

Проверка пробок, осмотр мышей. Для проверки разъемов и некоторых других наблюдений требуется немного больше управления мышью. Переместите мышь в верхнюю часть клетки так, чтобы стержни клетки двигались влево-вправо. Возьмите мышь за основание хвоста между большим и указательным пальцами и поместите остальные пальцы захватывающей руки на крестец и поясницу мыши.Когда вы схватите мышь, она оттолкнется от вас, опираясь передними лапами на перекладину клетки, что позволит вам осмотреть ее нижние области.

Работа с мышами для маркировки, инъекций и желудочного зондирования. Для маркировки, инъекций и желудочного зондирования требуется полный контроль над мышью. Следующие инструкции приведут к тому, что мышь будет обездвижена в вашей левой руке, а правая рука будет свободна. Поместите мышь поверх решеток клетки так, чтобы полоски шли влево-вправо. Возьмитесь за хвост правой рукой, а затем левой рукой поскребите мышь.Правильно вытирайте мышь - ключ к успеху. Вы хотите обездвижить голову мыши, и для этого необходимо очистить всю свободную кожу на задней части шеи. Чтобы взять всю эту кожу в свои руки, начните чистящие движения с плеч мыши, большим пальцем с одной стороны и указательным пальцем с другой. Кожа на тыльной стороне мыши может быть зажата между оставшимися пальцами и ладонью. Для желудочного зондирования и инъекции тело мыши также необходимо обездвижить: растяните тело мыши, осторожно потянув за хвост правой рукой, и зацепите мизинец левой руки за хвост.Здесь дается более развернутое и подробное описание того, как делать желудочный зонд.

Если вы не обязаны работать с мышами в определенное время дня, вам будет легче работать с мышами с утра до полудня. Мыши наиболее активны непосредственно перед тем, как погаснет свет, и с ними труднее справиться в конце дня.

Как отличить самцов от самок?
Расстояние между наружными гениталиями и анусом у мужчин больше, чем у женщин на всех постнатальных стадиях.Примерно после двухнедельного возраста соски у женщин обычно видны, а у мужчин - нет. У взрослых очевидным маркером является мошонка самца (и яички, если они вывернуты). Для недоношенных детей сориентируйте клетку так, чтобы прутья проходили влево-вправо, и поместите мышь на решетку клетки. Возьмитесь за хвостик мыши большим и указательным пальцами, а остальные пальцы поместите на заднюю часть мыши и согните торец мыши к себе. Мышь будет пытаться оторваться от вас, используя прутья клетки.Новорожденных мышей легче всего половить, если область гениталий мыши полностью расширена: возьмите мышей и осторожно согните поясницу, чтобы растянуть область гениталий. У пигментированных штаммов новорожденные самцы мышей имеют пигментное пятно на мошонке. Примерно в двухнедельном возрасте соски самок мышей более заметны, чем соски самцов. Эмбрионы и плоды можно типировать с помощью ПЦР с праймерами SMCX-1 5'CCGCTGCCAAATTCTTTGG3 'и SMC4-1 5'TGAAGCTTTTGGCTTTGAG3'. Самки дают одну полосу, а мужчины дают две полосы из-за различия интронов между генами X и Y (Agulnik et al.1997 Мамм. Genome 8, 134-138). Альтернативно, праймеры Jarid 1c F CTGAAGCTTTTGGCTTTGAG и Jarid 1 c R CCACTGCCAAATTCTTTGG амплифицируют полосу из 331 п.н. у женщин, но две полосы по 302 и 331 п.н. у мужчин: Clapcote SJ и Roder JC. Biotechniques 2005 38 (5): 702. Анализ симплексной ПЦР для определения пола у мышей. PMID: 15945368.

Как вязать мышей?
Если вы не торопитесь производить много потомства, поместите самца мышей с одной или двумя самками. Если в клетке не слишком тесно, мышей можно оставить вместе до тех пор, пока щенки не будут готовы к отлучению от груди.Если вам нужны мыши преимущественно одного пола, вы можете удалить нежелательный пол через несколько дней после рождения (не беспокойте мам в течение первых 24 часов после рождения). Остальные щенки будут расти быстрее. Тем не менее, вы должны знать, что самки - лучшие матери, если у них есть как минимум 3 щенка, о которых нужно заботиться, поэтому не производите выбраковку слишком сильно. Если вам нужно быстро расширить штамм, вы можете вязать самок в период течки с самцами каждый день и проверять пробки на следующее утро. Домашние самки с похожей вилкой встречаются вместе вплоть до отъема детенышей.Для многих штаммов двух беременных самок и их пометы можно содержать вместе до отъема, хотя вы можете обнаружить, что особенно плодовитые штаммы, такие как CD1, требуют, чтобы клетка была разделена, чтобы избежать переполнения. Рекомендации IACUC для мышей с пометами ограничивают количество мышей до 2 взрослых и не более 20 детенышей.

Сколько длится беременность?
Беременность от 18 до 20 дней, в зависимости от штамма.

Как я могу предотвратить уничтожение пометов матерями?
Мыши общительны и лучше заботятся о своих детенышах, когда они живут с друзьями.Размещайте самок вместе с отцом или беременных самок вместе, или держите беременную самку с небеременной самкой. Однако не помещайте мышей в клетку за несколько дней до рождения, так как это их побеспокоит. Матери-новички и очень молодые самки с меньшей вероятностью смогут успешно вырастить помет, чем опытные матери и более зрелые самки. В первый день после родов нельзя беспокоить матерей и их пометы. Ко второму дню матери должны полностью усвоить материнское поведение и лучше переносить сбои.Неблагоприятные условия окружающей среды, такие как внезапные громкие звуки и недостаточная вентиляция, также могут иметь пагубный эффект. Некоторые штаммы более материнские, чем другие (см. Список характеристик штаммов Jax). В трудных ситуациях вы можете вырастить щенков до более материнской линии или совместно содержать беременную мышь материнской линии на той же или более поздней стадии беременности (с другим цветом шерсти) вместе с вашей проблемной мамой. Вы можете держать под рукой одну или несколько клеток с беспородными брачными парами (например, мышей CD1 из Charles River) для взращивания щенков.Подробное описание выращивания мышей, предоставленное лабораторией Джексона, доступно здесь. Кроме того, см. Раздел ниже о повышении репродуктивной способности.

Когда следует отлучать мышей от груди?
Мышей следует отлучать от груди через 3-4 недели после рождения. Если одна и та же мама родила второй помет, щенков необходимо отлучить от груди. Щенки должны быть крепкими, активными, с открытыми глазами, зубами и взрослой шерстью, а не с редкой шерстью младенцев. Им необходимо иметь возможность прыгать на верх клетки, чтобы кормить и пить.Если они слишком незрелые, позвольте им проводить с мамой дольше. У многих пород щенки, готовые к отлучению от груди, будут «попкорн», когда крышка клетки будет открыта. Если вы не уверены в их способности выздоравливать самостоятельно, вы можете оставить немного размягченного водой корма на дне клетки, чтобы помочь им пережить первый или два дня.

Когда мыши становятся половозрелыми?
Самки мышей становятся половозрелыми через 6 недель после рождения, а самцы - через 8 недель.

Какие методы эвтаназии приемлемы?
Мышей наркотизируют путем вдыхания CO 2 , а затем умерщвляют путем смещения шейного отдела позвоночника.Хотя CO 2 сам по себе может усыпить животных, необходимо установить, умерли ли животные (см. Рекомендации NIH по использованию только CO 2 ), поэтому после использования CO 2 рекомендуется шейный вывих. CO 2 должен доставляться из резервуара , а не из сухого льда. ARC предоставляет резервуары и камеры. Дайте газу течь в течение 1 минуты, чтобы заполнить камеру, и оставьте камеру закрытой на 5 минут. Наркотизация мышей происходит быстро, поэтому не оставляйте камеру без присмотра.Смерть должен быть обеспечен шейным вывихом. В различных помещениях CWRU мышей можно оставить на стойках в специально отведенном помещении для усыпления сотрудниками ARC. Мыши не должны быть переполнены, и у них должно быть достаточно еды и воды, чтобы их хватило на рабочие часы следующего рабочего дня. Если отлученные от груди щенки остаются без матери, необходимо немедленно уведомить ARC, чтобы можно было без промедления провести эвтаназию.

CO 2 для эвтаназии дешев, удобен, эффективен и не представляет большого риска для персонала и исследователей, но гуманность его использования все чаще обсуждается.Альтернативный метод эвтаназии - обезболивание мышей изофлураном перед смещением шейного отдела позвоночника. В химический вытяжной шкаф (то есть во взрывозащищенном вытяжном шкафу с выходом наружу) поместите полную крышку изофлурана на ткани на дне небольшой камеры (пустая пластиковая коробка для наконечников пипетки для усыпления одиночных мышей), поместите мышь внутрь и закройте камеру. Когда мышь неподвижна, откройте камеру и выполните шейный вывих. Имейте в виду, что изофлуран представляет опасность для здоровья, и следует избегать воздействия на персонал, ограничивая использование химических вытяжных шкафов и анестезиологических аппаратов, а также путем надлежащего хранения.

Мыши могут быть умерщвлены путем смещения шейки матки без анестезии опытными и компетентными людьми, если это научно обосновано. IACUC может потребовать демонстрации навыков лечения смещения шейного отдела позвоночника. Вывих шейки матки выполняется путем взятия мыши за основание хвоста. Мышь может захватывать прутья поперечно ориентированной вершины клетки и, осторожно оттягивая назад за хвост, крепко захватывает основание черепа между большим и указательным пальцами.Чтобы обеспечить гуманную эвтаназию, вывих шейки матки следует изучать под наблюдением квалифицированного специалиста.

Какие методы эвтаназии приемлемы для эмбриональных и новорожденных мышей?
Новорожденных мышей можно наркотизировать в небольшом пластиковом пакете с CO 2 из газового баллона, пакет запечатывают, затем мышей усыпляют, помещая в морозильную камеру. Полные правила и рекомендации CWRU IACUC по приемлемым методам эвтаназии эмбриональных мышей (более 14 дней беременности), новорожденных мышей и молодых мышей доступны здесь.

Каковы приемлемые эффективные способы маркировки мышей?
IACUC регулирует маркировку мышей. Перфорация ушей (перфораторы: Fisher 01-337B или Kent Scientific INS301202) может выполняться без анестезии. Наружные уши достаточно большие, чтобы пробивать уши после двухнедельного возраста. Однако через несколько недель прокалывание ушей может стать трудночитаемым из-за заживления. Для более стойкой маркировки допустимо удаление последнего сустава пальца ноги без анестезии в течение первой недели после родов.На каждую конечность можно обрезать только один палец. Анестезия должна использоваться для стрижки пальцев мышей старше одной недели. Необходимо предоставить научное обоснование использования обрезки пальцев ног вместо других методов идентификации. Полная политика CWRU IACUC в отношении стрижки пальцев ног находится здесь. Татуировка - приемлемая альтернатива, хотя она используется реже. Индийские чернила в шприце объемом 1 мл с иглой 30 калибра можно использовать для маркировки лап в различных комбинациях. В качестве альтернативы доступны коммерческие чернила для татуировок и устройства для татуировки (http: // www.ketchum.ca). В некоторых случаях генотипы необходимы при рождении: татуировка индийской тушью новорожденных лап с обрезкой хвоста хорошо работает на практике. Мышей, в том числе новорожденных, можно пометить в течение нескольких часов несмываемым маркером, однако чернила быстро удаляются мамами или при уходе, что делает отметку необходимой. Имплантированные чипы транспондера ID являются альтернативой, если не являются препятствием стоимость и трудозатраты.

Как генотипируют мышей?
Эффективный способ содержания мышей - это одновременное отлучение от груди, удар по уху и генотип.Генотипирование методом ПЦР наиболее эффективно. В идеале праймеры для ПЦР являются специфическими для мутации, а не общим набором, как праймеры для neo R или lacZ. Подробная информация о разработке и валидации тестов для генотипирования мышей доступна здесь. Здесь представлен простой и надежный протокол для ПЦР от ушей. В качестве альтернативы Саузерн-блоттинг может быть проведен на ДНК пальца ноги, полученной описанным здесь методом.

Как содержатся мужчины и женщины? Самцы не дерутся?
Самок можно разместить по пять человек в клетке и без проблем смешивать с незнакомыми самками.Особое внимание следует уделять жилищу самцов из-за их склонности к дракам. Самцы обычно не будут драться, если они будут жить вместе от периода до половой зрелости до старости. После половой зрелости самцы будут драться, когда познакомятся с новым самцом. Например, самцы, которые были размещены в одиночестве, будут драться с любым представленным самцом. Поэтому заводских самцов из одного помета следует содержать вместе с раннего возраста, чтобы сэкономить место. Самцы, используемые в качестве производителей, размещаются по одному в клетке и никогда не помещаются в клетку с другими самцами.Признаки драки между мужчинами проявляются в виде укусов и могут привести к смерти. Самки, содержащиеся вместе, иногда не могут ужиться, и это может проявляться в виде подстриженных до корня усов, выпадения волос на других четко разграниченных участках без повреждений кожи (зазубрины) или укусов спины и задних конечностей. Чаще всего это поведение можно устранить, поместив рассматриваемых самок в более низкую плотность или удалив доминирующую самку (ту, у которой все еще есть усы и у которой нет укусов). Легкое или умеренное парикмахерское действие может не потребовать разделения, но заслуживает более внимательного наблюдения в случае эскалации агрессии.

Что такое вилка?
Пробки полезны для получения синхронизированных вязок. Пробка - это затвердевшая сперма, которая блокирует влагалище и остается на месте примерно 12 часов после спаривания. Пробки обнаруживаются путем визуального осмотра или осторожного зондирования стерильной зубочисткой или тупым зондом (Fisher Seeker 08-995) у женщины, иммобилизованной, как описано выше. Предполагается, что спаривание происходит в середине темного цикла (полночь при 12-часовом цикле включения / выключения, начиная с 6), и, таким образом, полдень следующего дня равен 0.5 дней беременности. Полное описание стадий эмбриогенеза и развития плода у мышей см. В Hogan, B. L. M., Beddington, R., Costantini, F. и Lacy, E. (1994). «Манипулирование эмбрионом мыши. Лабораторное руководство». Колд Спринг Харбор Пресс.

Как узнать, что у мыши течка?
Самки мышей во время течки будут восприимчивы к спариванию. Выбирая самок в период течки, вы можете максимизировать размножение своих мышей или получить несколько самок, спариваемых одновременно.В среднем вы должны ожидать, что от двух третей до трех четвертей мышей в течке будут спариваться. У женщин во время течки наблюдается отек губы вульвы, ближайшей к анальному отверстию. Возьмите самку за хвост в проксимальной трети и, удерживая хвост большим и указательным пальцами, позвольте мыши ухватиться за планку клетки передними лапами и осторожно надавите другими пальцами на поясницу и крестец, чтобы наклонить гениталии. анальная область вверх (лордотическая позиция). Во время течки вульва опухает, но влагалище не открывается.

Цикл течки составляет от 4 до 6 дней, поэтому примерно у 1 из 5 самок в среднем должна быть течка в любое время, если самки меняют свой цикл беспорядочно. Тем не менее, самки, постоянно проживающие вместе, могут совершать циклы вместе или могут выйти из цикла течки. Молодые женщины (от 6 до 8 недель) с меньшей вероятностью перестали ездить на велосипеде. Воздействие мужских феромонов перезапустит цикл, равно как и изменение социальных групп среди женщин. Перенос подстилки из клетки половозрелого самца можно использовать для стимуляции езды на велосипеде.

Мои мыши не размножаются. Что можно сделать для размножения?
Мыши лучше всего размножаются, если им меньше восьми месяцев, поэтому следите за возрастом своих мышей. Штаммы с пониженной фертильностью лучше всего размножаются в молодом возрасте, но даже самые устойчивые сорта плохо размножаются после того, как им исполнится год. Знайте, чего ожидать от вашего штамма: в этом отношении полезен список характеристик штамма Jax. Количество жира в рационе может иметь значительное влияние на плодовитость самок (больше жира, больше плодовитости), но увеличение количества жира может отрицательно сказаться на продуктивности производителей.ARC может предоставить вашим мышам альтернативную пищу с более высоким содержанием жира (стандартная диета - Purina 5010, обезжиренная еда; Purina 5021 - еда с высоким содержанием жира). Внезапный шум может пагубно сказаться на размножении, равно как и плохое качество воздуха. Конфиденциальность обеспечивается "любовными лачугами" (KLASS 4960 Almaden Expressway, Suite 233, San Jose, CA 95118, США. Тел .: (408) 266-1235 скворечники для мышей MB-01) или гнездами (VWR 10279-140) могут помочь застенчивым штаммы. Цикл свет-темнота оказывает значительное влияние на воспроизводство мышей.Убедитесь, что ваши мыши используют соответствующий цикл (12 часов света, 12 часов темноты). В некоторых случаях увеличение светового периода (14 часов света и 10 часов темноты) может улучшить репродуктивный успех.

У моей мыши закрытые или увеличенные глаза, опухоли, алопеция или судороги: что не так?
Мыши могут страдать от множества болезней. Спектр болезней зависит от штамма, условий содержания и множества других условий, но в приведенном выше кратком списке приведены многие из распространенных недугов мышей.Тем не менее, часто обсуждайте с ветеринаром здоровье своих мышей. Карточка отчета о заболеваемости и смертности (MMR) ARC может использоваться исследовательским персоналом для маркировки клетки с больной мышью, чтобы получить осмотр животного ветеринаром ARC. Поместите заднюю бумажную копию с логотипом ARC в клетку для животного и доставьте две верхние копии в офис ветеринарного техника, EB12A.

Полезные ресурсы по здоровью мыши включают

Список инбредных линий мышей, составленный лабораторией Джексона, который дает информацию о восприимчивости различных линий мышей к болезням.

Руководство по оценке состояния и здоровья мышей, pdf-файл статьи Lab Animal.

Веб-сайт сравнительной патологии в Калифорнийском университете в Дэвисе

Веб-сайт Американского комитета по болезням лабораторных животных (ACLAD).

Следует ли мне беспокоиться о генетическом фоне моих мутантных мышей?
Генетический фон может иметь значительное влияние на мутантный фенотип. Для многих мутантов вам понадобится мутация хорошо охарактеризованного, надежного, распространенного инбредного штамма, такого как C57Bl / 6.Мутация обычно скрещивается с фоном C57Bl / 6 в течение 10 поколений, после чего она считается конгенной, поскольку ожидается, что геном на 99,8% состоит из C57Bl / 6. (Подробная информация об ожидаемом содержании генома в каждом поколении обратного скрещивания доступна в книге Ли Сильвера «Генетика мышей», доступной в Интернете в Лаборатории Джексона). После этого момента мутация может быть продолжена для скрещивания с инбредным штаммом. Мутанты, поддерживаемые путем скрещивания между собой, могут привести к фиксации новых мутаций внутри штамма, поэтому их следует избегать.В ходе селекции нокаутные или трансгенные штаммы, генотипированные с помощью ПЦР, иногда следует проверять с помощью Саузерн-блоттинга, поскольку капризы ПЦР привели к потере мутанта более чем в одной лаборатории. Трансгенные штаммы часто необратимо теряют экспрессию трансгена из-за метилирования сайта вставки, поэтому разумно проверять экспрессию трансгенных линий в каждом поколении. Криоконсервируйте свой штамм, если он не является одним из распространенных, коммерчески доступных штаммов. Криоконсервацию можно получить в местных (Case Transgenic and Targeting Facility и коммерческих службах (Jax; Charles River).В некоторых случаях большая устойчивость и воспроизводимость аутбредного штамма, такого как CD1 (из Charles River), является достаточным преимуществом, чтобы компенсировать гетерогенность фона, например, в исследованиях эмбриогенеза.

Ряд штаммов, обычно используемых для получения трансгенных мышей, либо являются слепыми (FVB / NJ), либо выделяют ген слепоты (B6SJLF1 / J и B6CBAF1 / J). Слепота у этих штаммов вызвана рецессивной дегенерацией сетчатки в результате отлучения от груди из-за мутации Pde6b rd1 .Список пораженных штаммов и обсуждение того, как справиться с этой проблемой, находятся здесь.

Многие инбредные штаммы (включая C57BL / 6J) имеют возрастную мутацию потери слуха 1 ( Ahl1 ), которая вызывает дегенерацию слуха, начиная примерно с 10-месячного возраста, в зависимости от генетического фона (Johnson et al., (2000) ) Геномика 70: ​​171).

Какой размер колонии мышей мне следует поддерживать?
Размер вашей колонии мышей зависит от ваших потребностей.Учитывая затраты на содержание мышей, вы должны сохранять свою колонию как можно меньше. Для штаммов, которые вы в настоящее время не используете, достаточно небольшой племенной колонии из нескольких клеток (позволяя ей опуститься до одной клетки, она живет на грани - не делайте этого). Мыши, которые не размножаются, - это тупик, поэтому убедитесь, что, если вы сократили количество выгула до минимума, чтобы мыши были плодовитыми и молодыми. Составьте график разведения заводчиков на замену, чтобы заводчики могли быть заменены, когда им будет от 6 до 8 месяцев.Криоконсервация мутантов и штаммов настоятельно рекомендуется для защиты от случайной потери. Структура колонии будет зависеть от ваших потребностей. Для тех, кто нуждается в спаривании по времени, необходим набор самцов-производителей, содержащихся в индивидуальном помещении, и клетки для небеременных самок, размещенные по пять человек в клетке. Для поддержания поголовья путем размножения в колонию также обычно входят размножающиеся пары (самец, самка и помет). Хорошее обсуждение эффективных стратегий разведения, отвечающих вашим потребностям, дано в UC Irvine Transgenic Core.

Насколько обширными должны быть записи о разведении? Что я должен отслеживать?
Ваши конкретные потребности будут определять уровень детализации, который вам понадобится в ваших записях о разведении. В случае больших колоний подробный учет может потребовать значительных ресурсов. Однако подробные записи необходимы для решения проблем, когда они возникают. Записи могут храниться в комбинации лабораторных тетрадей и карточек клеток, в пользовательских базах данных, в коммерческих специализированных базах данных (Bigbench Mouse, программное обеспечение для родословных Progeny) или в бесплатных базах данных (Система управления лабораторными животными (LAMS)) или в База данных FileMaker с использованием шаблонов, предоставленных другим MouSeek Калеба Дэвиса, различных шаблонов баз данных FileMaker, созданных различными лабораториями.)

Как отправить / получить мышей?
Все мыши, получаемые в CWRU от организаций, отличных от утвержденных коммерческих поставщиков, должны быть одобрены для получения ARC. Нестандартная форма поставщика (которую можно скачать здесь в виде pdf-файла, должна быть заполнена, отчет о состоянии мышей должен быть представлен, а ветеринарный врач CWRU ARC должен одобрить отправку. Отправка должна быть направлена ​​в получающий отдел отделения Health Sciences Animal Помещение. Как только ветеринар даст вам разрешение на отправку, вам будет предоставлен адрес для получения.Ни при каких обстоятельствах нельзя получать мышей без предварительного разрешения. В зависимости от патогенного статуса мышей, они могут быть одобрены для помещения в чистый или грязный карантин. Основным источником патогенов мышей являются мыши, полученные от исследователей из других учреждений. Методы, используемые для мониторинга инфекционных агентов, относительно нечувствительны, и контакт мышей с патогенами может происходить во время транспортировки. Лучший способ гарантировать, что болезнетворные микроорганизмы не занесены, - это восстановить поступающий штамм.Состояние здоровья всех мышей, поступающих не от коммерческих поставщиков, проверяется ARC, и они принимают решение о необходимости повторного получения или лечения перед выпуском из карантина. Повторное выделение мышей может быть выполнено центром трансгенных и целевых исследований Case. Самый быстрый способ отправить и вернуть - это отправить замороженные эмбрионы или сперму или живые доимплантационные эмбрионы. Преимплантационные эмбрионы могут быть доставлены либо криоконсервированными в жидком азоте, либо в виде бластоцист при комнатной температуре с доставкой в ​​течение ночи.Свяжитесь с трансгенной службой по поводу криоконсервации и доставки замороженных эмбрионов или эмбрионов комнатной температуры. В качестве альтернативы можно отправить живых мышей. Транспортные контейнеры для мышей можно приобрести у компаний Taconic и Zivic Miller. Еда и вода могут быть предоставлены в пакетах «Нектар Напа», которые можно приобрести в компании Lenderking. Вы должны знать, что транспортировка самок в первой трети беременности обычно приводит к резорбции эмбрионов. При отправке учитывайте прогноз погоды: вы не хотите отправлять в сильный холод или жару.Когда вы отправляете мышей в другие учреждения, они захотят узнать о состоянии здоровья ваших мышей и, вероятно, захотят связаться с ветеринарным персоналом ARC.

ARC может помочь с доставкой мышей в другие учреждения (форма экспорта нестандартных поставщиков). (Некоторые учреждения принимают информацию о состоянии здоровья только от животноводческого комплекса, а не от отправляющего ИП.)

Как уберечь мышей от патогенов?
Существует несколько различных уровней борьбы с патогенами.Эти уровни варьируются от коммерческих операций, предусматривающих содержание аксенических (стерильных) и гнотобиотических (определенных видов растений), до бестимусных и ультрабарьерных помещений в CWRU, вентилируемых стеллажных систем медико-санитарного отделения для животных и отделения для мышей Wolstein, статических микроизоляторов до обычных клеток. . Большинство мышей в CWRU не содержат специфических патогенов. Процедуры, которым вам необходимо следовать, устанавливаются ARC и будут зависеть от типа жилья. Однако во всех случаях можно соблюдать несколько общих правил.Следует учитывать, что мышиные патогены будут наиболее распространены среди мышей, и поэтому следует избегать контакта с мышами, которые являются потенциальными носителями патогенов: никаких домашних грызунов дома; следует немедленно отловить сбежавших и диких мышей в колониях; Избегайте контакта с мышами, которые, как известно, являются переносчиками патогенных микроорганизмов.

Где получить дополнительную помощь.

UC Irvine University Transgenic Core содержит отличное руководство по разведению и воспроизводству мышей

Базовое руководство по трансгенным мышам Мичиганского университета по разведению трансгенных мышей и мышей с нокаутом

Лаборатория Джексона имеет Руководство по стратегиям разведения мышей (.pdf)

Мышь как модельная система, собранная нами информация о генетике и биологии мыши.

CWRU ARC обеспечивает практическое обучение технике работы с микроизолятором и работе с мышью.

Полезную информацию о предыстории и практической стороне генетики мышей можно найти в книге Lee Silver's Mouse Genetics, которая сейчас опубликована в Интернете лабораторией Джексона.

Хоган Б. Л. М., Беддингтон Р., Костантини Ф. и Лейси Э. (1994). «Манипулирование мышиным эмбрионом.Лабораторное руководство. "Cold Spring Harbor Press


Хетерингтон, М., Доу, Б. и Хэй, Д. (2000). Уход и содержание мышей. В: «Генетика и трансгеника мышей: практический подход». Джексон, И. Дж. И Эбботт, К. М. редакторы. Издательство Оксфордского университета.

Разведение мышей | Обучение и образование


Мы надеемся, что эта информация будет полезна исследователям, которые не знакомы с селекцией мышей или впервые разводят трансгенных мышей или мышей, нацеленных на ген.Эти предложения основаны на нашем опыте. Они открыты для изменений и не должны рассматриваться как исчерпывающий набор правил.

Рекомендации по разведению мышей

1. Ведите точный учет разведения. Составьте родословную для каждого трансгенного основателя или химеры эмбриональных стволовых клеток-мышей.

2. Спарить мышей, когда они станут половозрелыми (от 6 до 8 недель). Мы рекомендуем скрещивать трансгенных основателей или химер с мышами C57BL / 6. После 6 поколений скрещивания с C57BL / 6 более 99% генетического фона будет C57BL / 6.Анализируя экспрессию гена на фоне C57BL / 6, можно контролировать любое влияние генетического фона на экспрессию гена по сравнению с нормальными мышами C57BL / 6. Альтернативно, химеры могут быть скрещены с мышами 129 / Sv + Tyr-c + p, которые имеют тот же генотип, что и эмбриональные стволовые клетки. Это даст мышей с мутацией целевого гена на фоне 129 / Sv + Tyr-c + p для сравнения с мутацией на фоне C57BL / 6.

3. Ожидайте появления пометов в течение месяца после спаривания, поскольку самки мышей вступают в течку каждые 3 или 4 дня, а время беременности мышей составляет 19-21 день.Если по прошествии одного месяца пометы не производятся, вы должны заменить мышей, которых вы вяжете со своим основателем. Вполне возможно, что трансгенный основатель может быть бесплодным из-за последствий экспрессии трансгена или по неизвестным причинам. Возможно, что фенотипически мужские химеры могут быть бесплодными, потому что они являются результатом колонизации женского эмбриона мужскими эмбриональными стволовыми клетками.

4. Причины использования мышей C57BL / 6.

a) C57BL / 6 - это стандартный инбредный штамм, обычно используемый в трансгенном разведении
b) спаривание мышей в возрасте 6-8 недель для достижения наилучших репродуктивных показателей
i.заменить самцов, когда им исполнится 1 год
ii. заменить самок после 6 пометов или когда им исполнится 6 месяцев
c) ​​спарить самца-основателя с 2 самками, чтобы получить 2 помета подряд
d) спарить самку-основатель с 1 самцом
e) мыши обычно снова спариваются в день самка рожает второй помет через 3 недели
после первого.
f) для быстрого производства животных, меняйте 2 самок через клетку самца каждые 1-2 недели
g) содержите беременных самок по 1 или 2 на клетку, чтобы избежать переполнения клеток

5.Общие проблемы и решения:

a) самка может не заботиться о первом помете
добавить в клетку проверенную самку-заводчик в качестве помощника и попробовать еще раз
b) самка не заботится ни о каком помете
чаще всего встречается со 129 самками, содержащимися на подстилке, что исключает конструкцию
сложная « подземные »гнезда
129 клетки для спаривания должны постоянно включать в себя материал для гнезд
b) самец может съесть подстилку
удалить самца из клетки для спаривания до того, как самка родит
c) ​​боевые мыши
i.отделите боевых мышей, поместите их по одной в клетку, если необходимо
ii. самки обычно не дерутся
iii. самцы могут драться при следующих обстоятельствах:
самца помещают в клетку, содержащую другого самца (ов)
самца отделяют при отъеме и затем воссоединяют с однопометниками
самца отлучают от груди в клетке, в которой содержатся самцы из другого помета
самцы агрессивны и может начать драку без видимой причины
Взрослый самец нападает на незрелую самку, когда самка помещается в клетку самца

6.График маркировки ушей, биопсии хвоста, отлучения от груди и спаривания:

a) записать рождение в карточку клетки и родословную
b) пометить щенкам ушные метки, когда им исполнится две недели
c) ​​получить биопсию хвоста при нанесении ушных меток
d) выделить ДНК хвоста и определить генотипы до того, как щенкам исполнится 21 день старый
e) записать генотипы в родословную
f) отлучить щенков от груди в возрасте 21 дня
i. забрать щенков от их матерей
ii. выбросить ненужных нетрансгенных детенышей
iii.Разделяйте самцов и самок
f) когда мышам исполняется 6 недель, их можно спаривать (см. 1. выше)

5 причин, по которым ваши мыши не размножаются

Были ли у вас проблемы с плохой продуктивностью колоний мышей? Вы когда-нибудь хотели, чтобы вы были доктором Дулиттл, чтобы спросить их, почему они не спариваются? К счастью, наши специалисты хорошо обучены выращиванию мышей и могут помочь вам лучше понять их потребности.

1. Вы их напрягаете!

Хотя у нас самые лучшие намерения, проверка мышей каждый день (или через день) может вызвать ненужный стресс, который, в конечном итоге, может повлиять на продуктивность размножения.Между сменой клетки, ежедневными проверками клетки и уровня воды, а также экспериментальными процедурами, мыши претерпевают множество нарушений в своей повседневной жизни. Смена клетки чаще, чем 1-2 раза в неделю может взволновать мышей, и если вы также часто открываете клетку, чтобы проверить благополучие мышей, у них может снизиться продуктивность размножения.

Помимо чрезмерного обращения, удаление самцов из клеток для разведения также может негативно повлиять на продуктивность разведения. Отделение самцов от их беременных самок может вызвать стресс у самок и может побудить их либо рассасывать пометы в утробе матери, либо бросить или каннибализировать их после рождения.В большинстве наших колоний в JAX самцы ВСЕГДА остаются со своими коллегами-самками. Если самца необходимо удалить, постарайтесь подождать, по крайней мере, пока родятся детеныши, и не возвращайте его в клетку, пока помет не будет отлучен от груди.

Оставление самцов в клетке также увеличивает общую продуктивность колонии за счет использования преимущества послеродовой течки - явления, при котором самки вступают в течку и становятся восприимчивыми к спариванию сразу после родов. Если самец все еще присутствует, самка может забеременеть вторым пометом, пока кормит первый, и родить второй через 3-4 недели, что повысит ее продуктивность.Если период послеродовой течки пропущен, самки не будут восприимчивы к спариванию до тех пор, пока их помет не отлучится от груди. Однако не забудьте уточнить у менеджеров вашего учреждения, сколько мышей они разрешают в клетке. Если второй помет рождается до того, как первый помет отлучен, вам может потребоваться отсеивание и отбраковка нежелательных мышей из первого помета или раннее отлучение всего первого помета. Также возможно размещение мышей в больших клетках, чтобы у них было несколько пометов.

Мыши - чувствительные существа, поэтому незаметные для человека шумы и вибрации могут сильно повлиять на них.Убедившись, что ваши обидчивые заводчики не находятся рядом с дверью или раковиной, где может быть интенсивное движение или громкий шум, и напоминание смотрителям, чтобы они работали аккуратно, медленно и тихо при обращении с мышами, может заметно улучшить результаты размножения. Добавление «белого шума» в комнату или воспроизведение музыки в фоновом режиме может помочь замаскировать шок любых громких шумов, которые возникают неожиданно или которые невозможно уменьшить или избежать.

У мышей также сильно развито обоняние, а запахи духов или средств по уходу за кожей могут вызвать чрезмерный стресс в ваших колониях.Точно так же запахи и феромоны из других клеток могут переноситься на ваших щипцах или перчатках и передаваться из одной клетки в другую, что может способствовать усилению агрессивного поведения и снижению продуктивности спаривания. По этой причине не забудьте продезинфицировать перчатки и щипцы между клетками. Дезинфекция и частая смена перчаток также помогают свести к минимуму распространение патогенов.

2. Дайте им где-нибудь спрятаться (и поиграть)!

Подумайте об этом - когда мыши находятся в дикой природе, они не находятся на открытом воздухе, чтобы все могли пялиться и указывать на них.Они любят устраиваться в своих гнездах, чтобы спрятаться от ужасных человеческих глаз (и веников!). То же самое и с лабораторными мышами. В клетке, лишенной какого-либо обогащения (причудливый термин для обозначения игрушек для мышей), многие породы демонстрируют неблагоприятное поведение, включая парикмахерскую, ограниченное питание и ограниченное размножение. Доступны многие варианты обогащения, включая Shepard Shacks®, Nestlets, иглу и биотуннели. Любой из них может значительно улучшить не только психическое благополучие ваших мышей, но и их эффективность размножения.Фактически, некоторые из наших наиболее часто используемых штаммов - например, C57BL / 6J (000664) и NSG (005557) - содержат некоторую форму обогащения для улучшения самочувствия и психологической стимуляции.

3. Помогите им поднять настроение правильной едой!

Не все мыши созданы равными, и пища, на которой процветает один вид, может не подходить для другого. Мы кормим наших мышей C57BL / 6J, например, диетой с содержанием жира 6%, тогда как мыши CAST / EiJ (000928) лучше работают на диете, содержащей только 4% жира.Вы также можете попробовать использовать так называемую диету заводчика, которая обычно содержит 10–12% жира. Однако просто обратите внимание, что некоторые штаммы (например, C57BL / 6J) могут страдать ожирением на диете с высоким содержанием жиров, что, в конечном итоге, может снизить их продуктивность в разведении.

Добавка к пище, которую исследователи JAX использовали для улучшения результатов размножения в своих колониях, называется «Love Mash».


Овсяные хлопья 42 унции

200 мл зародышей пшеницы

200 мл пивных дрожжей

150 мл жира печени трески

Если у вас нет оборудования для приготовления собственного «Love Mash», один производитель диетических продуктов, BioServ, предлагает гранулированный «Love Mash», содержащий те же ингредиенты.

4. Приглушите свет.

Как мы все знаем, мыши ведут ночной образ жизни; они наиболее активны в темноте. Действительно, самки мышей обычно овулируют и восприимчивы к спариванию только в середине темного цикла. По этой причине важно убедиться, что у них достаточно темного периода для спаривания. В JAX все наши мышиные комнаты поддерживаются в режиме свет / темнота: 14 часов и 10 часов. Многие учреждения используют цикл 12 часов света / 12 часов темноты, что тоже прекрасно.Просто убедитесь, что у мышей есть хотя бы 10 часов непрерывной темноты. Как только свет погаснет, они должны оставаться выключенными! Также убедитесь, что в комнате нет других источников света (например, от оборудования), которые могут нарушить этот решающий период.

Если вы обнаружите, что вам нужно войти в свой виварий в ранние часы, прежде чем загорится свет для инъекции или измерения, вам может потребоваться приобрести головной убор ночного видения, потому что вы не захотите беспокоить циклы размножения ваших мышей.

5. Кто-нибудь вызовите врача; они больны!

Еще одним фактором, который может повлиять на успех размножения мышей, является их состояние здоровья. Если вы используете иммунодефицитные штаммы, включая NOD scid (001303), Nude (007850 и 002019), Balb / c scid (001803) и самый иммунодефицитный штамм мышей, NSG (005557), вы должны быть внимательны к обеспечение максимальной чистоты помещения, в котором они содержатся. Для некоторых штаммов может быть не так очевидно, что они более чувствительны к патогенам в окружающей среде, таким как B6.129P2- Il10 tm1Cgn / J (002251) B6.129P2- Il2 tm1Hor / J (002252) и B6.129S7- Rag1 tm1Mom
48 / J также размножаются (и их фенотипы также могут быть затронуты), если состояние здоровья в комнате недостаточно чистое. Вы можете найти информацию о патогенных микроорганизмах, которые мы отслеживаем в наших комнатах для мышей, в наших отчетах о здоровье животных, ссылки на которые вы можете найти на вкладке «Здоровье и уход» каждой таблицы данных штамма.Более полное описание нашей программы по охране здоровья животных также доступно на нашем веб-сайте.

Бонус: Знайте репродуктивную способность своего сорта!

Несмотря на все наши усилия, есть некоторые сорта, которые, что бы мы ни делали, по-прежнему плохо размножаются. Поэтому важно знать плодовитость фонового штамма, чтобы знать, чего ожидать. Если вы спрашиваете: «Где я могу найти эту информацию?» не ищите ничего, кроме нашей собственной базы данных феномов мышей! Здесь вы можете найти показатели суперовуляции, процент продуктивных вязок и общую плодовитость некоторых из наших самых популярных сортов.А если вы все еще не можете найти то, что ищете, вы всегда можете обратиться к своим друзьям в разделе «Техническая информация» за дополнительной помощью в устранении неполадок с непродуктивными мышами.

Как часто мыши размножаются, живя в моем доме

Как часто мыши размножаются

Домовая мышь стала самым эффективным инвазивным видом млекопитающих на планете.Хотя они не являются коренными жителями Северной Америки, они в значительной степени превратились в домашних вредителей. Их достижение может частично быть обусловлено их репродуктивной способностью. Что, в отличие от других млекопитающих, довольно быстрое. Примерно из 6 мышей за несколько месяцев может вырасти более 60 мышей. Достигнув половой зрелости примерно в месяц, становится ясно, какая популяция мышей внутри дома может легко выйти из-под контроля. Обычная домовая мышь, какими бы симпатичными ни казались люди, может оказать разрушительное воздействие на ваш дом как вредитель за удивительно короткий промежуток времени.Это главным образом потому, что обычная домашняя мышь исключительно эффективна при воспроизведении. По сути, размещение лечения приведет только к все большему количеству проблем. Профессиональные средства борьбы с вредителями мышей от лицензированного истребителя могут остановить их. Как часто у мышей рождаются дети

Сочетание круглогодичного разведения, относительно большого размера помета и достижения половой зрелости в молодом возрасте означает, что вам нужно немедленно вызвать лицензированного дезинсектора в Торонто, если вы заподозрите, что у вас может быть нашествие грызунов.Профессиональное истребление - единственный способ гарантировать, что твари будут удалены навсегда.

Мыши Размножение

Как часто у мышей рождаются дети? Многие люди задаются этим вопросом, когда видят мышей в доме. Всего одна самка дает от 5 до 10 пометов в год. Каждый помет состоит из 5-6 детенышей, способных к размножению примерно в 30-дневном возрасте.

Как быстро размножаются мыши? Одиночная самка мыши может родить 5-10 раз в течение одного года, поэтому популяция мышей может очень быстро увеличиваться.Период беременности мышей составляет примерно 20 дней, поэтому мыши производят большое количество детенышей (от 6 до 12). Размножение может происходить в течение всего года, и, таким образом, если пара мышей войдет в ваш дом, они могут произвести сотни мышей за короткий период времени. Мыши, живущие на открытом воздухе, могут жить в среднем до 12 месяцев. Мыши, нашедшие уютное домашнее жилище, могут жить от 2 до 3 лет. К сожалению, мыши - хорошо известные машины для размножения. В течение этого времени они будут оставаться в своих гнездах, которые находятся внутри стеновых пустот и изоляции.Они будут следовать по проложенным ими тропам к пище и воде и редко будут видны.

В среднем от 5 до 12 детенышей на каждый помет, это означает, что у этого маленького вредителя может быть до семидесяти детенышей мышей в год. И, как будто этого было недостаточно, среднестатистическая мышь-самка может быть готова произвести потомство, когда ей будет всего два месяца. Что еще хуже, период размножения также не ограничивается размножением мышей в течение года. Это означает, что мыши воспроизводятся с экспоненциальной скоростью, и если их не остановить, их популяции могут мгновенно достичь масштабов эпидемии.

Цикл разведения (размножения) мышей

Самки мышей достигают половозрелого возраста всего в 6 недель. Тот факт, что мыши могут забеременеть в таком молодом возрасте, является причиной того, что они могут производить так много детей каждый год. После беременности самке мыши требуется около 3 недель, чтобы родить. Каждый раз, когда она рожает, в ее помете будет примерно 5 или 6 детенышей, хотя она может родить до 12 мышей одновременно.

Сколько пометов у мышей

Мыши могут воспроизводить очень быстро и могут родить помет из 14 щенков за раз, максимум до 5 пометов в год, и могут дать ей 100 детенышей в год, если проблема не будет решена.Мыши могут размножаться исключительно быстро и могут стать половозрелыми всего в несколько недель. Проблема заключается не в самом размножении, а в том, насколько рано могут быть половозрелые мыши, как упоминалось ранее. Когда дело доходит до спаривания, у мышей нет границ, и они легко могут скрещиваться, в результате чего проблема быстро выходит из-под контроля. Мыши жили в вашем доме на протяжении многих поколений, особенно если вы приобрели дом в историческом районе. Поколения за поколениями могли жить и умирать между четырьмя стенами вашего дома.Мышки-детеныши останутся с матерью минимум 3 недели. Когда они приходят в этот мир, они практически глухие и слепые. Средняя продолжительность жизни мыши в природе обычно составляет менее года, и это связано с несколькими факторами. Мышь - популярная добыча, которую любят все животные, которых вы только можете себе представить. От собак до змей. Несмотря на все эти препятствия, мышь может найти безопасное убежище в среде обитания человека. Вы будете удивлены, узнав, что продолжительность жизни мыши, живущей в человеческом доме, увеличилась в три раза, и это причина того, почему так трудно выехать из дома, потому что почти нет ничего, что могло бы противостоять преимуществам тепла. дом может предложить много еды.Поэтому необходимы профессиональные специалисты по борьбе с вредителями, чтобы убедиться, что они больше не будут беспокоить и угрожать вашему нормальному образу жизни.

Мышь будет кормить грудью своих детенышей примерно 3 недели. Однако она снова способна к размножению почти сразу после родов. Другими словами, самка мыши может иметь следующий помет примерно через 25 дней после рождения предыдущего помета. Через год одна мышь может произвести несколько других самок, способных к размножению.

Фактически, ее потомство женского пола, вероятно, уже родило несколько собственных детенышей, которые также находятся в процессе размножения к тому времени, когда прошел год. Такой цикл может продолжаться в течение года или максимум до 3 лет, и к этому моменту в ваш дом может вторгнуться несколько сотен мышей.

К сожалению, цикл размножения мышей очень быстр, и всего в три недели мыши уже выросли настолько, что могут нанести вред вашему дому и имуществу. Они уже достаточно взрослые, чтобы прогрызать пакеты с едой или начать жевать изоляцию, дерево и другие предметы, которые могут показаться привлекательными.К сожалению, проблема продолжает усугубляться по мере того, как они становятся старше и рожают больше собственных детей.

Поведение домовой мыши

Домовая мышь предпочитает жить в местах, где они могут найти как хороший запас пищи, так и место, где у них есть хороший доступ к влаге или воде. Остатки корма для домашних животных, другие пищевые отходы и мешки для мусора действуют как магниты для этих надоедливых маленьких существ. А из-за их способностей к воспроизводству, если одна самка мыши переместится в ваш дом, это означает, что в течение четырех коротких месяцев у вас может быть более двухсот мышей, наводящих беспорядок в вашем доме.

Мыши построили гнездо в утеплителе

И, конечно же, правда, что они активны круглый год. Невероятная рождаемость обычно контролируется их естественными хищниками на открытом воздухе. Хищники, такие как совы, ястребы, кошки, а также суровые зимние и летние условия могут помочь контролировать популяцию грызунов. А вот в помещении - это совсем другая история. Как только мыши попадают в дом, они получают доступ к укрытию, воде и пище. Они будут медленно продвигаться из одной комнаты в другую, создавая туннели внутри изоляции, а также за стенами и гипсокартоном.Их практически не заметят, пока они не проникнут в вашу жилую зону.

Домовая мышь представляет угрозу не только для вашей кладовой и продовольственных магазинов. Домашние мыши являются переносчиками болезнетворных микроорганизмов и могут переносить смертельные заболевания, такие как тиф и бубонная чума. Домашние мыши также могут быть особенно разрушительными для вашего белья, мебели и другой домашней обстановки, потому что домашняя мышь известна тем, что грызет и роет норы, и даже стены не защищены от их жестоких зубов.

Знание того, насколько плодотворно размножаются эти вредители, должно заставить вас осознать, что игнорирование одной маленькой домашней мыши может быть разрушительным, потому что эта мышь может размножаться в мгновение ока и вообще, и, прежде чем вы это узнаете, у вас может быть разрушительное заражение.

Опасности для здоровья при выращивании мышей в птичнике

Как и все грызуны, мыши являются переносчиками болезней, и вы можете подвергнуть свою семью серьезному риску, игнорируя заражение даже в течение нескольких дней. Чем больше грызунов продолжают размножаться, тем выше шансы заразить людей или домашних животных одной из этих болезней;

Лептоспироз: распространяется через питьевую воду или употребление пищи, загрязненной мочой инфицированного грызуна. Заболевание также может распространяться при контакте с поврежденной кожей.Заболевание имеет очень низкий уровень смертности и лечится антибиотиками. Симптомы включают кашель, диарею, озноб, высокую температуру, головные боли и боли в мышцах.

# Лептоспироз - распространенное, но потенциально смертельное заболевание, распространенное в «сезон дождей». Передается людям от животных.

Проконсультируйтесь с врачом, если у вас возникли какие-либо из перечисленных ниже симптомов! #MaxCureHospitals #Rainyseason #Health pic.twitter.com/GrfbrO5NrS

- Больницы Симхапури (@SimhapuriHosp) 17 июля 2018 г.

Хантавирусный легочный синдром (HPS): Некоторые эксперты считают, что уровень смертности от HPS достигает 36 процентов.В первую очередь он распространяется при вдыхании пыли, зараженной пометом инфицированных мышей или мочой. Болезнь также может быть передана при прямом контакте с грызуном, его пометом или мочой. Симптомы включают жар, тошноту, головные боли, ломоту в теле, боль в животе, сухой кашель и рвоту.

Лимфоцитарный хориоменингит (LCM): , как и HPS, это заболевание также в первую очередь передается при вдыхании зараженной пыли. Мыши могут переносить вирус в течение всей своей жизни, не проявляя никаких симптомов при передаче его людям и домашним животным.Заболевание особенно опасно для беременных, так как может вызвать серьезные осложнения у будущего ребенка. Симптомы включают недомогание, лихорадку, светобоязнь, анорексию, головные боли, тошноту и рвоту. LCM также вызывает менингоэнцефалит, асептический менингит и энцефалит.

Лихорадка укусов крыс: , также известная как лихорадка Хаверхилла, передается при царапании или укусе инфицированной мыши или другого грызуна. Болезнь также может быть передана от контакта с инфицированным трупом. Около 10 процентов укусов крыс приводят к инфекции, хотя разумно обратиться к врачу, если вас укусила или поцарапала мышь.Почти все дикие и домашние мыши являются носителями бактерий, вызывающих укусы крыс ( S. Moniliformis ).

Чума : передается при контакте с инфицированным грызуном или укусом зараженной блохи. Несмотря на то, что в средние века это был массовый убийца, уровень смертности от чумы в настоящее время составляет менее 10 процентов. Заболевание лечится антибиотиками, при этом симптомы включают слабость, озноб, лихорадку, головные боли и болезненность лимфатических узлов.

Как предотвратить размножение мышей?

Лучший способ не иметь дела с мышами - это вообще не позволять им проникнуть внутрь.Ограничение их источников пищи и воды замедлит скорость их размножения. Но если они внутри, то второй лучший способ - избавиться от них быстрее, чем их размножение. Мышеловки работают, но чтобы избавиться от проблемы, вам понадобится их много. Под многими мы подразумеваем десятки. Вам нужно будет проверять их ежедневно, очищать мертвые или, если вы используете живые, ловить живых и сбрасывать ловушки. Однако лучший способ справиться с популяцией мышей - нанять Истребителей. Мы лицензированные истребители и имеем доступ к инструментам и продуктам, которых нет у широкой публики.Очень сильнодействующий родентицид, который остановит грызунов. Наши технические специалисты прошли тщательную подготовку, чтобы обеспечить высочайший уровень обслуживания. Мы также решаем проблемы с мышью несколько раз в день, поэтому опыт помогает нам быстро понять и решить проблему с мышью. Вот несколько продуктов из нашего раздела о мышеловках. По вопросам гарантированного управления мышью звоните: 647-496-2211

Обратите внимание, что большинство этих болезней передается через дыхательные пути или при прямом контакте с инфицированными грызунами.Плохая идея - пытаться справиться с проблемой грызунов самостоятельно без надлежащего защитного снаряжения, особенно в закрытых помещениях, таких как чердаки, гаражи и подвалы. Наймите дезинсектора с подходящим защитным оборудованием и лучшими методами удаления, чтобы гарантировать, что грызуны уйдут навсегда. Вы можете рассчитывать на The Exterminators Inc. в решении всех ваших задач по борьбе с вредителями.

Обновлено: 19 июля 2018 г.

фактов о размножении вредителей | Крысы, мыши и птицы для борьбы с вредителями

Эффективная борьба с вредителями часто сводится к игре в числа.Дикие животные - невероятно успешные заводчики. Таким образом, когда дело доходит до видов вредителей, то, что начинается с небольшого и незаметного заражения, может быстро превратиться в гораздо большую проблему, которую невозможно игнорировать.

Скорость, с которой могут размножаться грызуны и некоторые виды птиц-вредителей, пугает, особенно при подходящих условиях. К сожалению, условия в населенных людьми средах могут быть идеальными для вредителей, поскольку обычно есть много укрытий и изобилие пищи, на которой различные виды могут обеспечить себе успешную жизнь.

Поэтому крайне важно, чтобы все предприятия принимали активные меры по борьбе с вредителями, чтобы не дать паразитам сначала проникнуть в помещение, а затем создать себе питательную среду, что неизбежно приведет к появлению большого количества вредителей и гораздо более серьезным проблемам.

Давайте посмотрим на привычки размножения некоторых распространенных видов вредителей, с которыми может иметь дело ваша компания.


Крысы могут размножаться с ужасающей скоростью.Самый распространенный и успешный вид крыс в Великобритании - коричневая крыса. Присутствует и черная крыса, хотя в нашей стране это очень редкий вид.

Коричневые крысы имеют продолжительность жизни от одного до трех лет, хотя средняя продолжительность жизни составляет немногим более года в плотных популяциях, где существует большая конкуренция за пищу.

Млекопитающие достигают половой зрелости всего через четыре-пять недель, после чего самка крысы начинает рожать от пяти до двенадцати крысят, примерно шесть пометов в год.Это означает, что популяция крыс, если ее не контролировать, может вырасти всего с двух до 1250 всего за двенадцать месяцев и оттуда расти экспоненциально.

Однако в реальном сценарии этого обычно не происходит из-за того, что уровень смертности также будет увеличиваться с ростом популяции крыс. Тем не менее, их склонность и способность к частому и успешному размножению такова, что популяция крыс быстро вырастет до размеров, допустимых окружающей средой.Пока есть достаточно места и еды, количество крыс может стать огромным за очень короткий период времени.


История для мышей не должна быть намного лучше.

Самки становятся половозрелыми примерно через шесть недель, а самцы примерно через восемь недель. Одна пара может иметь от пяти до восьми пометов в год. Период беременности составляет примерно 19-21 день, и самка родит от трех до 14 детенышей (в среднем от шести до восьми).

Таким образом, одна самка может родить восемь пометов из 14 детенышей всего за один год - это 112 мышей, полученных от одной племенной пары. Поэтому нетрудно представить, насколько быстро может расти население, если позволяют пространство и еда.

Размножение может происходить в течение всего года, но в более холодные месяцы - реже. Тем не менее, профилактические меры по борьбе с вредителями все еще необходимо принимать зимой, чтобы гарантировать, что в вашем помещении не будет мышей, прежде чем погода потеплеет и снова не начнется размножение.


Размножение видов птиц-вредителей в Великобритании менее интенсивно и более сезонно, чем у грызунов. Тем не менее, разведение птиц по-прежнему создает проблемы для предприятий не только из-за быстрого увеличения численности популяции, но и из-за ущерба, который они наносят при строительстве гнезд, что также может привести к пожароопасности и засорению сточных вод и водостоков.

Голуби: В отсутствие экстремальных погодных условий голуби могут размножаться практически по календарю, хотя основной период размножения приходится на период с марта по июль.За один раз производится от двух до четырех яиц, которые инкубируют около 18 дней до вылупления, а молодые птицы оперяются примерно через пять недель.

Чайки: Сезон размножения чаек приходится на период с мая по август, при этом 2-3 яйца откладываются за сезон. Хотя эти виды более распространены в прибрежных районах, в последние годы различные виды все больше и больше продвигаются вглубь суши в поисках пищи и мест для гнездования. После того, как участок будет создан, больше чаек будут стекаться к нему по мере того, как строятся колонии.Чайки представляют собой особую проблему в период размножения из-за того, что они становятся агрессивными по отношению к людям, часто «бомбят с высоты птичьего полета» с крыш, когда люди проходят мимо, защищая своих птенцов.

Скворцы: Из-за особенностей миграции скворцы наиболее высоки в Великобритании осенью, хотя некоторые из них обычно присутствуют в течение всего года. Обычно они строят свои гнезда в дуплах деревьев и при подходящих условиях устраивают свои дома в зданиях. Сезон размножения начинается в апреле, и птицы откладывают кладку из четырех-шести яиц, которые вылупляются через двенадцать дней.Молодняк оперяется примерно через три недели. Обычно в год выращивают только один выводок, однако иногда, если первый откладывается рано, может последовать второй.

Воробьи: Воробьи размножаются с марта по август, но могут иметь несколько выводков в год. Таким образом, числа могут быстро умножаться в данной области. Обычно за один раз откладывают четыре яйца, хотя в некоторых гнездах может быть до семи. Инкубация длится примерно двенадцать дней, а вылупившиеся молодые покидают гнездо через 15-17 дней.Как только молодые птицы вылупятся из гнезда, самец будет продолжать кормить их, а самка начнет следующий выводок.

Грачи: Грачи - обычные птицы-вредители в Великобритании, и, хотя они, как правило, предпочитают широкие открытые пространства, где они обитают, огромный размер их стай может создать очень шумную проблему для близлежащих домов и предприятий. Период размножения начинается в начале марта, и каждая пара откладывает от трех до пяти яиц. Инкубация длится от 16 до 18 дней, и через месяц птенцы покидают гнездо.

Safeguard Control Pest Control

Снижение численности видов вредителей необходимо для эффективной и длительной борьбы с вредителями.

Добавить комментарий

Ваш адрес email не будет опубликован.