Перейти к содержимому

Чунь цинь собака: Чунцин (китайский бульдог): фото, описание, характер, уход

Содержание

Чунцин (китайский бульдог): фото, описание, характер, уход

Чунцин или китайский бульдог (кит. трад. 重慶, упр. 重庆, пиньинь: Chóngqìng, англ. Chinese Chongqing Dog) — редкая порода собак, родом из китайского города Чунцин. В средние века их использовали на охоте, но сегодня это сторожевые собаки. Эта порода считается древнейшей в Китае, ей не менее 2000 лет, она была известна еще в империи Хань. После образования КНР, количество представителей породы значительно уменьшилось, сегодня чунцинов содержат в отдаленных, сельских районах и в самом Китае она считается редкой.

Тезисы

  • Эта порода очень редкая не только в Европе, но и в самом Китае.
  • Еще недавно это были исключительно охотничьи собаки.
  • На родине их разделяют на три типа, по размеру и особенностям строения.
  • У них доминантный и тяжелый характер. Не рекомендуются начинающим.
  • Они очень верные и будут охранять свой дом и семью до конца.
  • У них практически нет шерсти на ушах и хвосте, а хвост имеет уникальную форму.
  • Эти собаки одного окраса — коричневого, вариации могут быть только в его оттенках.

История породы

Несмотря на то, что собаки очень часто изображаются на китайских полотнах, в литературе о них практически нет упоминаний.

Кроме того, интерес к аборигенным породам проявился в Китае только последние 10-15 лет. По сути, о породе практически ничего не известно. Из фактов можно привести только лишь то, что порода древняя и всегда ассоциировалась с городами Чунцин и Сычуань.

Если основываться на визуальном сходстве (язык синего цвета и множество морщин), то можно предположить что эта порода происходит от других китайских пород, таких как чау-чау и шарпей.

Описание

Для тех, кто знаком с этой породой, навсегда останется в памяти первая встреча, настолько они уникальны.

По размеру они средние, кобели в холке достигают 35–45 см и весят 14–25, суки 30–40 см и весят 12–20. Стоит отметить что на родине их разделяют на три категории: малых, средних и крупных (свыше 45 см).

С китайскими бульдогами охотились в горах и в каждом регионе сформировался свой тип породы. Соответственно, все три типа отличаются друг от друга по высоте, строению тела, форме головы и рта.

В целом, это приземистые и компактные собаки, но не экстремально. Большинство представителей породы похожи по строению на американского питбультерьера.

Они очень атлетичные, тем более что мышцы рельефно проступают через короткую шерсть. Шкура эластичная, но не должна деформировать очертания тела.

Особенностью этих собак является хвост. Он средний или короткий и высоко поднят над линией спины. Обычно он полностью прямой, без изгиба, очень толстый, острый в конце. Самое интересное то, что на нем практически полностью отсутствует шерсть.

Голова крупная относительно тела и являет собой выраженную силу и мощь. Верхушка черепа плоская, а скулы выражены очень четко, что придает голове квадратную форму. Стоп четко выражен, морда достаточно короткая, но очень широкая и глубокая.

У чунцина цвет языка черно-синий, как и у других китайских пород, чау-чау и шарпея.

Предпочтительнее однотонный, черно-синий цвет, но розовые пятна тоже допустимы. Нос большой, черного цвета и немного возвышается над мордой, что обычно для охотничьей собаки.

Сама морда покрыта морщинами, количество которых не чрезмерное, как у шарпея или мопса, но сравнимо с морщинами у английского бульдога или мастифа.

Глаза темного цвета, не впалые и не выпуклые. Уши маленькие, треугольные, стоячие, направлены строго вперед и почти не покрыты шерстью.

Уникальна и шерсть чунцина, лишь у шарпея она чем-то похожа. Шерсть короткая, гладкая, не густая, очень жесткая на ощупь. В идеале, на ней должен быть глянцевый отлив. У многих собак шерсть настолько редкая, что они кажутся голыми, но полностью голых не бывает.

Хвост и уши практически не имеют шерсти, иногда ее нет на морде, шее, груди и животе. Обычно шерсти меньше на спине, относительно остального тела.

Эти собаки одноцветного окраса, обычно коричневого и его оттенков. На груди допускается небольшое белое пятно.

Через редкую шерсть ясно видна черная кожа, так что кажется будто у собаки черная маска на морде, черный хвост, уши и спина. В последние годы появился новый окрас — черный, но эксперты считают что это результат кроссбридинга.

Характер

Однозначно описать характер породы сложно, из-за малой распространенности и того, что часть собак содержат в качестве охотничьих, часть сторожевых.

В целом это очень преданные и верные собаки, образующие с семьей тесную связь. Если щенка растит один человек, то только с ним он формирует тесную связь. Но, даже если щенок растет в большой семье, чаще всего он выбирает себе одного хозяина, остальных просто уважает.

По отношению к детям они добродушны, но с подозрением относятся к детям не из своей семьи. Кроме того, они доминантные и заводить их желательно тем, кто имеет опыт управления подобными породами.

Компанию семьи предпочитают компании незнакомых людей, к которым относятся настороженно. В течение последних двухсот лет их содержат в качестве сторожевых, так что недоверие уже вполне сложилось в их характере.

При правильном воспитании и социализации, они вполне толерантные к чужим. Но, дрессировка очень важна, так как от природы они с сильным защитным инстинктом, очень территориальные, чуткие и сильные.

Китайский чунцин великолепный охранник, который будет защищать дом и семью до самой смерти. Кроме того, еще совсем недавно этих собак использовали в качестве охотничьих, а местами охотятся с ними и по сей день.

У них очень-очень сильный охотничий инстинкт, они будут преследовать любую добычу, от белки до медведя. Они способны поймать рыбу в воде, птицу на лету, а уж на суше… Некоторые терпят домашних кошек, если выросли с ними вместе, но далеко не все.

Китайский бульдог плохо ладит с другими собаками, особенно кобели. При содержании лучше выбирать животное противоположного пола, идеально содержать в одиночестве.

О дрессируемости породы нет достоверных данных. Некоторые говорят что порода высоко интеллектуальная и гораздо более управляемая, чем другие азиатские породы. Другие что они своенравные и сложные.

Однозначно, для начинающих собаководов чунцин будет не лучшим выбором, из-за доминантности и волевых качеств. Большинство кобелей регулярно оспаривают место хозяина в иерархии стаи и предпочитают делать то, что считают нужным.

Владельцы должны приложить много усилий для того, чтобы их китайский бульдог стал послушным и иметь для этого опыт.

По уровню активности они средние и обычная семья вполне способна удовлетворить их нужды. Ежедневная прогулка и игры в течении одного часа вполне их удовлетворяет и позволят избежать таких проблем в поведении как агрессия, деструктивность, гиперактивность. При этом, они способны быть куда более активными и легко адаптируются под нужды семьи.

Известны они тем, что редко подают голос. Если лают, то чтобы поднять тревогу, на охоте или чтобы испугать чужого, но обычно довольно тихие.

Это качество, вместе с умеренными требованиями к активности, делает породу хорошим вариантом для жизни в городе.

Несмотря на то, что комфортней всего они себя чувствуют в частном доме, способны спокойно жить и в квартире.

Единственное неудобство при жизни в городе, то что у них сильный охотничий инстинкт и доминантность. Выгуливать чунцина нужно на поводке и в местах, где нет других животных.

Уход

Минимальный. Услуги профессионального грумера им не нужны в принципе, достаточно регулярного расчесывания.

А вот купать их нужно только по необходимости, чтобы не смывать естественный защитный жир.

Линяют они очень мало и практически незаметно из-за своей редкой шерсти. А вот за морщинами на коже нужен отдельный уход, так как в них может накапливаться грязь, что приводит к воспалениям.

Здоровье

Из-за того что порода не скрещивалась с другими, особых заболеваний у нее нет. Из-за короткой шерсти могут быть проблемы с кожей и в холодное время года собаке нужен особый уход.

Продолжительность жизни до 18 лет.

Чунцин (Chinese Chongqing Dog) - это умная, бесстрашная и проворная порода собак. Описание, фото, отзывы.

Смелость, отвага и бойкий нрав были присущи породе ещё в незапамятные времена. Кроме того, эти собаки необычайно преданы своему хозяину и семье, и всегда будут становиться на их защиту. Собака породы чунцин имеет прекрасный интеллект, отлично понимает хозяина и всегда прислушивается к нему.

Это касается и отношения к незнакомцам – собака изначально может относиться к незнакомому человеку с недоверием, однако, если видит что хозяин расположен положительно, также открывается и относится более дружелюбно. Чунцин понимает речь, поведенческие намёки и эмоциональное состояние своих людей, будет радоваться и грустить вместе с хозяином.

В то же время, собака всегда начеку, и если чувствует угрозу со стороны незнакомого человека, может повести себя агрессивно исходя из инстинкта самозащиты. Потому, рекомендуется: во первых - обязательно проводить социализацию в раннем возрасте, а во вторых - не оставлять животное наедине с чужим человеком. Исключение могут составлять друзья семьи, которых собака хорошо знает.

Могут выполнять сторожевые функции, из-за своего недоверия к незнакомым людям, прекрасных инстинктов, бдительности и смелости, вы всегда будете знать, если кто-нибудь направляется к вашему дому. Детей воспринимают положительно, но имеют предел терпения, и не годятся для роли няньки.

Ребёнка обязательно нужно научить правильному обращению с собакой, кроме того, детям младше пяти лет, лучше не давать играть наедине. Плохо переносят одиночество.

Имеют высокий уровень энергии, нуждаются в ежедневных активных прогулках, играх, физической нагрузке. Собака чунцин хорошо подходит для содержания в городской квартире, при условии, что вы можете обеспечить животному должный уровень физической активности. Этот питомец может стать отличным компаньоном как для одинокого человека, так и для большой семьи. Плохо переносят холода (на прогулку надо одевать комбинезончик), а вот жару - нормально.

описание китайских бульдогов, характер породы. Особенности содержания

Чунцин, или китайский бульдог, относится к числу самых редких пород, и даже на территории Китая поголовье этих необычных собак насчитывает лишь несколько сотен. Уникальность чунцина состоит прежде всего в том, что их генофонд не содержит крови других пород, из-за чего китайских бульдогов считают примитивной популяцией. Издревле таких животных ценили за преданность хозяину, бесстрашие и навыки отличного охотника.

История происхождения

История появления породы чунцин уходит корнями в далёкое прошлое, однако в китайских источниках информации об её происхождении мало. Известно лишь, что собаки являются выходцами из окрестностей города Чунцин провинции Сычуань, а первые упоминания о них относятся к III веку до н. э.: к временам правления династии Хань. В то время на территории Китая процветало животноводство, и предки современных чунцин помогали крестьянам пасти стада и охраняли их имущество от набегов кочевников. Причём для сторожевой и охранной службы отбирались исключительно самые выносливые и бесстрашные собаки, остальных же просто съедали. В результате на разведение пускались только самые сильные и крепкие представители породы, которые передавали потомкам свои лучшие рабочие качества.

В первой половине XX века популяция китайских бульдогов находилась на грани исчезновения, и сохранилась она благодаря энтузиастам и истинным ценителям породы. Лишь в конце столетия китайские кинологи обеспокоились сохранением чунцина и начали проводить активную работу по восстановлению породы. Однако не всё проходило так гладко, как хотелось бы, и в результате эпидемии 2003 года большинство животных пришлось ликвидировать.

После стабилизации эпидемиологической обстановки селекционные работы были продолжены, и на сегодняшний день стараниями кинологов и заводчиков численность мировой популяции удалось поднять до 2 тыс. особей. Большой вклад в развитие и восстановление породы вносят американские специалисты, которые, несмотря на непризнание чунцина Международной кинологической федерацией, активно продвигают и популяризируют эту самобытную породу. Что касается прародителей китайского бульдога, то единого мнения в кругах специалистов на этот счёт нет. Большинство из них, опираясь на визуальное сходство с некоторыми другими породами из Китая, предполагает у них наличие общего предка. Так, язык тёмно-синего цвета, по мнению учёных, говорит о родстве с чау-чау, а морщинистая кожа указывает на родство с шарпеем.

Рассматривая историю происхождения породы, нельзя не отметить такой важный момент, как длительная изоляция популяции от внешнего мира. С одной стороны, она позволила сформироваться уникальному экстерьеру и получить чистую кровь, а с другой – привела к негативным последствиям. Так, будучи изолированной и не получая вливания свежих кровей, порода пережила несколько мутаций, которые спровоцировали ряд наследственных заболеваний.

Со временем недуги настолько укоренились, что появление здорового щенка стало, скорее, исключением. Впрочем, такое положение дел является довольно характерным для большинства замкнутых популяций, где болезни прочно закрепляются в генотипе и передаются каждому новому поколению. Во многом именно этот факт не позволил обрести чунцину большую популярность, так как растить такую собаку в домашних условиях довольно трудно и дорого.

На сегодняшний день позволить себе покупку и содержание китайского бульдога могут немногие. Это обусловлено малым количеством питомников, которые можно пересчитать по пальцам, и слишком высокой стоимостью щенков. Цена на них начинается от 3 700 долларов США и нередко достигает 4,5 тыс.

Более того, купить настоящего чунцина можно только в Китае либо Америке, причём китайские заводчики, прежде чем продать щенка, требуют документы, подтверждающие наличие у покупателя собственного дома и средств, необходимых на содержание собаки.

Описание

Китайский бульдог представляет собой среднюю по размеру атлетично сложенную собаку, напоминающую по своему телосложению американского питбуля. Животное имеет довольно рельефные мышцы, отчётливо проступающие через эластичную кожу с короткой шерстью. Рост кобелей варьируется от 35 до 45 см, сук – от 30 до 40 см.

Такой большой разбег в росте обусловлен наличием 3 типов чунцина: малого, среднего и большого, что объясняется формированием в каждом регионе своего типа породы. Так, бульдоги из горной местности заметно отличаются от равнинных и в сравнении с ними являются более приземистыми и сильными. Вес кобелей в зависимости от типа варьируется от 14 до 25 кг, сук – от 12 до 20 кг.

Характерной особенностью китайских бульдогов является прямой толстый хвост среднего размера, заострённый на конце. Он высоко поднимается относительно линии спины и начисто лишён шерстяного покрова. Голова у чунцина в сравнении с телом несколько непропорциональна и выглядит довольно крупной. Верхняя часть черепа имеет уплощённую форму, что в сочетании с чётко выраженными скулами придаёт голове квадратную форму. Морда у бульдога укороченная и широкая, что в совокупности с квадратной головой выглядит устрашающе.

Язык у китайского бульдога равномерного чёрно-синего цвета, однако розоватые вкрапления также допускаются. Нос большой черный, слегка возвышающийся над мордой, что довольно типично для охотничьих собак. Морда слегка морщинистая, однако число морщин намного меньше, чем у шарпеев и мопсов. Глаза у чунцина всегда тёмные, а не имеющие шерсти уши имеют треугольную форму, хорошо стоят и наклонены вперёд.

Отдельно стоит сказать о шерсти. У большинства китайских бульдогов она очень редкая, из-за чего питомцы выглядят как голые, к тому же на ушах, хвосте, а иногда и на морде шерстяной покров и вовсе почти отсутствует. Там, где шерсть всё же имеется, она короткая, довольно жёсткая на ощупь и окрашена в коричневые оттенки. Сквозь неё отчётливо видна чёрная кожа, что создаёт иллюзию чёрной маски на морде, а также у животного чёрный хвост и уши. Грудь собаки нередко украшает белое пятно. В последнее время чётко прослеживается линия появления чёрного окраса, однако специалисты считают это последствием кроссбридинга – межпородного скрещивания.

Что касается предназначения породы, то она относится к категории охотничьих и охранно-сторожевых собак, однако в последнее время наметилась тенденция содержания чунцина в качестве компаньона и даже поводыря. При этом необходимо отметить, что воспитать собаку для этих целей под силу только профессионалам, поэтому при отсутствии опыта и неуверенности в своих силах лучше остановить свой выбор на более простой породе.

А также следует отметить, что собака относится к разряду долгожителей и легко доживает до 20 и более лет.

Характер

Чунцин отличается высоким интеллектом и уравновешенным характером, однако на чужих животных и домашнюю птицу реагирует очень агрессивно, что объясняется его охотничьими инстинктами. Поэтому даже хорошо знакомых собак в гости лучше не приводить. Хотя на нейтральной территории пёс с удовольствием будет играть с этими же собаками и не выкажет даже намёка на подозрительность и недоброжелательность по отношению к ним.

Особенно следует отметить отличные охранно-сторожевые качества чунцинов. Пёс ни за что не пустит в дом посетителя, пока не получит на это «добро» хозяина. И это относится не только к чужакам, но и к хорошо знакомым собаке людям, и даже к тем, которые приходят в дом довольно часто.

Отдельная тема – отношение к детям. Несмотря на то что некоторые заводчики причисляют чунцинов чуть ли не к нянькам, обид и издевательств от ребёнка они не прощают и вполне могут дать малолетнему обидчику серьёзный отпор. Если же ребёнок настроен доброжелательно и не обижает питомца, то чунцин в ответ готов терпеть бесконечные игры малыша и даже принимать в них участие.

Поэтому при появлении в доме такого пса с ребёнком необходимо провести разъяснительную беседу и рассказать правила поведения с новым членом семьи.

Плюсы и минусы породы

В последнее время всё больше людей стали проявлять интерес к породе чунцин, что обусловлено рядом неоспоримых достоинств этих уникальных самобытных собак.

  • Представители породы отличаются спокойным и уравновешенным характером и способны идти на компромисс.
  • Китайские бульдоги склонны к принятию самостоятельных решений. При возникновении опасности собака сама определяет, насколько реальной является угроза, и когда следует приступать к решительным действиям. Это одновременно может расцениваться и как минус, так как если чунцин решил, что хозяин нуждается в защите, то переубедить его в этом практически невозможно.
  • Безграничная преданность своему хозяину и его домочадцам выгодно отличает данную породу от многих других охотничьих собак.
  • Высокий интеллект и незаурядные умственные способности позволяют обходиться без долгих объяснений, так как животное понимает человека буквально с полуслова.
  • Чунцины являются очень смелыми и решительными собаками, и при возникновении опасности кинутся, не раздумывая, защищать имущество и людей.
  • Высокая чувствительность позволяет бульдогам с первого взгляда определять намерения незнакомца и незамедлительно предупреждать об этом хозяев своим нестандартным поведением.
  • Собаки очень активны и с удовольствием сопровождают хозяев на утренней пробежке.

Наряду с большим количеством очевидных плюсов минусы у породы также имеются. К ним относят зооагрессию и охотничий инстинкт, при котором при содержании кроликов и домашней птицы нужно будет серьёзно позаботиться об их безопасности. Кроме того, чунцин может не ужиться с бойцовской собакой и очень не любит кошек.

Ещё одним недостатком породы считают трудности в формировании личности питомца. Несмотря на то что собака умна, понятлива и хорошо обучаема, у неё ярко выражены лидерские качества, из-за чего могут возникнуть сложности в её воспитании. Особенно это касается кобелей, которые если не признают в хозяине лидера, станут неуправляемыми. А также к минусам породы относят слишком высокую стоимость щенков, что обусловлено малым количеством питомников и редкостью породы.

Особенности содержания

Лучшим местом содержания чунцина является приусадебный участок или просторный двор. Держать животное в квартире или доме категорически нельзя. Мало того, что оно может разнести в отсутствие хозяев весь дом (особенно это относится к молодым собакам), питомец не будет получать нужного количества необходимых ему физических нагрузок.

Поэтому чунцину подходит исключительно уличное содержание, где он сможет реализовать свои охранные качества, держа под неусыпным контролем вверенную ему территорию.

При этом ограничивать свободу передвижения животного вольером или того хуже – цепью, ни в коем случае нельзя. Цепные бульдоги отличаются бесконтрольной агрессией либо, напротив, впадают в тяжёлую депрессию, нередко перерастающую в серьёзное заболевание. Поэтому главное для чунцина – это свобода передвижения, которой его ни при каких обстоятельствах нельзя лишать.

На участке необходимо будет соорудить просторную будку, в которой животное могло бы укрываться от дождя и сильного ветра. На зиму чунцинов нередко забирают в дом, однако лучшим решением станет обогреваемая будка. Участок, на котором живёт китайский бульдог, необходимо огородить высоким забором, а на калитку повесить табличку, предупреждающую о наличии злой собаки.

Чем кормить?

Ввиду естественного происхождения породы кормить её представителей следует только натуральной пищей. В рационе животного обязательно должны присутствовать индюшатина, говядина, курятина и баранина, а также сердце, печень, почки, рубец и другие субпродукты. Причём доля мясного должна составлять не менее 50% от всего объёма, а вторая половина рациона должна состоять из гречки, риса либо перловки.

Овощи также должны обязательно присутствовать в меню. Причём их можно давать как сырыми, так и запечёнными. Наиболее полезными для собачьего организма являются листья шпината и салата, тыква, капуста, свёкла и кабачки. Два раза в неделю можно давать нежирную рыбу, предварительно сваренную и очищенную от крупных костей, и яйца.

Цельное молоко предлагать, конечно, нельзя, а вот кисломолочные продукты придутся очень кстати. Собака с удовольствием будет есть творог, перемешанный с сырым желтком, и твёрдый сыр. Животное можно иногда баловать сушёными свиными и говяжьими ушами, трахеями и жевательными косточками, приготовленными из прессованных жил. Ни в коем случае нельзя кормить собаку горохом, фасолью, картофелем, кукурузой, соленьями, копчёностями, а также хлебом, сладостями и сдобной выпечкой.

Что касается частоты прима пищи, то щенков необходимо кормить 5–6 раз в день. Взрослому животному будет достаточно 2-разового питания. В качестве добавки к пище необходимо давать костную муку, рыбий жир, витамины и минералы.

Как ухаживать?

Уход за чунцином включает в себя ряд обязательных мероприятий и процедур.

  • Вычесывание собак выполняют раз в 2 недели, удаляя выпавшие волоски. Кроме того, 1–3 раза в месяц собаку расчёсывают резиновой щёткой, массируя при этом кожу и улучшая тем самым кровообращение.
  • Купать чунцина следует раз в полгода, используя для этого натуральные шампуни, не вызывающие аллергических реакций. После каждого купания кожу следует увлажнять кремами.
  • Чистку зубов рекомендуется проводить раз в 3 месяца, используя специальные собачьи аксессуары.
  • Подрезка когтей выполняется по мере необходимости, однако большинство собак благополучно стачивают их в процессе прогулок.
  • Осмотр глаз проводят ежедневно, и при обнаружении подозрительных симптомов незамедлительно обращаются к ветеринару.
  • Уши чистят раз в месяц, используя для этого ватный тампон, смоченный в растительном масле.

Воспитание и дрессировка

Чунцин является собакой для людей с сильным характером и требует серьёзной дрессировки. Важно как можно раньше дать ему понять, кто в доме главный, иначе пёс быстро захватит инициативу и будет доминировать над хозяином. Воспитанием щенка следует заниматься с первых дней его появления в доме. Если животное берётся в качестве компаньона, то необходимо сразу подавлять его агрессию к незнакомым людям и животным.

Если собаку предполагается использовать для охраны, то её дрессировкой должен заниматься только опытный специалист. Хозяину, не имеющему твёрдой руки и опыта воспитания сложных пород, браться за такое ответственное мероприятие не следует.

В доказательство этому можно привести отзывы владельцев чунцинов, которые не смогли справиться с воспитанием самостоятельно и получили в результате неуправляемого злобного пса, которого со временем стали бояться.

Занимаясь с бульдогом самостоятельно, главное – быть строгим и последовательным и ни при каких обстоятельствах не давать слабину. При этом бить животное не рекомендуется, так как это может вызвать непредсказуемые последствия, и собака вырастет либо слишком агрессивной, либо чересчур затравленной и трусливой. Самое сложное в воспитании чунцинов – это завоевать у них авторитет. Как только этого удастся достигнуть, дальнейшая дрессировка пойдёт как по маслу. В противном случае доминировать будет пёс. А также следует помнить, что чунцин нуждается в серьёзных физических нагрузках, поэтому малоподвижному человеку такая собака не подойдёт.

Болезни

Изолированность популяции вызвала ряд мутаций, которые обернулись наследственной склонностью к множеству заболеваний. Наиболее слабым местом чунцинов является кожа и глаза. Животные подвержены частым дерматитам, конъюктивитам, воспалению роговицы и катаракте. Кроме того, часто наблюдаются проблемы с суставами, пищевая аллергия и болезни органов дыхания. Последнее часто вызвано переохлаждением животного, которое ввиду скудного шерстяного покрова очень плохо переносит холод.

Во избежание простудных заболеваний требуется обеспечить собаку тёплой одеждой и полноценным питанием.

Еще больше информации об особенностях породы смотрите в следующем видео.

Чунцин (собака) – фото, описание породы, цена щенков

Автор Veto Просмотров 4.2к. Обновлено

ПроисхождениеКитай (провинция Чунцин)
Использованиеохота, охрана
Окраскоричневато-рыжий, цвет красного дерева
Размерысредние. Кобели до 50 см в холке. Суки до 40 см.
Продолжительность жизни15-20 лет

Выбирая себе породистого четвероногого друга, люди всегда ищут собаку по ярко выраженным характеристикам. В качестве охранника с генетически развитыми охотничьими инстинктами, чунцин-собака – один из самых удачных вариантов. «Собака-Хань», «Бамбуковый хвост» – китайская порода собак чунцин имеет несколько названий, и относится к одной из самых редких пород в мире.

История происхождения

Chinese chongqing dog (китайский бульдог) – одна из самых древних пород, известных человеку в неизменном виде. Название связано с китайской провинцией Чунцин.

Пока думаю

17.39%

Древние китайцы ценили бульдога чунцин, и эта одна из немногих разновидностей, которая тысячелетиями не подвергалась изменениям путём смешивания с другими породами. Древние китайцы считали, что и без каких-либо улучшений эта собака идеально выполняет все свои функции. Но селекция проводилась, хотя и самым примитивным образом – из помёта оставляли только самых сильных особей, чтобы использовать их в качестве охранников и охотников.

Считается, что китайская собака чунцин была излюблена императорами и их приближёнными. Сильные животные идеально приспособлены к любимому развлечению знати – охоте. Большинству простолюдинов владеть собакой не позволялось.

Данная порода не слишком известна миру, так как Китай долгое время был закрытой страной. Перевоз животных на территорию других стран начался относительно недавно. Этот же факт способствовал тому, что китайский бульдог чунцин до сих пор не признаётся FCI.

Слишком малое количество особей распространяют в других странах. На международных выставках, в связи с тем, что описание породы не определено FCI, китайского чунцина не встретить.

Стандарт породы

Как такого стандарта нет. FCI не определила характерные черты собаки и общие критерии, по которым её можно оценивать. По внешнему виду это порода средних размеров, рост кобелей до 50 см в холке. Масса тела – до 23 кг. Самки, в силу половых особенностей, немного меньше.

Основной окрас чунцин — цвет красного дерева разных оттенков, или коричневый. Пигмент глаз обычно гармонирует с цветом шерсти, но чаще всего встречается оттенок «тёмный шоколад».

Особенность, которая привлекает семьи, где есть дети и взрослые, склонные к аллергии – у этой породы встречаются псы, практически полностью лишённые шерсти, либо она присутствует частично.

Внешние особенности, описание породы:

УшиВысокая посадка, прямая заострённая форма. Небольшого размера.
ГоловаКрупная, лоб плоский, нос вздёрнут.
ШеяМощная, крепкая.
ТелоПрямоугольного формата. Развитые мускулы. Рельеф поджарый и упругий.
КонечностиИдеальные пропорции в сочетании с корпусом.
СпинаПрямая, короткая, но крепкая. Поясница мускулистая.
РёбраЧётко выраженные.
Грудная клетка«Бочкообразной» формы, широкая.
ПрикусВ идеале - ножницеобразный. Перекус в незначительной степени допустим, но когда пасть закрыта, зубы не должны быть видны.
ГлазаДруг от друга располагаются широко. Форма – округлая.
ХвостДлинный, кончик острый. Форма конусообразная. Китайский чунцин держит хвост либо приподнимая, либо параллельно к земле.

Характер

Нрав у чунцин уравновешенный, но довольно самостоятельный. Поэтому хозяину необходимо уделять большое внимание дрессировке. Хорошо воспитанные псы ведут себя с чужими настороженно, но сдержанно, без команды хозяина нападать сами не будут. Китайский чунцин слушает только хозяина, который сумеет твёрдо, но без агрессии, воспитать адекватную особь.

Особенности характера предполагают дрессировку с исключением физических форм наказания. Иначе китайский чунцин вырастет агрессивным и замкнутым. Идеально будет пройти курс послушания совместно со специалистом.

Эта порода собак очень смелая, и не зря использовалась китайцами как отличный охранник имущества.

Применение

Если следовать международным правилам, классифицирующим породы, то китайского бульдога можно причислить сразу к сторожевым и охотничьим. Чунцин-собака – прирождённый охранник, и о любом нарушении границ оповещает громким лаем. Нужно иметь в виду, что китайский бульдог чунцин не только ставит хозяина в известность о нарушителе, но и способен предпринять все доступные ему действия по защите территории.

Эта порода собак – отличный компаньон для охотника. Чаще всего щенков китайского бульдога приобретают и обучают особенностям утиной охоты. Чунцин отлично охотится на барсуков и других мелких диких животных.

Были случаи, когда щенков чунцин обучали в качестве поводырей-компаньонов для людей с ограниченными возможностями. Но для этого необходимо действительно специализированная и сосредоточенная дрессировка.

Социализация

К человеку представители породы относятся совершенно лояльно. Но эта черта характера, в связи с охотничьими наклонностями, никак не переносится на других животных. Зооагрессию китайские бульдоги проявляют в полной мере. И только правильное воспитание со щенячьего возраста поможет обезопасить других домашних животных.

Нужно иметь в виду, что некоторых мелких зверей, например, хомячков, чунцин-собака примет за свою законную добычу и начнёт на них увлечённо охотиться.

Отношение к детям диаметрально противоположное. Чунцин-собака крайне предана не только хозяину, который заслужил уважение, но и к малышам. Но в этом случае, защищать придётся уже собаку от ребёнка, объяснив правила поведения с животным. И ни в коем случае не разрешать проявления детской любви в виде дёрганий за чувствительные уши, или постоянные крепкие объятия.

Когда чунцина заводят в фермерском хозяйстве, для пса это будет отличным местом жительства. Но хозяину необходимо продумать меры по защите домашней птицы, кроликов и других животных. Чунцин в плане охоты проявляет чудеса изворотливости, и добирается до добычи путём подкопа, перегрызания заграждения и другими способами.

Как выбрать щенка

Выбор щенка, с учётом того, что утверждённого стандарта нет, основывается не на внешнем виде собаки, а на личных качествах, которые проявляются уже с первых месяцев жизни. Для начинающего собаковладельца, щенок, который ярко проявляет доминирующий характер, едва начав уверенно ходить, не подойдёт.

Особенности содержания и ухода

От хозяина пса породы чунцин требуется много внимания и тщательная дрессировка. В плане ухода всё гораздо проще.

Груминг

Шерсть чунцин не требует тщательного ухода. В этом плане чунцин-собака беспроблемна для хозяев. Даже период линьки проходит бесследно. Максимум ухода – это вычёсывание шерсти пару раз в месяц мягкой резиновой щёткой. Полезными процедурами будет чистка зубов пса 2 раза в месяц, и столько же внимания уделить гигиене ушей. Это поможет избежать неприятностей с воспалением и инфекциями.

Купание

Купание один раз за шесть месяцев с использованием специального шампуня. Этого достаточно для ухода за короткой шерстью.

Выгул

Чунцин – порода вольная. И постоянное нахождение в квартире, и даже в запертом вольере, негативно влияет на характер. Человек, который решается на приобретение представителя этой породы, должен быть активным, так как собаке нужны минимум двухчасовые ежедневные прогулки.

Кормление

Чунцин – собака из категории долгожителей. При правильном уходе радует хозяина двадцать лет. Но кормление сухими кормами сократит срок жизни. Основа питания – нежирные сорта мяса, такие как курица, конина, постная говядина. Непременно добавляют рисовую и гречневую крупу, раз в неделю субпродукты. Раз в неделю дают молочные продукты, рыбу, яйца.

Режим кормления – два раза в день для взрослого животного. Щенков и в подростковый период собаку кормят до 6 раз в день, небольшими порциями.

Здоровье

Собака нуждается в том, чтобы здоровью уделялось максимум внимания. Желательны регулярные осмотры у ветеринара.

 Заболевания

Данная порода склонна к генетическим заболеваниям. К ним привели многовековые мутации, связанные с долгим изоляционным периодом и инбридингом. Из достоинств в плане здоровья – устойчивость к вирусным заболеваниям.

Особи этой породы подвержены кожным болезням, часто случается атрофия сетчатки глаза, пищевые аллергии, вывих колена, метеоризм. Учитывая крайне редкую шерсть, которая у некоторых бульдогов отсутствует, животное склонно к солнечным ожогам и плохо переносит высокие и низкие температуры воздуха.

Прививки

Китайским бульдогам делают прививки по стандартному графику, но не раньше, чем им исполнится два месяца. За две недели до запланированной процедуры, животное дегельминтизируют. Первая прививка – от собачьей чумки, гепатита, лептоспироза, энтерита. В 13 недель делается прививка от бешенства. Ревакцинации ставятся по графику, ежегодно.

Вязка

Лучший период для вязки собак – третья течка. В слишком молодом возрасте разведение бульдога нежелательно, так как приведёт к проблемам со здоровьем.

Сколько стоят щенки китайского бульдога

Стоимость щенков чунцин – 3500-4000 долларов. Цена одна из самых высоких в мире на собак. Этот факт связан с тем, что осталось около двух тысяч особей, и на территории России найти эту породу чрезвычайно сложно.

Питомники

В России питомников, которые занимаются разведением щенков китайского бульдога, нет. Любители животных надеются, что будут приняты меры, чтобы популяция уникальных китайских бульдогов росла, и угрозы для вымирания породы не было. В наше время – это труднодоступные животные. Чтобы купить щенка, даже по высокой цене, нужно приложить много усилий.

Мне нравится6Не нравится

Китайский Чунцин (Китай) | МОСОХОТА

Китайская собака Чунцина (Chinese Chongqing Dog) – это древняя порода собак, история которой, по мнению большинства исследователей, началась во времена династии Хань в III веке до нашей эры.

Название породы происходит от места ее происхождения – области Чунцин, что на Юго-западе Китая. Чунцин – прекрасные охотники и защитники, работники и компаньоны. Однако порода является редкой даже у себя на родине, не говоря уже о Европе и США. На родине число представителей породы составляет около 2000, за пределами Китая зарегистрированы лишь единичные собаки. Часто чунцина используют в качестве охотника на мелкую дичь – лис, барсуков, диких котов и птиц, они хорошо подают дичь с воды. Считается, что развитие породы происходило в условиях естественной эволюции, без вмешательства человека. Однако длительная изоляция и тесный инбридинг повлекли проблемы с шерстью и некоторые наследственные заболевания, в том числе и достаточно серьезные мутации. Малое распространение породы исследователи относят на счет того, что регион разведения (Чунцин) является довольно изолированной областью. А наряду с закрытостью от иностранцев самого Китая не удивительно, что собаки практически не попадали в Европу или Америку. Чунцина является собакой среднего размера, с короткой шерстью коричневого цвета или цвета красного дерева. Встречаются особи, у которых шерсть отсутствует частично или полностью. Уши высоко посаженные, прямостоячие. Прикус у животного ножницеобразный, однако, допустим небольшой перекус, только при этом не допускается, чтобы зубы были видны при закрытой пасти. Кобели более массивны. Высота собаки – 40-50 см у кобелей, 35-40 см у сук. Вес кобелей составляет 20-25-кг, сук – 15-20 кг.

Энциклопедия Домашних животных КИРИЛЛА и МЕФОДИЯ

Стандарты породы Китайский Чунцин (Китай):

  • Темперамент (характер). Характер у собаки спокойный, уравновешенный. К незнакомцам и другим животным относятся настороженно, однако, воспитанная собака никогда не набросится без команды хозяина. Очень преданны семье хозяина, любят детей. Из-за довольно независимого нрава собаке требуется твердое и планомерное воспитание. Однако жестокость в отношении чунцина сделает собаку замкнутой и агрессивной. Поэтому желательно доверить обучение профессионалу или хотя бы пройти предварительную консультацию. Чунцина – это крепкая, смелая и независимая собака, готовая всегда встать на защиту хозяина и его имущества.
  • Тело прямоугольное, сама собака мускулистая, мощная.
  • Характерный ножницеобразный прикус. При закрытой пасти зубов не должно быть видно. Небольшой перекус не желателен, но допустим.
  • Уши высоко посаженные, прямостоячие.
  • Очень короткая шерсть, иногда рождаются они вовсе без шерсти, поэтому животное нуждается в теплой одежде.
  • Эти собаки имеют уникальный красновато-коричневый окрас, хотя часть щенков в помете бывает коричневого окраса.

Чунцин: собака с «бамбуковым» хвостом

Исторический обитатель китайских императорских дворцов. Защитник без страха и упрёка. Высокоинтеллектуальный компаньон со смешным названием породы.

Прошу любить и жаловать и, конечно же, еще любить — китайский чунцин — весёлый друг с грустными глазами. Пойдём?

Эта собака появилась более двух тысяч лет назад в Китае, в провинции Чунцин. Собственно, поэтому название собака имеет такое. Провинция была  горная, тяжелодоступная. Поэтому бытует мнение, что собака аборигенная — то есть, появилась без вмешательства человека.

Китайского бульдога — так называют чунцина — легко отличить от других бульдогов по высоким прямостоячим ушам, древесному окрасу, хвосту с забавным названием «бамбук», короткой шерсти, которая может совсем отсутствовать вдоль хребта, и, конечно, большим грустным глазам на складчатой мордочке.

Любимица половины Фейсбука. Вот когда видят её такое вот лицо, все думают, что она плачет, что её обижают, что она бедная и несчастная пускает слезы и всё такое.

На самом деле чунцины игривые и любопытные компаньоны, несмотря на охотничье прошлое и прекрасные охранные качества. Прекрасно ладящие с другими животными и детьми. Они не могут жить без общения, отлично чувствуют настроение хозяина и готовы поддержать любую затею. Но общаться с этой гордой собакой нужно с позиции уважения, иначе упрямство, присущее всем бульдогам, возьмёт вверх.

Мы с ними только через договоры: через вкусняшку, через целовашку, то есть вот именно по-хорошему.

Умеренная активность и компактный размер собаки (взрослые самцы редко перерастают полметра в холке) позволяют держать чунцина даже в небольшой квартире, выгуливать питомца нужно по часу два раза в день. К тому же, собака неприхотлива: протирать влажной тканью и давать качественный корм — вот и вся инструкция по уходу за этим символом достатка. Кстати, так в народе этого питомца прозвали неспроста.

Они очень редкие. В России, наверное, меньше сотни таких собак, на улице их точно не встретить. В Петербурге таких собак, я думаю, меньше десятка. Ну, может быть, десяток.

Поэтому по стоимости щенок чунцина сравнится с импортным легковым автомобилем. И это при том, что порода до сих пор не признана международной кинологической федерацией.  Но не цена делает этих собак таким уникальным, а их интеллект, красота, безмерная преданность и любовь к своему хозяину.

Чунцин – собака с узнаваемым «лицом», но которую мало кто знает. Знакомимся с редкой породой | Облачко храпа

Приветствую всех, дорогие читатели! Рада видеть вас на своем канале!

Продолжаем рубрику «Гвадалахарский барбадрынц» о редких и необычных породах собак с еще более необыкновенными названиями. В прошлый раз я рассказывала про баскскую овчарку (эускаль артсаин тксакурра).

Сегодня наш герой – китайский чунцин

Эту древнейшую породу называют также «восточно-сычуаньская охотничья собака». Мне кажется, она очень похожа «лицом» на короткошерстную чау-чау (чау-смуфа). Понятно, что собаки очень разные, но есть общие черты – морщинки, торчащие уши, толстая морда, средний размер, красно-коричневый окрас.

Китайский чунцин. Неужели эта милаха не заслуживает лайк и подписку?)

Китайский чунцин. Неужели эта милаха не заслуживает лайк и подписку?)

Да и по характеру чунцины с чау-чау похожи. Оба насчитывают историю в несколько тысяч лет, что сделало их настоящими компаньонами человека. Настороженные, отличные защитники (чау все же более ушел в декоративное русло, не все являются хорошими бойцами и охранниками), не воспринимают силу, а только взаимное уважение. Оба выделяют в семье вожака и считают его главным.

Чунцин и чау-чау – братья или просто земляки?

Поскольку обе породы китайские и во многом похожи, мой рассказ больше получился в стиле сравнения. Мне кажется, это тоже хороший способ представить себе породу и получить более менее внятное впечатление.

Чунцин. Фото с просторов интернета

Чунцин. Фото с просторов интернета

Итак, различия. Чунцин – короткошерстная, более легкая и низкая собака, чем чау-чау. Второй важный момент – будучи аборигенной породой, чунцин мало почувствовал на себе вмешательство человека, он создан почти полностью естественным отбором. Поэтому, в отличие от чау, у чунцина отсутствуют генетические породные заболевания, да и живет он дольше – около 20 лет.

Также чунцин более активная и дружелюбная собака, которая больше настроена на контакт и сотрудничество с хозяином, нежели пофигисты-чау, независимые и себе на уме. А еще чунцин гораздо более «разговорчив», чем молчун чау-чау.

Чунцин. Фото с просторов интернета

Чунцин. Фото с просторов интернета

Чунцины любят детей, нуждаются в физических нагрузках (тренировки, бег на свободе). Это в основном сельская собака, которая раньше использовалась и для охоты на кроликов и кабанов. Сегодня чунцин несет функцию охранника и компаньона.

Узнаваемое «лицо»

Вот есть такие породы (не хочу обидеть ни одну), которые похожи на беспородных собак, или которых легко перепутать. Например, белые пастушьи собаки – их около шести пород – так похожи, что отличит их лишь специалист. Или гладкошерстные борзые (грейхаунд, гальго, азавак, слюги и т.д.), тоже довольно похожи. Даже у пуделя есть «двойники» в виде бишонов или водяных спаниелей.

Но есть такие собаки, которых, увидев раз, уже не спутаешь ни с одной другой породой. Они уникальны, неповторимы и узнаваемы. Китайский чунцин относится как раз к таким. Я не видела ни одной породы, похожей на него.

Кому-то собака покажется симпатичной, кому-то страшненькой, но равнодушных, мне кажется, не будет.

А вам нравится китайский чунцин? Завели бы такого у себя дома?

Не забудьте подписаться и поставить лайк, плиз)

Читайте также:

«Забрать и переделать». Американский вариант японской диковины, или как менялась акита-ину

Овчарка из провинции Бос, хотя на самом деле из Бри. Разбираем плюсы и минусы босерона

Это какой-то блокпост! Семья отказывается переезжать - поэтому вокруг их дома нужно построить новую дорогу

Это какой-то блокпост! Семья в конечном итоге живет посреди главной дороги после отказа выехать из дома для застройщиков


Автор Daily Mail Reporter

Опубликовано: | Обновлено:

Объявление

Владелец недвижимости закончил жить посреди новой главной дороги после того, как она отказалась съехать, когда застройщики начали строительство.

Хун Чуньцинь, 75 лет, и ее муж Кунг, которые живут в двух ветхих зданиях со своими двумя сыновьями, первоначально договорились продать недвижимость в Тайчжоу, в провинции Чжэцзян на востоке Китая, и приняли 8000 фунтов стерлингов в качестве компенсации.

Но потом она передумала и вернула деньги, как только начались дорожные работы.

Изолированный: девелоперы продолжили строительство дороги в Тайчжоу, в провинции Чжэцзян на востоке Китая, несмотря на решение семьи не продавать свой дом

Блокировка дороги: Хун Чуньцинь и ее муж Кунг сначала согласились продать собственность, но затем она изменила ее разум

Она и ее семья настаивают на том, чтобы им было разрешено выбирать, куда они будут перемещены, и установили камеры видеонаблюдения, чтобы не дать застройщикам попытаться незаконно снести здание.

В Китайской Народной Республике на протяжении большей части коммунистической эпохи частная собственность на собственность была отменена, что облегчило переселение жителей, но теперь законы ужесточены, и снос собственности незаконным сила без соглашения.

Владельцы недвижимости в Китае, которые отказываются переезжать, чтобы освободить место для развития, известны как «гвоздеры», что означает упрямый гвоздь, который нелегко удалить из куска старого дерева и который нельзя вытащить молотком.

Ряд громких «гвоздевых домиков» уже получили широкое внимание.

В одном случае одна семья из 280 других на месте строительства шестиэтажного торгового центра в Чунцине отказалась покинуть свой дом в течение двух лет.

Застройщики отключили электроэнергию и воду и выкопали яму глубиной 10 метров вокруг своего дома, в котором их семья жила на протяжении трех поколений.

Владельцы ворвались на строительную площадку, снова оккупировали ее и развесили наверху китайский флаг, а затем Ян У, местный чемпион по боевым искусствам, использовал нунчаки, чтобы сделать лестницу к дому, и пригрозил избить любых властей, которые попытаются выселить ему.

Владельцы отклонили предложение в размере 300 000 фунтов стерлингов, но в конце концов договорились с разработчиками в 2007 году.

В другом примере, «гвоздильный дом» остался в Чанше, даже после того, как вокруг него был построен торговый центр, и теперь находится в двор готового комплекса.

Определено: 75-летняя Хун Чуньцинь и ее муж Кунг полны решимости не покидать свой дом и установили систему видеонаблюдения, чтобы убедиться, что застройщики не снесут его.


»Сарай Солнца на экологической ферме Чун Цинь Юань Реконструкция Mix Architecture, деревня Циншуй - Китай

2017 Mix Architecture был заказан экологической фермой Чун Цинь Юань, к северу от экологической фермы города Ичжэн, в солнечном навесе для реконструкции.Фермер надеется изменить свою функцию с меньшими затратами и использовать банкетный зал в качестве основной функции, чтобы получить максимальную выгоду. Основная часть навеса для солнца - это обычный бетонный фундамент, легкая стальная конструкция и доска для солнечного света в сельской ферме, которая используется для выращивания экономичных саженцев. После полевых исследований мы обнаружили, что сам проект относительно изолирован, окружающая среда для развития сельской местности, нет уникального природного и культурного ландшафта, заезд городского населения не очень удобен.

Таким образом, как преодолеть все виды ограничительных условий, насколько это возможно, раскрыть потенциал самого проекта и найти прорыв в повышении ценности пространства, эффективное стимулирование местной сельской жизнеспособности - это весь процесс проектирования нам нужно обдумать и решить проблему.

Концепция дизайна
Дизайн начинается в сельской местности и заканчивается в сельской местности. Наша концепция дизайна исходит из сельской местности: голубое небо, невинные поля, жужжащие лягушки, ароматный воздух в тени деревьев.Он привлекает вас остаться, остаться, задохнуться или поиграть. Вы можете почувствовать защиту солнца и луны, холодного и жаркого лета, и вы можете почувствовать силу природы.

Пространственная стратегия
Дизайн общей модели банкетного пространства по средней оси из одного слова, приспособленной к центральной сцене в качестве основы круглого банкетного пространства радиационного типа, формирование местоположения центростремительного и хорошего. Пир-люди больше не имеют первичного и вторичного, вес очков, может чувствовать себя как дома.Выбор материалов, отражающих элементы сельской местности, использование саженцев тиса, посаженных на ферме, вокруг пространства для создания истинного фона, обрамленного деревьями, выделение кислорода для улучшения климатических условий участка.

Желто-коричневый бамбук, вплетенный в 12 древовидных столбов, не только скрыл оригинальную конструкцию стальных столбов, ослабивших его индустриальные следы, но и в абстрактной форме дерева под формой пространства, образуя лес в бальном зале. Земля использует цемент для полировки дорожного покрытия, земли из зеленого камня, луга, обработки синтеза цветочного поля. Функциональные услуги и обслуживаемое пространство с первого взгляда, разумная оптимизация, невмешательство.

Преобразование в промышленности
Войдя в стадию эксплуатации, мы были приятно удивлены, обнаружив, что реальный спрос на социальную деятельность намного превосходит ожидания дизайна. Первоначально задуманное пространство используется только для банкетных мероприятий, таких как свадебный день рождения, а теперь выбирается для более широкого круга общественных мероприятий, таких как ежегодное собрание местной марафонской команды, музыкальное выступление певцов кантри, место проведения развлекательных программ и выпуск корпоративных продуктов в будущем.встреча. Эти объективные и реальные потребности социальной деятельности предоставляют дополнительную возможность для трансформации сельскохозяйственной отрасли. Он привлекает людей, что делает его использование более разнообразным и неожиданным. Это будет и дальше увеличивать его ценность, но также придаст этой деревне больше жизненных сил и страсти.

Немного мыслей
Стремление к пространству - врожденная вера архитектора. Пространство начинается с чувственности и заканчивается разумом. Когда он закончен, он тихо стоит там, наблюдая за фактическими сценами, за открывающимся занавесом.Звонок через занавес был ошеломляющим, и он оставался неподвижным. В большинстве случаев архитектор устраивает для него некоторые конкретные функции, например, бальный зал в корпусе, но чаще всего он не обязательно будет следовать по пути директора архитектора. Он может взять на себя больше ответственности, больше возможностей играть, больше ценить. Это ценность, которую может принести дизайн, и то, что мы всегда надеялись увидеть - истинные изменения, которые дизайн приносит обществу и стране.

Архитекторы: Mix Architecture
Группа дизайнеров: Тао Тан, Сунин Чжоу, Зие Ву, Чжуджу Вэй, Бин Пэн
Строительная группа: Ичжэн Гуаньшуйлинь Констракшн Сервис Ко., Лтд.
Фотографии: Линь Конг

https://www. archdaily.com/896796/the-sun-shed-of-chun-qin-yuan-ecological-farm-renovation-mix-architecture

Разница в составе микробиоты кишечника в зависимости от состояния тела оценки у собак

J Anim Sci Technol.2020 Март; 62 (2): 239–246.

Джу Лан Чун

1 Национальный институт зоотехники, Администрация сельского развития, Ванджу 55365, Корея

Сан Юн Джи

1 Национальный институт зоотехники, Администрация сельского развития, Ванджу 55365, Корея

Сунг Дэ Ли

1 Национальный институт зоотехники, Администрация сельского развития, Ванджу 55365, Корея

Ю Кён Ли

1 Национальный институт зоотехники, Администрация сельского развития, Ванджу 55365, Корея

Бёнхён Ким

1 Национальный институт зоотехники, Администрация сельского развития, Ванджу 55365, Корея

Ки Хюн Ким

1 Национальный институт зоотехники, Администрация сельского развития, Ванджу 55365, Корея

1 Национальный институт зоотехники, Администрация сельского развития, Ванджу 55365, Корея

* Автор, ответственный за переписку: Ки Хюн Ким, гражданин страны Институт зоотехники, Управление сельского развития, Ванджу 55365, Корея. Тел: + 82-63-238-7052 E-mail: [email protected]

Поступила в редакцию 30 декабря 2019 г .; Пересмотрено 11 февраля 2020 г .; Принято 2020 фев 20.

© Copyright 2020 Корейское общество зоотехники и Технология Это статья в открытом доступе, распространяемая в соответствии с условиями Некоммерческая лицензия Creative Commons Attribution (http://creativecommons.org/licenses/by-nc/4.0), которая разрешает неограниченное некоммерческое использование, распространение и воспроизведение в любых medium при условии правильного цитирования оригинальной работы. Эта статья цитировалась в других статьях PMC.

Abstract

Известно, что микроорганизмы, обитающие в кишечнике, играют важную роль в тело животного. Микробы и микросреда хозяина тесно связаны с здоровье хозяина, включая энергетический обмен и иммунную систему. Более того, это сообщили, что микробиом кишечника коррелирует с такими заболеваниями, как ожирение у человека. и собаки. Было проведено множество исследований по выявлению и характеристике микробов и их гены в человеческом теле. Однако информации о микробиоме было мало. у домашних животных.Здесь мы исследовали сообщества микробиоты в фекалиях. от двадцати четырех гончих (возраст 2 года) и проанализировали таксономический профиль использование метагеномики для изучения различий микробиома кишечника в зависимости от тела оценка состояния (BCS). гДНК была выделена из фекалий, секвенирована и кластеризована. Таксономическое профилирование было выполнено на основе базы данных NCBI. BCS был оценен один раз в неделю согласно описанию, предоставленному World Small Animal Ветеринарная ассоциация. Firmicutes Тип был самым многочисленным за которыми следуют Bacteroidetes , Fusobacteria , Протеобактерии и Актинобактерии .Что Основная микробиота в кишечнике была распределена по-разному в зависимости от BCS. Известно, что фузобактерии связаны с толстой кишкой. рак у человека. Интересно, что Fusobacteria попали в третью строчку. уровень сверху в микробиоме кишечника здоровой собаки. Кроме того, Фузобактерии были особенно выше у собак с избыточным весом, которые имел 6 шкал БКС. Вид Fusobacterium perfoetens также был больше, когда собаки были в BCS 6. Это означало, что F.perfoetens будет положительно связан с избыточной массой тела у собак. Эти открытия будут способствовать дальнейшим исследованиям микробиома кишечника и их функции для улучшения диеты и состояния здоровья собаки.

Ключевые слова: Собака, Фузобактерии , Микробиота кишечника, метагеномный анализ, избыточный вес, таксономический профиль

ВВЕДЕНИЕ

В последние десятилетия микробиота была сосредоточена как ключевой фактор, влияющий на здоровых людей. жизнь. Микробиота кишечника определяется в желудочно-кишечной среде хозяина. где предоставляет различные пребиотики перевариваемых волокон, которые можно использовать в качестве источники энергии по микробиоте.Этот симбиоз важен для хозяина здоровье. Было проведено много исследований, что дисбактериоз кишечной микробиоты связан с с иммунной системой хозяина [1]. Воспалительный заболевание кишечника может быть вызвано дисбактериозом кишечной микробиоты, Proteobacteria , которая изменяет слизистую оболочку хозяина с защитный к провоспалительному статусу [2,3]. Синдром раздраженного кишечника также встречается при состав микробиоты кишечника нарушен. Баланс состава кишечной микробиоты также участвует в балансе между проканцерогенными и антиканцерогенными свойствами. колоректальный рак [2,4–6].

Сообщается, что состав и функция кишечной микробиоты связаны при ожирении у мышей и человека. У тучных мышей состав Firmicutes было увеличено и Bacteroidetes было увеличено. уменьшилось [7]. Вид Bacteroides был снижается у людей с ожирением и увеличивается у людей после похудания с помощью рукава гастрэктомия [8]. Есть несколько исследований, чтобы поддерживают связь между ожирением и микробиомом кишечника. Микробиота производит SCFAs как конечный продукт ферментации после переваривания неперевариваемых волокон [9,10] и используется как источник энергии хозяина [11]. Ацетат, который является одним из SCFA, передается в мозг через периферическое кровообращение, что снижает потребление острой пищи [12]. Фактически, концентрация SCFA была выше в субъекты с избыточным весом [13,14]. Кроме того, повышение уровня липополисахаридов (ЛПС) который является компонентом микробной мембраны, вызывающей ожирение, воспаление и инсулинорезистентность, когда мышей кормили диетой с высоким содержанием жиров [15].

Микробиота кишечника также влияет на здоровье и болезни собак. Подобно этому наблюдается у других животных, микробный состав кишечника связан с обмен веществ во многих процессах.У здоровых собак есть 10 2 –10 9 КОЕ / г в тонком кишечнике и 10 8 –10 11 КОЕ / г в толстой кишке бактерий [16,17]. Состав микробиоты кишечника собаки был изменен типом диеты, например количество белка или углеводов [18]. Высокая белковая и низкоуглеводная диеты больше повлияли на микробиом тучных собак, чем у тощих собак [19]. Для сравнения: микробиота собак больше похожа на микробиоту человека, чем микробиота свиней или мышей по данным метагеномного анализа микробиома [18].Микробиом кишечника собаки был бы более полезен для изучите их у людей, чем у свиней или мышей. Однако энергетический баланс собаки не сильно зависит от микробиоты в отличие от человека, потому что у них относительно простой желудочно-кишечный тракт, как у других плотоядных животных [20], хотя собаки ближе к всеядным и может использовать значительное количество углеводов. Для здоровья собаки и благополучия, необходимо знать особенности собственной микробиоты кишечника. К сожалению, информация о микробиоте кишечника собак ограничена.

Собаки давно приручены и стали основными домашними животными. [21]. В настоящее время благополучие и долголетие домашних собак было главной заботой владельцев, и они ставили много усилия по поддержанию здоровья своей собаки как члена семьи. Чтобы сохранить здоровый образ жизни собак управление питанием имеет решающее значение. Для этого сбалансированный кишечник микробиота важна для усвоения пищи и поддержания здоровье желудочно-кишечного тракта. Однако информации о собаках все же меньше. кишечная микробиота.В этом исследовании мы изучили таксономические профили кишечника. микробиота у собак. Кроме того, мы проанализировали различие таксономических профилей микробиота кишечника на основе балльной системы оценки состояния организма. Эти находки способствовать пониманию разнообразия микробиома кишечника собаки и взаимосвязи микробиота кишечника с увеличением массы тела у собак.

МАТЕРИАЛЫ И МЕТОДЫ

Животные

Всего было применено 24 здоровых гончиха (возраст 24 месяца). Животное исследования были одобрены Комитетом по уходу и использованию животных Национальный институт зоотехники, Корея (номер разрешения: NIAS201

).Собак кормили коммерческой диетой (33% сырого протеина, 20% сырого жира, 3% клетчатка, 13% сырой золы, 1% кальция, 0,8% фосфора, 12% влаги и 4100 ккал / кг ME) на основе метаболической массы тела два раза в день и воды с бесплатная оценка. Собак содержали в одном вольере и дважды выгуливали на открытом воздухе. день. Собаки содержались в обычном порядке, дополнительное лечение не проводилось. или дополнительная диета для этого исследования. За всеми собаками наблюдали каждый день и при необходимости осмотрены ветеринарами.

Сбор образцов и экстракция ДНК

Свежие фекалии собирали и непосредственно замораживали в жидком азоте.После доставленные в лабораторию фекалии хранили при -80 ° C до использовал. Геномную ДНК (гДНК) экстрагировали из замороженных фекалий с использованием Табурет ДНК NucleoSpin ® (Macherey-Nagel, Германия). Вкратце, Использовали 180–220 мг образца фекалий и лизировали с использованием пробирки MN Bead Tube. Держатель и гДНК собирали с помощью NucleoSpin ® DNA Stool. Центрифугирование на колонке при 13000 × g в течение 1 мин. На последнем этапе гДНК была элюируется буфером для элюции после центрифугирования при 13000 × g в течение 1 мин. гДНК хранили при -20 ° C.

Создание библиотеки секвенирования 16s рРНК

Последовательности 16s рДНК в гипервариабельных областях V3 и V4 были нацелены на амплификацию согласно предыдущему исследованию [22]. К нацелены на области V3 и V4, полноразмерные последовательности праймеров использовали в качестве внизу: передний праймер 5’ – TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG – 3 ’ и обратный праймер 5’ – GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC – 3 ’. Нуклеотидные последовательности выступа адаптера Illumina были добавлены в ген-специфичную последовательности.Последовательности, специфичные для локусов, были как прямые 5’ – TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG – 3 ’и наоборот выступ 5’ – GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG – 3 ’. Для очистки продуктов ПЦР KAPA HiFi HotStart ReadyMix (KAPA Biosystems, США) и Использовали Agencourt AMPure Xpsystem (Beckman Coulter Genomics, США). В библиотеки секвенированы на приборе Illumina MiSeq (2 × 300 парное секвенирование).

Предварительная обработка

После упорядочивания исходные считывания парных концов были обрезаны путем удаления последовательности адаптеров с CutAdaptV1. 11. Объединенные чтения были сгенерированы сначала обработанные парные чтения с использованием FLASH v1.2.11. Для контроля качества некачественные объединенные чтения удалялись, если они содержали два или более неясных нуклеотидов, имеют менее 20 средних оценок качества и менее 300 длина п.н. после обрезки низкокачественных баз. На завершающем этапе химерный чтения были удалены с помощью ChimeraSlayer r20110519. Количество оперативных таксономические единицы (OTU) были рассчитаны с использованием предварительно обработанных чтений из каждого образца и определяется путем кластеризации последовательностей на основе 97% идентичность последовательностей с использованием программного обеспечения QIIME (v.1.8.0).

Таксономическое профилирование

Таксономическая численность была рассчитана с помощью cd-hit v.4.6 путем консенсуса по кластеризации последовательности, которые имеют более 99% идентичности и 80% покрытия. Использование мегабласта алгоритма согласованные последовательности были выровнены с базой данных нуклеотидов NCBI. Таксономическое профилирование было выполнено для собранного генома на основе NCBI. информация о таксономии и KronaTools v.2.7.

Статистический анализ

Альфа-разнообразие для каждой выборки было измерено с помощью OTU с использованием индекса Шеннона и бета-разнообразие измерялось разницей в составе организмов измеряется согласно расстоянию Брея-Кертиса.Различия между микробиотой сообщества, основанные на BCS, оценивались с помощью одностороннего дисперсионного анализа. Статистическая значимость определялась, если p было меньше 0,05.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Избыточный вес и ожирение связаны с развитием множества заболеваний. Управление питанием собак было критически важным вопросом для поддержания их здоровья. жизнь и благополучие, следя за оптимальной массой тела. В настоящее время это было сообщили, что ожирение может влиять на микробный состав кишечника мышей [7].Микробное сообщество тоже было иначе существует в зависимости от показателей ИМТ в кишечнике человека [23]. У тучных людей было меньше Bacteroidetes и более Firmicutes [24]. Для по этой причине Turnbaught et al. предположил, что тучный микробиом увеличивает возможность получения энергии из продуктов, которые могут вызвать накопление чрезмерная энергия в теле [13]. Эта находка было подтверждено другим исследованием, что общее количество SCFA (конечный продукт ферментация кишечной микробиотой) была выше у людей с избыточным весом [14].Микробиота кишечника, как и человека, была отличается по сравнению с таковыми у худых собак и собак с ожирением, а SCFA был ниже у собак с более быстрым похуданием. Однако информации о кишечнике мало. микробиом, связанный с набором массы тела у собак. Поэтому мы исследовали различие микробных составов кишечника на основе оценок состояния тела с использованием метагеномный анализ у здоровых собак.

Метагеномный анализ - мощный метод, позволяющий получить представление о целом сообщество микробиоты, проживающее в определенной среде.Выживание и функция микробы были связаны с хозяином и сложным микробным сообществом, а не отдельный микроб. Здесь для изучения состава микробного сообщества Весь микробиом кишечника собаки анализировали с использованием последовательностей 16s рРНК. В двадцать четыре здоровых бигля были обследованы по шкале их физического состояния (BCS) с которые они сгруппированы в BCS 3 (худой), 4–5 (оптимальный) и 6 (избыточный). BCS - это косвенный метод оценки накопления жира в организме. Количество прочтений после предварительной обработки данных секвенирования был показан в.Операционные таксономические единицы были выше в BCS 3 (худой) по сравнению с таковыми в BCS 4–6 (). Альфа-разнообразие снижалось, когда собаки имели избыточный вес (). Это означало, что разнообразие микробиом у собак будет иметь противоположные отношения с BCS.

Таксономическое распределение микробиома кишечника на основе оценки состояния тела система у собак.

(A) Относительная численность основной микробиоты кишечника на уровне Phylum, (B) Обилие Fusobacteria на уровне филума.

Таблица 1.

Разнообразие микробиома кишечника собаки в зависимости от состояния тела оценка

9030 9030 после 9030 предварительная обработка 4.33 ab
Оценка состояния тела (BCS) SEM p -значение
Lean Optimal Избыточный вес
3 4 5 6 70,391 75,287 71,980 73,685 1,389 0. 609
OTU (количество кластеров) 5,176 4,588 4,757 4,546 117 0,357
Альфа-разнообразие (индекс Шеннона

1
4,31 ab 3,96 b 0,05 0,044

Преобладающая микрофлора для поддержания здоровья желудочно-кишечного тракта Firmicutes , Bacteroidetes , Proteobacteria , Fusobacteria и Актинобактерии в кишечнике собаки [25–26]. В таксономические профили образцов метагеномики, Firmicutes , Bacteroidetes , Fusobacteria , Proteobacteria и Actinobacteria были преобладает, как и в предыдущих отчетах данного исследования. Далее, эти пять преобладающих микробиоты были исследованы, как они были распределены на основе BCS. Тип Уровень таксономического распределения преобладающей микробиоты у собак отличался согласно BCS (). Среди них Фузобактерии имели тенденцию быть более многочисленными, когда собаки были избыточный вес в BCS 6 (статистически недостоверно) ().Фактически, Firmicutes был хорошо известен как основной микроб ожирения у человека и мышей, а не Fusobacteria [7,24]. Fusobacteria анаэробный, грамотрицательный, неподвижные, неподвижные и длинные веретенообразные стержни [27]. Известно, что у него слабая ферментирующая способность, инфекционные и вызывают воспаление [27]. Фузобактерии обнаруживаются в полости рта, желудочно-кишечном тракте. тракт и женские половые пути. У человека Fusobacteria были известно, что они связаны с такими заболеваниями, как колоректальная карцинома, острый отит или саркоидоз.Однако информации о функциях Fusobacteria у собак.

Чтобы сузить вовлеченность fusobacteri на уровне видов в отношении увеличения массы тела были проанализированы виды микробов. Как показал результат in, Fusobacterium mortiferum и Fusobacterium perfoetens были высоко связанные с повышением оценки физического состояния. Согласно статистическому анализу F. perfoetens по-разному у собак с оптимальным и избыточная масса тела ( p <0.05). в отличие от других Fusobacterium видов, которые являются более слабыми ферментерами F. mortiferum может использовать различные сахара в качестве источников энергии [28]. F. nucleatum - наиболее common Fusobacterium , выделенные от человека и известные как связанные с инфекциями и колоректальным раком [6]. В отличие от других Fusobacterium . Ф. perfoetens имеет морфологию кокковидной формы, а не длинный стержень веретена форма типичной морфологии Fusobacterium [29].На филограмме, показывающей генетическое родство, F. perfoetens образовали отдельную ветвь от кластеров другие видов Fusobacterium [29]. С учетом ранее сообщенных фактов F. perfoetens (в том числе F. mortiferum в некоторых аспект, такой как использование энергии в кишечнике) будет иметь нетипичные и разные функционируют в микросреде кишечника в отличие от человека. Следовательно, возможно, что микробиом кишечника собак был бы относительно уникальным, хотя и имел сходство с человеком.Однако требуется дополнительный количественный эксперимент для дальнейшая проверка связи между Fusobacteria и ожирение, которое мы предложили в этом исследовании.

Обилие видов Fusobacterium у собак кишка.

Разные Fusobacterium виды, обитающие в кишечнике собаки на основе уровня оценки физического состояния (BCS). p <0,05.

Собаки считаются одним из членов семьи. Хорошее самочувствие собаки также стать важной проблемой в человеческом обществе.Владельцы собак прекрасно осведомлены важность сбалансированного управления питанием и приложить усилия для обеспечения хорошее качество и количество кормов для своих собак. Однако всеобъемлющий информация о микробиоте кишечника собаки, которая влияет на общий здоровье по-прежнему нужно. В этом исследовании мы исследовали разницу микробиота кишечника собаки в соответствии с системой оценки состояния организма, которая отражает уровень состояния накопления жировых отложений. Мы нашли кишечник собаки Привычки микробиоты по-разному зависят от степени прибавки массы тела.Эта находка будет способствовать улучшению и развитию знаний о питании микробиома кишечника для более здоровой жизни собаки.

Благодарности

Авторы выражают признательность Программе стипендий RDA 2019 Национального института Зоотехния, Управление сельского развития, Корея.

Конкурирующие интересы

О потенциальном конфликте интересов, относящемся к этой статье, не сообщалось.

Источники финансирования

Это исследование поддержано грантом «Программа совместных исследований Центр исследований домашних животных (Проект №PJ013984012019) ”от Национальный институт зоотехники, Управление сельского развития, Корея.

Доступность данных и материалов

По разумному запросу, наборы данных этого исследования могут быть доступны на корреспондент.

Вклад авторов

Концептуализация: Chun JL, Kim KH.

Обработка данных: Chun JL, Kim KH.

Формальный анализ: Ji SY.

Методология: Ли Ю.К., Ким Б.

Проверка: Джи Си, Ли С.Д.

Написание - первоначальный набросок: Chun JL, Kim KH.

Написание - просмотр и редактирование: Ли С.Д.

Одобрение этических норм и согласие на участие

Дизайн исследования на животных был одобрен наблюдательным советом IACUC (номер одобрения: NIAS201

). Мы прочитали и поняли правила вашего журнала, и мы считаем, что ни рукопись, ни исследование не нарушают ни одно из этих положений. Этот рукопись не опубликована и не рассматривается другим журнал.

ССЫЛКИ

1.Хуллар МАЙ, Лампе Дж. У., Торок-Сторб Б. Дж., Харки Массачусетс. Микробиом кишечника собак связан с более высоким риском заворот желудка и генетические варианты высокого риска иммунной система. PLoS One. 2018; 13: e0197686. DOI: 10.1371 / journal.pone.0197686. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 2. Шихан Д., Шанахан Ф. Микробиота кишечника при воспалительном заболевании кишечника. Гастроэнтерол Clin N Am. 2017; 46: 143–54. DOI: 10.1016 / j.gtc.2016.09.011. [PubMed] [CrossRef] [Google Scholar] 3. Компакт-диск Луны, Янг В., Маклин PH, Куксон А.Л., Бермингем, США.Метагеномное понимание роли протеобактерий в микробиомы желудочно-кишечного тракта здоровых собак и кошек. Microbiologyopen. 2018; 7: e00677. DOI: 10.1002 / mbo3.677. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Кастелларин М., Уоррен Р.Л., Фриман Дж. Д., Дреолини Л., Кшивински М., Штраус Дж. И др. Инфекция Fusobacterium nucleatum широко распространена среди людей. колоректальный рак. Genome Res. 2012; 22: 299–306. DOI: 10.1101 / gr.126516.111. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 6.Рой С., Тринкьери Г. Микробиота: ключевой организатор терапии рака. Nat Rev.2017; 17: 271–85. DOI: 10.1038 / nrc.2017.13. [PubMed] [CrossRef] [Google Scholar] 7. Ley RE, Bäckhed F, Turnbaugh P, Lozupone CA, Knight RD, Gordon JI. Ожирение изменяет микробную экологию кишечника. Proc Natl Acad Sci USA. 2005. 102: 11070–5. DOI: 10.1073 / pnas.0504978102. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 8. Лю Р., Хун Дж., Сюй Х, Фэн Кью, Чжан Д., Гу И и др. Изменения микробиома кишечника и метаболома сыворотки при ожирении и после вмешательства по снижению веса.Nat Med. 2017; 23: 859–68. DOI: 10,1038 / нм 4358. [PubMed] [CrossRef] [Google Scholar] 9. ден Бестен Г., ван Ойнен К., Гроен А. К., Венема К., Рейнгуд Д. Д., Баккер Б. М.. Роль короткоцепочечных жирных кислот во взаимодействии между диета, микробиота кишечника и энергетический обмен хозяина. J Lipid Res. 2013; 54: 2325–40. DOI: 10.1194 / мл. R036012. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 10. Самуэль Б.С., Шайто А., Мотоайк Т., Рей Ф.Е., Бэкхед Ф., Манчестер Дж. К. и др. Воздействие микробиоты кишечника на ожирение хозяина модулируется: короткоцепочечный рецептор, связывающий жирные кислоты с G-белком Gpr41.Proc Natl Acad Sci USA. 2008; 105: 16767–72. DOI: 10.1073 / pnas.0808567105. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 11. Кимура И., Одзава К., Иноуэ Д., Имамура Т., Кимура К., Маэда Т. и др. Микробиота кишечника подавляет опосредованное инсулином накопление жира. через рецептор короткоцепочечных жирных кислот GPR43. Nat Commun. 2013; 4: 1829. DOI: 10,1038 / ncomms2852. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 12. Frost G, Sleeth ML, Sahuri-Arisoylu M, Lizarbe B, Cerdan S, Brody L и др. Ацетат короткоцепочечных жирных кислот снижает аппетит через центральную гомеостатический механизм.Nat Commun. 2014; 5: 3611. DOI: 10,1038 / ncomms4611. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 13. Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. Микробиом кишечника, связанный с ожирением, с повышенной способностью к сбор энергии. Природа. 2006; 444: 1027–31. DOI: 10,1038 / природа05414. [PubMed] [CrossRef] [Google Scholar] 14. Швирц А., Тарас Д., Шефер К., Бейер С., Бос Н. А., Донус С. и др. Микробиота и SCFA у худых и здоровых людей с избыточным весом предметы. Ожирение. 2010; 18: 190–5.DOI: 10.1038 / oby.2009.167. [PubMed] [CrossRef] [Google Scholar] 15. Cani PD, Amar J, Iglesias MA, Poggi M, Knauf C, Bastelica D и др. Метаболическая эндотоксемия вызывает ожирение и инсулин сопротивление. Сахарный диабет. 2007; 56: 1761–72. DOI: 10.2337 / db06-1491. [PubMed] [CrossRef] [Google Scholar] 16. Немецкий AJ, Day MJ, Ruaux CG, Steiner JM, Williams DA, Hall EJ. Сравнение прямых и непрямых тестов для тонкого кишечника избыточный бактериальный рост и диарея, реагирующая на антибиотики. собаки. J Vet Intern Med. 2003; 17: 33–43.DOI: 10.1111 / j.1939-1676.2003.tb01321.x. [PubMed] [CrossRef] [Google Scholar] 17. Mentula S, Harmoinen J, Heikkilä M, Westermarck E, Rautio M, Huovinen P и др. Сравнение культур тонкого кишечника и фекалий микробиоты у гончих собак. Appl Environ Microbiol. 2005; 71: 4169–75. DOI: 10.1128 / AEM.71.8.4169-4175.2005. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Коэльо Л.П., Култима Дж. Р., Костя П. И., Фурнье С., Пан И., Чарнеки-Молден Г. и др. Сходство микробиомов кишечника собаки и человека по содержанию генов и реакция на диету.Микробиом. 2018; 6: 72. DOI: 10.1186 / s40168-018-0450-3. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 19. Ли Кью, Лаубер С.Л., Чарнеки-Молден Дж., Пэн И., Ханна СС. Влияние диетического соотношения белков и углеводов на кишечник микробиомы у собак с разным состоянием организма. mBio. 2017; 8: e01703–16. DOI: 10.1128 / mBio.01703-16. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 20. Макдональд М.Л., Роджерс К.Р., Моррис Дж. Г.. Питание домашней кошки, млекопитающего плотоядное животное. Энн Рев Нутр. 1984; 4: 521–62.DOI: 10.1146 / annurev.nu.04.070184.002513. [PubMed] [CrossRef] [Google Scholar] 21. vonHoldt BM, Pollinger JP, Lohmueller KE, Han E, Parker HG, Quignon P, et al. Полногеномный анализ SNP и гаплотипов показывает богатую историю лежащая в основе одомашнивания собаки. Природа. 2010; 464: 898–902. DOI: 10,1038 / природа08837. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 22. Клиндворт А., Прюсс Э., Швир Т., Пеплис Дж., Кваст С., Хорн М. и др. Оценка общих праймеров для ПЦР гена 16S рибосомной РНК для классическое и основанное на секвенировании следующего поколения разнообразие исследования.Nucleic Acids Res. 2013; 41: e1. DOI: 10.1093 / нар / gks808. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 23. Ху ХДЖ, Пак С. Г., Джанг Х.Б., Чой М.К., Пак К.Х., Кан Дж.Х. и др. Ожирение меняет профиль микробного сообщества по-корейски подростки. PLoS One. 2015; 10: e0134333. DOI: 10.1371 / journal.pone.0134333. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 24. Ley RE, Turnbaugh PJ, Klein S, Gordon JI. Микробы кишечника человека, связанные с ожирением. Природа. 2006; 444: 1022–23. DOI: 10.1038 / 4441022a.[PubMed] [CrossRef] [Google Scholar] 25. Дэн П., Суонсон К.С. Микробиота кишечника людей, собак и кошек: современные знания и будущие возможности и проблемы. Br J Nutr. 2015; 113: S6–17. DOI: 10.1017 / S0007114514002943. [PubMed] [CrossRef] [Google Scholar] 26. Хэмпп Э. Г., Скотт Д. Б., Вайкофф Р. В.. Морфологическая характеристика фузобактерий ротовой полости по данным электронный микроскоп. J Bacteriol. 1960; 79: 716–28. DOI: 10.1128 / JB.79.5.716-728.1960. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 28.Робриш С.А., Оливер С., Томпсон Дж. Метаболизм сахара фузобактериями: регулирование транспорта, фосфорилирование и образование полимера с помощью Fusobacterium mortiferum ATCC 25557. Заражение иммунной. 1991; 59: 4547–54. DOI: 10.1128 / IAI.59.12.4547-4554.1991. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 29. Conrads G, Claros MC, Citron DM, Tyrrell KL, Merriam V, Goldstein EJ. Внутренние транскрибируемые спейсерные последовательности 16S-23S рДНК для анализа филогенетических отношений между видами рода Fusobacterium.Int J Syst Evol Microbiol. 2002; 52: 493–9. DOI: 10.1099 / 00207713-52-2-493. [PubMed] [CrossRef] [Google Scholar]

Собака-девочка в китайском зодиаке, 2018 Wisdom Good Name Daquan

- это новый виток именования, и он находится в движении. Малыш, помоги своей судьбе и добавь блеска своей жизни. Здоровая и умная, ваша родная семья, хотела бы подарить вам все хорошее.

Иань, Цзяо, Цинъи, Яньфу, Чили, Ляннань, Циин, Гу Хуай, Цзяоцзе, Ииюнь

Гудань, Сюэлю, Хуэйюэ, Сюцзе, Цяочунь, Су Синь, Хуале, Фэньфэнь, 9000 Цуймань,

Цуймань, Шуангвэнь, Ицин, Байкуй, Вода, Чжиюй, Ханьдун, Цинцзюнь, Линфань, Цзюаньли

Юань, Наполовину ароматный, Ненависть, Саса, Цинся, Паньи, Джунтинг, Денди, Линьчэнь, Чанъи

Мэнфань, Мэйси, Мэнфань, Мэйси , Rouli, Panxia, ​​Daiqiu, Lingyu, Qinghua

Jirou, Binglan, Shuizhu, Wenrui, Huacai, Zhirong, Tiantian, He Nuan, Xuefeng, Wanmiao

Shandie, Ruoshan, Chu Yang, Yoyqya, Shanyq , Jinyao, Yumin

Xiumin, Xiangtian, Hemeng, Nanzhen, Mishan, Xiashan, Wenxin, Jiasi, Siling, Yingmei

Bi Lin, Ленг Лин, Yi Qiao, Chu Zhi, Jing Zhi, Ying Ran, Ying Chu, Man Rong , Сю Янь, Сяо Лэй

Лин Си, Цин Шу, Цзин Бай, Пей Бай, Ван И, Чжуюэ, Юйтун, Ханхань, Сяфэн, Фэйлянь

900 05 Menghuai, Lingling, Bingbing, Caiwen, Banlan, Chunxue, Seeking Green, Jingqiao, Yujing, Magic Peach

Nong Qi, Shudie, Danyi, Yiyu, Manhui, Yunxi, Chanjuan, Huaiqin, Zhaoyi,

Jingxia Хунсюэ, Аоцин, Кунью, Кэ Цзя, Сянчжэнь, Хуэйчжи, Руизи, Сяонин

Гусян, Мироу, Лихуа, Синцин, Ханьцзин, Сяоси, Ханьшуан, Баньхуа, Шаньмэй, Инси

Шусянь, Лэ Нюнь, Шуанг , Xiaolu, Lotte, Xia Rong, Yubai, Zhiyun

Xiulan, An Bai, Xiangtao, Lianqing, Youmei, Tingnan, 子怡, Tingfeng, Pingya, Nianzhi

Erdie, Huiyan, Shen Jing, Yiunjing Hexu, Qingq , Qingxin, Xinmei, Xianjing

Nanqing, Pingling, Zhiyu, Yumeng, Faner, Nalan, Ya'an, Qingyan, Xinyue, Qingmei

Zixin, Jifeng, Xiangwei, Shen Jing, Zhaoyi, Yuying 、 岚 _sp 7span, Fangxin, невиновность

Mengyue, Qiaofan, Caimeng, Hanshuang, Chaoxu, Ling Qing, Qizhen, Xia Xuan, Shuzhe, Сиди

Xiujie, 香芹, Ya Rong, Man Wen, Shi Ran, Yan Zi, Chu Liu, Xia Wen, Ye Fei, Fang Zhou

Ruo Yun, Su Huai, Shu Fang, Shu Hui, Fan Bai, Man Tong , Дуань И, Янь Ни, Фанг Цзэ, Чаоюй

Паньи, Липин, Фанг И, Цяосян, Сюаньхэ, Юэкай, Цимэй, Бунонг, Сююнь, Цуннинг

Цзинбай, Сисун, Цинся, Хуэйин, Тин Жань, Цию , Теплый сон, Хуаньюй, Синан

Ан Мэн, Гу Хуай, Цзинхуэй, Чжэньфан, Хань Лэй, Шаньшань, Триси, Шу Янь, Ман Тонг, Сюин

Мяо Цин, Ю Фу, Руо Янь, Юнь Си, Шен Ран, Хун Ли, Пан Лю, Сюэ Цин, Ми Фу, Цзы Юй

Сян Роу, Сюй Юань, Цуй Инь, Хао Лань, Юэ Лин, Линь И, Вэнь Юань, Яньцинь, Цю Ю, Чжии

Си Ай, И Ли , Мин Ци, И Цзя, Е И, Цзянь Инь, Хуэй Чун, Сюй Ци, Ван Юнь, Цзин Цзя

Мин Янь, Жун Си, Ванфэн, Яньцзинь, Руокуй, Ирюй, Ляньчжи, Муфу, Ижун, Цяоцю

, Илянь, Няньтун, Донгруй, Тяньянь, Цзихай, Шаньчжэнь, Б. ingfeng, Lingyun, Milu

Xiaowei, Lone Dream, Xingyu, Junyang, Tong Fang, Yilei, Xuanhui, Lu Shao, Tingyan, Binan

Qingshuang, Xue Lan, Lezhen, Muhe, Ninghan, Hanyi, Qheniaorong, Feizu Miaoqin

Ранняя осень, Xinman, Ningyun, Yunan, Miaozhu, Xiaorong, Yidan, Ленг Yi, Xihan, Cuizhen

Caixuan, Huixuan, Yuhong, Yanyun, Xiaozhong, Guorong, Wangxue, Yiqin, Xuegan000, Yiqin, Xuegan , Пей Лан, Юэ Хао, Ю Кай, Ю Цзе, Куан Чжэнь, Лин Ян, Сяо Фэй, И Сюань

Кай Цяо, Нуань Линь, Ди Синь, Цзэ Хэ, Ци Канг, любовь, Юйжун, Ицю, Лян Лэй, Мэй Фань

Хуэйинь, Юньчунь, Кей, Шукай, Синчжэнь, Янсюэ, Ифу, Эрбо, Ютянь, Ююй

Гэцинь, Ивэй, Цзинлин, Линли, Сюэпэн, Сюанье, Жунци, Цици, Жэньцзинь

, Цзинхау , Ванроу, Сяолань, Линлянь, Ифэн, Байтао, Цяньвэй, Юхань, Си Цинь

2018 Мудрость Доброе имя Дацюань

Цзуйсюань, Елу, Наньхай, Цяомэн, Кунь Цзюэ, Шулин, Хуэйю, Шэнцинь, Фаньчунь, Хуэйлай

Бинь Ю, Цинь Цзя, Хуан Мэн, Мин Ро, Цун Ци, Сяо Цзинь, Цзин Цюнь, Чун Гуй, Сяо Юань, Цзин Suo

Duo En, Yu Jing, Xiu Ye, Xiao Yun, Chi Yu, Si Tong, Pu Yun, Rong Qin, Qian Han, Luo Wen

Junjun, Shiyuan, Yijin, Linna, Xiqiao, Xiu Ling, Qiyang, Weidan , Yunying, Erqing

Min Ye, Guiqiong, Rong Qing, Laixiang, Nie Feng, Si Ping, Feng Qing, Fu Yi, Xiao Yin, Yin Qiao

Shiyi, Qizhen, Ying Ran, Hong Yue, Dianmin, Jiya, Meihua , Сяолу, Чжимэн, Илинь

Фэйбу, Сусян, Цзяньшу, Чжаньхань, Шилу, Тяньшань, Синься, Сяолу, Аойи, Жусян

Елань, Цюйи, Сяоуй, Сянъюнь, Цзилань, Цайфэн, Вэньчжэнь, Мунъян

Цзяо, Мэнфань, Ляньлу, Чанлей, Ютянь, Юэ Ян, Жуй Чжэнь, Фу Цзин, Дебэй, И Чан

.

первичной легочной чумы, связанной с собаками, в провинции Цинхай, Китай | Клинические инфекционные болезни

0"> Аннотация

Справочная информация. Первичная легочная чума (PPP), вызываемая Yersinia pestis , является наиболее опасной клинической формой чумы. О вспышке заболевания сообщалось в июле 2009 года в провинции Цинхай, Китай.

Методы. Эта вспышка была исследована клиническими, эпидемиологическими, бактериологическими и иммунологическими методами.Мультилокусный анализ тандемных повторов числа переменных (MLVA) использовался для отслеживания источника вспышки.

Результаты. В первом случае, пациент с ГПП, имел 11 близких контактов. У всех 12 пациентов, в том числе у первого пациента, внезапно поднялась температура, появилась головная боль и продуктивный кашель с кровянистой мокротой. Трое из них погибли. Тем не менее, еще 61 прямой и 256 косвенных контактов не были инфицированы в течение двухнедельного карантина. Антитела к антигену F1 были обнаружены в 9 случаях выживания с 4-кратным увеличением титров в образцах сыворотки, собранных в разные периоды.Семь штаммов Y. pestis были выделены от собак и пациентов. Полевое исследование и анализ выявленных штаммов выявили, что вспышка была инициирована погибшей собакой.

Заключение. Считается, что собаки являются животным-индикатором для эпиднадзора за чумой, но их связь с PPP встречается редко. Наши результаты подтверждают эту возможность, что свидетельствует о значении собак как источника чумы для общественного здравоохранения.

Чума, вызванная Yersinia pestis , была классифицирована Всемирной организацией здравоохранения (ВОЗ) как возобновляющееся инфекционное заболевание в начале 1980-х годов, поскольку в то время число зарегистрированных случаев во всем мире увеличивалось. Существуют разные формы чумы, в том числе бубонная и легочная, и последняя представляет собой наиболее опасную клиническую форму. Первичные и вторичные легочные чумы хорошо задокументированы в истории. Наиболее часто упоминаются вспышки первичной легочной чумы (ППП) в Окленде в 1919 г., Лос-Анджелесе в 1924 г. [1], Маньчжурии в 1910–1911 гг. [2] и на Мадагаскаре в 1957 г. ППС также недавно был зарегистрирован в США, Индии, Уганде, Замбии, Эквадоре и Мадагаскаре [3–11]. Поскольку PPP прогрессирует так быстро, что у пациентов часто ставится диагноз или подозревается чума только на поздней стадии заболевания, большинство случаев PPP было зарегистрировано на основе ретроспективных эпидемиологических исследований, и только некоторые из них были подтверждены бактериальной изоляцией. и обнаружение антител.

29 июля 2009 г. китайская система оповещения о чрезвычайных ситуациях в области общественного здравоохранения сообщила Министерству здравоохранения Цинхай о подозрении на вспышку ГЧП в округе Синхай, провинция Цинхай, Китай. На следующий день группа экспертов по чуме, включая эпидемиологов, бактериологов, врачей и руководителей, была отправлена ​​для дальнейшего расследования в тибетскую больницу округа Синхай (XCT), куда поступили подозреваемые пациенты.

3"> МЕТОДЫ

4"> Клинико-эпидемиологическое расследование

Клинические симптомы наблюдались клиническими врачами, и обычное эпидемиологическое расследование этой вспышки было проведено эпидемиологами.Ландшафт очага представляет собой альпийско-луговую степь с голыми скалами на Цинхай-Тибетском плато (известный очаг чумы). В селе очага проживает 324 семьи, в которых проживает 1472 человека. Marmota himalayana была основным хозяином чумы в этой области. Иногда встречаются другие грызуны ( Mus musculus , Cricetulus migratorius, Allactaga sibrica , Microtus oeconomus и Ochotona daurica ) и некоторые дикие или домашние животные (лисы, кошки, козы, рыси, барсуки и собаки). заразиться Y.pestis . Средняя температура во время вспышки чумы составляет 11,5 ° C, количество осадков - 113,6 мм. Чтобы отследить источник этой вспышки, в окрестностях зоны эпидемии были отловлены домашние животные (3 собаки, 2 козы, 1 кошка, 1 свинья и 1 корова) и дикие животные (35 сурков и 1 полевая мышь) (∼ 873 км 2 вокруг эпидемического поселка). Образцы сыворотки были взяты для обнаружения антител против антигена F1 с помощью анализа непрямой гемагглютинации (IHA) и для выделения Y. pestis . Со всеми животными обращались в соответствии с национальными критериями расследования чумы животных в Китае.Все эксперименты проводились в соответствии с инструкциями нашего института по работе с животными. Это исследование было одобрено биоэтическим подкомитетом научного комитета Цинхайского института профилактики и контроля эндемических заболеваний.

6"> Определение антител и антигена F1

IHA [12] был использован для измерения титра специфических антител F1 [13] путем 2-кратного серийного разведения образцов сыворотки, собранных у 9 выживших пациентов и всех их контактов. Все образцы были взяты специально для этого исследования, и все живые субъекты предоставили подписанное информированное согласие; образцы, взятые у умершего пациента, были согласованы на основе подписанного информированного согласия его прямого родственника. ИГА выполняли путем включения контроля ингибирования антигена F1, а также отрицательного и положительного контролей [14]. Обратный IHA был использован для обнаружения антигена F1 Y. pestis в образцах человека и животных [15].

8"> Выделение и идентификация Y.pestis

Клинические образцы от пациентов, собак, сурков и полевых крыс, включая кровавую мокроту, мазки из горла или органы вскрытия (печень, легкие, селезенка и сердце из первого случая и 2 мертвых собак, сурков и крыс) были первыми. вводили внутрибрюшинно мышам (1 образец на 5 мышей) для наблюдения за симптомами заболевания (например, лихорадкой, взъерошенной шерстью и дистимией) в течение 7 дней. Если животное было мертвым, печень, селезенку и легкие животного получали немедленно для инокуляции на 2 чашки с селективным агаром (так называемый BIN-агар, который основан на агаре для инфузии мозга и сердца с добавлением селективных агентов иргасана и солей холата). для бактериальной изоляции при 28 ° C [16].Если у животного не было явных симптомов, животных вскрывали на 5-7 день, убивая по 1 животному каждый день; печень, селезенку и легкие эмульгировали для инокуляции большего количества мышей, как упомянуто выше. Если образец был отрицательным для третьего раунда вышеупомянутой инокуляции на бактериальную изоляцию, он считался отрицательным для Y. pestis . Биохимические тесты, такие как арабиноза, глицерин, рамноза и мелибиоза; Окрашивание по Граму; тест на лизис бактериофага; и специфические тесты полимеразной цепной реакции, нацеленные на гены F1 и pla , были использованы для идентификации предполагаемых изолятов.Их чувствительность к антибиотикам in vitro к стрептомицину, цефтриаксону, канамицину и ципрофлоксацину оценивали с помощью диско-диффузионного теста [17].

0"> Мультилокусный анализ тандемных повторов числа переменных (MLVA) для отслеживания источника

MLVA с 46 локусами было выполнено на 7 изолятах Y. pestis от собак и пациентов в этой вспышке и на 5 других изолятах из того же природного очага вокруг озера Цинхай, как описано ранее [18, 19]. Флуоресцентно меченые ампликоны визуализировали электрофорезом в полиакриламидном геле на секвенаторе ДНК Applied Biosystems 3100 с использованием фрагментного анализа GeneScan.Данные были импортированы в программный пакет BioNumerics версии 5.10 (Applied-Maths) в виде наборов символьных данных. Кластерный анализ проводился с использованием категориального коэффициента и невзвешенного парно-группового метода со средним арифметическим. Минимальное остовное дерево было построено из матрицы подобия.

2"> РЕЗУЛЬТАТЫ

3"> Обзор вспышки

Индексный случай (пациент A) был 34-летним пастухом, который переехал со своих зимних пастбищ на свои летние в Чжихайгоу, уезд Синхай, незадолго до вспышки.Когда его семья прибыла в Чжихайгоу 20 июля 2009 года, пастух нашел одну из своих собак потерянной и стал искать ее. Он нашел его в 6 км от реки, лежащим запыхавшимся. Он отнес его домой, и собака закашлялась, и ее сильно вырвало с кровью во рту и в носу. Через 2 дня, 22 июля, он умер, ничего не съев. Пастух понес мертвую собаку на плечах, на шее, спустился с холма в место на расстоянии около 400 м от своего дома и закопал ее. Другая собака из его семьи умерла на следующий день с похожими симптомами.

Днем 24 июля пастуху стало не по себе, 25 июля у него поднялась температура и появился кашель. 26 июля его младший брат отвез его на мотоцикле в сельскую поликлинику, где его приняли 2 врача. Один из врачей безо всяких средств личной защиты осмотрел горло пастуха с помощью средства для снятия языка. 29 июля этот врач заболел (пациентка L). Другой врач, который контактировал только с рукой пациента, сделал переливание физиологического раствора с 4.0 г цефтриаксона натрия, не заразился. Врачи описали симптомы пастуха как лихорадку, кашель с кровянистой мокротой, бледность лица и боль в груди. Во время лечения в этой клинике у пациента был личный контакт с одним из своих друзей в той же деревне (пациент K). После первоначального лечения врач посоветовал отправить пациента в больницу XCT для дальнейшего лечения. По дороге в больницу в сопровождении двух старших братьев (пациенты G и J) и одного младшего брата (пациент F) у пациента возникла резкая дисфория и рвота.Он умер около 17:00 26 июля. Вечером того же дня труп пастуха отвезли домой, где его 2 старших брата (пациенты G и J), 2 младших брата (пациенты F и I), его тесть (пациент E) и его племянник (не зараженный) помог подготовить его в форме зародыша в соответствии с тибетской традицией. Рано утром следующего дня (около 5 часов утра) пострадавшего похоронили. Во время развития болезни его жена (пациент B), 2 сына (пациенты C и D) и младший брат (пациенты H) также имели с ним тесный контакт.

В ходе эпидемиологического расследования мы определили тесный контакт как человека, который жил или имел личный контакт (в пределах 1 м) с пациентом, прямой контакт как человек, который когда-то находился вместе с пациентом в одном помещении. комната или в той же машине с закрытыми окнами, а также косвенный контакт, как у человека, который встретил пациента в больнице, на открытом воздухе или в автобусе без личного контакта. Все 11 близких контактов были инфицированы (рис. 1), а 61 прямой или 256 косвенных контактов не были инфицированы.Это наблюдение похоже на предыдущие сообщения о том, что проницаемость PPP была не такой высокой, как предполагалось [4, 5, 20–23].

Рисунок 1.

Эпидемиологическое расследование первичной легочной чумы. Собака I умерла от легочной чумы и заразила индексный случай (A), а собака II в том же семейном доме также умерла. Пациент А заразил членов своей семьи (от B до J), деревенского врача (L) и одного из своих друзей (K) при близком контакте. Отслеживание контактов выявило 61 прямой контакт и 256 косвенных контактов.Никто не был заражен. Отслеживание источника проводилось путем отлова домашних и диких животных с использованием бактериальной изоляции и обнаружения антител. Было подтверждено, что четыре сурка из окрестностей места, где была обнаружена первая больная собака, имели серопозитивную реакцию на антитела к антигену F1, что указывает на то, что собака могла быть инфицирована при охоте на больного сурка.

Рисунок 1.

Эпидемиологическое расследование первичной легочной чумы. Собака I умерла от легочной чумы и заразила индексный случай (A), а собака II в том же семейном доме также умерла.Пациент А заразил членов своей семьи (от B до J), деревенского врача (L) и одного из своих друзей (K) при близком контакте. Отслеживание контактов выявило 61 прямой контакт и 256 косвенных контактов. Никто не был заражен. Отслеживание источника проводилось путем отлова домашних и диких животных с использованием бактериальной изоляции и обнаружения антител. Было подтверждено, что четыре сурка из окрестностей места, где была обнаружена первая больная собака, имели серопозитивную реакцию на антитела к антигену F1, что указывает на то, что собака могла быть инфицирована при охоте на больного сурка.

8"> Клинические симптомы и лечение

В этой вспышке участвовало 12 человек: 9 взрослых мужчин, 2 детей мужского пола и 1 взрослая женщина. Трое из них погибли. Клинические проявления суммированы в дополнительной таблице S1. К сожалению, из-за внезапной вспышки болезни, необходимости быстрого реагирования на чрезвычайную ситуацию в области общественного здравоохранения и ограниченных медицинских условий в такой отдаленной местности, этим пациентам не проводились рентгенограммы и обычный подсчет клеток крови. Все случаи были диагностированы на основании анамнеза контактов, выделения бактерий и / или продукции специфических антител, а также результатов лечения антибиотиками.Во всех случаях отмечалось внезапное повышение температуры, кашель с кровянистой мокротой и боль в груди. Инкубационный период составлял 2–4 дня. Стрептомицин, цефтриаксон натрия и ципрофлоксацин в комбинации были выбраны для лечения пациентов [24, 25]. Стрептомицин вводили внутримышечно (6 г в сутки взрослым и 2 г детям). Цефтриаксон натрия вводился внутривенно (6 г в день для взрослых и 4–5 г для детей). Ципрофлоксацин назначали только взрослым (0,2–0,3 г два раза в день). Доза антибиотиков была уменьшена через 1 неделю в соответствии с симптомами пациентов.Все пациенты получали обычную противошоковую и другую поддерживающую терапию (дополнительная таблица S1).

0"> Выделение бактерий и иммуноанализ

Штаммы Y. pestis были выделены в образцах легких первичного случая, образцах мокроты пациентов L и K, образцах мокроты и мазков из горла пациента J и образцах легких 2 мертвых собак. Таким образом, было выделено 7 штаммов Y. pestis : 5 от пациентов и 2 от собак. Бактерии были идентифицированы окрашиванием по Граму, биохимическими анализами, тестом на лизис фага и полимеразной цепной реакцией, нацеленной на гены caf1 и pla .Подтверждено, что все изоляты являются биоваром antiqua. Изоляты были чувствительны ко всем протестированным антибиотикам. Невозможно было выделить бактерии от других пациентов, поскольку антибиотики были введены сразу при поступлении. Хотя индексный пациент также получил 4 г цефтриаксона, его не лечили конкретно стрептомицином, и мы выделили Y. pestis из его образцов легких, что свидетельствует об ингибировании стрептомицином Y. pestis на ранней стадии.

IHA использовали для измерения титра специфических антител к антигену F1 путем 2-кратного серийного разведения образцов сыворотки, собранных у 9 выживших пациентов и всех их контактов.Как показано на рисунке 2, антитело IgG не удалось обнаружить на 6-й день после появления симптомов, но на 12-й день у всех выживших наблюдается резкое увеличение. Следует отметить, что у 1 пациента (I) титр F1-антител был намного выше, чем у другие, которые могут отражать биологические вариации иммунологических ответов среди людей. Все образцы сыворотки от прямых и непрямых контактов оказались отрицательными на антитела против F1 по данным IHA, что указывает на то, что во время этой вспышки среди них не было бессимптомных инфекций.

Рисунок 2.

Титры антител к антигену F1 от девяти выживших пациентов в течение болезни. Координата x показывает дни после появления симптомов, а координата y log 2 титра антител, определенного IHA. Пациенту F не показывали, потому что его антителаный ответ такой же, как у пациента B. Все пациенты продемонстрировали увеличение титра антител более чем в 4 раза.

Рисунок 2.

Титры антител к антигену F1 от девяти выживших пациентов в течение болезни.Координата x показывает дни после появления симптомов, а координата y log 2 титра антител, определенного IHA. Пациенту F не показывали, потому что его антителаный ответ такой же, как у пациента B. Все пациенты продемонстрировали увеличение титра антител более чем в 4 раза.

F1-антиген Y. pestis был обнаружен в образцах мокроты некоторых пациентов с помощью обратного ИГА до 10 дня после появления симптомов. Образцы аутопсии из индексного случая и образец мокроты пациента J на ​​3-й день после появления симптомов оказались F1-положительными.У пациента L, перенесшего длительное течение чумы с осложняющим шоком, антиген F1 можно было обнаружить в образцах мокроты до 20-го дня после появления симптомов. Антиген F1 не был обнаружен в образцах мокроты других пациентов.

5"> Молекулярное исследование, проведенное MLVA

Y. pestis был изолирован от 2 мертвых собак, что указывает на возможный источник патогена. Это подтверждается тем фактом, что линии от собак и людей принадлежат к одному и тому же генотипу по MLVA [18, 19].Двенадцать штаммов были исследованы MLVA, в том числе 2 от собак и 5 от пациентов в этой вспышке, а также 5 репрезентативных штаммов, собранных в нашей предыдущей работе из разных округов вблизи округа Синхай. Как показано на Рисунке 3, нет различий в профилях MLVA всех 7 изолятов во время вспышки 2009 г., и они отличаются от других изолятов из близлежащих регионов, что указывает на то, что изоляты от пациентов были переданы от инфицированной собаки.

Рисунок 3.

Связь между изолятами вспышки 2009 г. (более крупный красный узел) и другими изолятами из того же природного очага вокруг озера Цинхай. Происхождение изолятов на панели A показано на карте ( B ) разными цветами. A , Минимальное остовное дерево с 46 локусами VNTR [18, 19]. Год выделения и источник штаммов показаны рядом с узлами, например «пациент 1962 года» для верхнего левого меньшего красного узла, что указывает на то, что этот штамм был изолирован от пациента в 1962 году.Цифры возле ветвей соответствуют количеству различий локусов VNTR между двумя узлами. Число в каждом узле указывает идентификатор штамма. B , Географическое распределение изолятов, проанализированных в данном исследовании.

Рис. 3.

Связь между изолятами (более крупный красный узел) и другими изолятами из того же природного очага вокруг озера Цинхай в 2009 году. Происхождение изолятов на панели A показано на карте ( B ) разными цветами. A , Минимальное остовное дерево с 46 локусами VNTR [18, 19]. Год выделения и источник штаммов показаны рядом с узлами, например «пациент 1962 года» для верхнего левого меньшего красного узла, что указывает на то, что этот штамм был изолирован от пациента в 1962 году. Цифры рядом с ветвями соответствуют количеству ветвей. Различия локусов VNTR между двумя узлами. Число в каждом узле указывает идентификатор штамма. B , Географическое распределение изолятов, проанализированных в данном исследовании.

8"> Эпидемиологическое расследование диких и домашних животных

Среди образцов сыворотки животных, обнаруженных IHA, образцы сыворотки от 4 сурков (из окрестностей зоны эпидемии, где была обнаружена заболевшая собака) содержали антитела против F1 с титрами 1:20 для 1, 1:80 для 1, и 1: 1280 для 2, которые все были значительными по сравнению с нулевым фоном у сурков.Хотя штамм Y. pestis не был выделен от пойманных животных, это серологическое свидетельство указывает на то, что лесная чума все еще продолжается или когда-то была распространена в этом регионе. Поскольку пастушьи собаки едят мертвого сурка в поле, это также означает, что собака могла заразиться во время охоты на больного сурка. Ранее мы сообщали, что в соседнем округе (Хуанъюань) (рис. 3В) охота на сурков является фактором высокого риска в этом очаге чумы, и что у охотников и членов их семей уровень серопозитивности к чуме значительно выше - 21.7% (26 из 120) из-за бессимптомных инфекций [26].

0"> ОБСУЖДЕНИЕ

На основании результатов бактериальных, серологических, эпидемиологических и генетических исследований можно сделать вывод, что указанный здесь PPP был вызван Y. pestis и был инициирован инфицированной собакой.

В ходе этого расследования мы обнаружили, что простые контрмеры могут эффективно предотвратить распространение ГЧП среди контактов. Пациент Л., врач, кое-что знает о чуме, и когда он услышал о внезапной смерти пастуха, он забеспокоился, что он заразился заразным ППС.Когда 29 июля 2009 года у него внезапно поднялась температура, появилась боль в груди и появился кашель с кровавой мокротой, он попросил жену не контактировать с ним лицом к лицу и спать с ним лицом к лицу. Когда он ехал на автобусе в больницу префектуры Синхай для дальнейшего лечения, он полностью надевал куртку на голову. Он не загрязнял никаких прямых или косвенных контактов. Больной К. был отправлен старшим зятем на прием к другому сельскому врачу. Врач слышал о возможной вспышке ГЧП и попросил их надеть маску перед посещением клиники.При их приеме врач также носил маску. Затем их встретил карантинный персонал и оказал помощь в больнице XCT, а затем пациенту своевременно лечили на открытом воздухе на пастбищах в течение 6 часов с переливанием антибиотиков, прежде чем его перевели в больницу. Никаких прямых или косвенных контактов от этого пациента не было. Другой пример - племянник пастуха, который не был инфицирован. Он связался только с трупом пастуха, что указывало на относительно более высокую коммуникативность PPP во время периода кровавого кашля.Точно так же девочка из Юты, заболевшая легочной чумой, контактировала> 200 человек, и, согласно анализу антител, никто не был заражен [8]. Однако есть еще одно сообщение о том, что некоторые посетители похоронных церемоний для пациента с PPP были заражены [6].

У большинства пациентов (6 из 11, исключая индексный случай) в этой вспышке развилась септическая чума, осложненная шоком, у 2 из 11 развилась полиорганная недостаточность и у 1 из 11 развился менингит. Эффективные антибиотики следует назначать как можно раньше, поскольку отсроченное конкретное лечение приведет к пагубным последствиям [24].Недавно сообщалось, что легочная чума часто связана с контактами с домашними или дикими животными, включая кошек [9], собак [27–29], морских свинок [11], львов [3] или других диких животных [5]. Это подчеркнуло важную роль домашних животных в надзоре за чумой. Хотя считалось, что собаки устойчивы к инфекции Y. pestis и являются посредником для облегчения передачи блох в качестве источника бубонной или сепсисной чумы [27], а также в качестве дозорного эпиднадзора путем измерения антител к F1 в сыворотке собак для прогнозирования заражения. риск вспышки чумы [29, 30], собаки действительно могли быть инфицированы Y.pestis , показывая летаргию, гипертермию и гнойное поражение кожи [28]. Насколько нам известно, это первый отчет, демонстрирующий легочную чуму, вызываемую собаками, которые могут заразиться чумой в результате охоты на больного или мертвого сурка, основного хозяина Y. pestis в зоне эпидемии. Этот результат важен для общественного здравоохранения, потому что, если у собаки в естественном очаге чумы были обнаружены неспецифическая лихорадка и летаргия, следует иметь в виду возможность заражения Y. pestis .Хотя эта вспышка была хорошо задокументирована, нам было трудно определить базовый репродуктивный показатель для нее, потому что мы не могли определить, была ли возможная вторичная передача чумы среди пациентов, которые жили в плохо вентилируемой юрте.

Естественный очаг чумы в уезде Синхай провинции Цинхай был впервые подтвержден в августе 1956 года при выделении Y. pestis из мертвого сурка. С тех пор Y. pestis был изолирован от разных хозяев, включая сурков и монгольских пятипалых тушканчиков, а также переносчиков, включая блох, иксодовых клещей и вшей.Первая вспышка человеческой чумы произошла в сентябре 1960 года, вызванной сдиранием кожи сурков. Двадцать человек заразились, 7 из них умерли. В августе 1962 года 1 человек умер от септической чумы, вызванной очищением кожи от сурков. С тех пор и до этой вспышки в этом районе не регистрировалось ни чумы людей, ни животных. Как показал анализ MLVA, изоляты вспышки 2009 г. отличались от изолятов 1962 г. в округе Синхай (рис. 3), что указывает на то, что MLVA является многообещающей технологией для отслеживания источника подозреваемого бактериального патогена в конкретном расследовании вспышки, которая ранее использовалась для выявление наиболее вероятного источника двух бубонных случаев в Нью-Йорке [31].

Мы благодарим доктора Ларса Болунда из BGI-Shenzhen и Орхусского университета и доктора Чжэнлинь Янга из UCSD за их критические комментарии к этой рукописи. Благодарим доктора Дуншэн Чжоу за помощь в рисовании рисунка 1. Благодарим госпожу Хаоран Ван, Цзинь Ван, Сянсю Цинь и доктора Лэй Чжоу за их помощь в обнаружении антител.

Финансовая поддержка . Эта работа была поддержана Национальной ключевой программой по инфекционным заболеваниям Китая (2008ZX10004-009) и программой 973 (2009CB522601).

Возможный конфликт интересов. Все авторы: без конфликтов.

9"> Список литературы

1.

Боген

E

.

Легочная чума в Лос-Анджелесе

,

Cal West Med

,

1925

, vol.

23

(стр.

175

-

6

) 2.

Wu

L-T

,

Chun

JWH

,

Pollitzer

R

. ,

Plague: руководство для медицинских работников

,

1936

Shanghai

The Mercury Press

3.

Wong

D

,

Wild

MA

,

Walburger

MA

и др.

Первичная легочная чума от туши горного льва

,

Clin Infect Dis

,

2009

, vol.

49

(стр.

e33

-

8

) 4.

Джоши

K

,

Thakur

JS

,

Kumar

R

и др.

Эпидемиологические особенности вспышки легочной чумы в Химачал-Прадеше, Индия

,

Trans R Soc Trop Med Hyg

,

2009

, vol.

103

(стр.

455

-

60

) 5.

Begier

EM

,

Asiki

G

,

Anywaine

Z

и др.

Кластер легочной чумы, Уганда, 2004

,

Emerg Infect Dis

,

006

, vol.

12

(стр.

460

-

7

) 6.

Рациторахина

M

,

Chanteau

S

,

Rahalison

L

,

Ratsifasoamanana

L

,

Boisier

P

.

Эпидемиологические и диагностические аспекты вспышки легочной чумы на Мадагаскаре

,

Lancet

,

2000

, vol.

355

(стр.

111

-

3

) 7.

МакКлин

KL

.

Вспышка чумы в северо-западной провинции Замбии

,

Clin Infect Dis

,

1995

, vol.

21

(стр.

650

-

2

) 8.

Крамер

C

,

Christensen

B

.

Легочная чума у ​​15-летней девочки из Юты

,

J Emerg Nurs

,

1995

, vol.

21

(стр.

491

-

493

) 9.

Doll

JM

,

Zeitz

PS

,

Ettestad

P

,

Bucholtz

AL

,

Davis

T

,

Gage

K

Смертельная легочная чума, передаваемая кошкой, у человека, который путешествовал из Колорадо в Аризону

,

Am J Trop Med Hyg

,

1994

, vol.

51

(стр.

109

-

14

) 10.

Werner

SB

,

Weidmer

CE

,

Nelson

BC

,

Nygaard

GS

,

Goethals

RM

,

Poland JD

9000.

Первичная чумная пневмония, заразившаяся от домашней кошки в Саут-Лейк-Тахо, Калифорния

,

JAMA

,

1984

, vol.

251

(стр.

929

-

31

) 11.

Габасту

JM

,

Proano

J

,

Vimos

A

и др.

Вспышка чумы, включая случаи с вероятной легочной инфекцией, Эквадор, 1998 г.

,

Trans R Soc Trop Med Hyg

,

2000

, vol.

94

(стр.

387

-

91

) 12.

Suzuki

S

,

Hotta

S

.

Противочумные антитела против антигена фракции I Yersinia pestis в сыворотке от грызунов, зараженных экспериментально или пойманных в портовых районах Японии, 1971–1977

,

Microbiol Immunol

,

1979

, vol.

23

(стр.

1157

-

68

) 13.

Wang

T

,

Qi

Z

,

Wu

B

и др.

Новая стратегия очистки капсульного антигена фракции 1 и его эффективность против заражения вирулентным штаммом Yersinia pestis

,

Protein Expr Purif

,

2008

, vol.

61

(стр.

7

-

12

) 14.

Бахманьяр

M

,

Кавано

DC

.,

Руководство по чуме

,

1976

Женева, Швейцария

Всемирная организация здравоохранения

15.

Hai

R

,

Yu

DZ

,

Shi

XM

, et al.

[Исследование применения и оценки методов обнаружения генов и антигенов в программе эпиднадзора за чумой]

,

Чжунхуа Лю Син Бин Сюэ За Чжи

,

2007

, vol.

28

(стр.

426

-

9

) 16.

Ber

R

,

Mamroud

E

,

Aftalion

M

и др.

Разработка улучшенной селективной агаровой среды для выделения Yersinia pestis

,

Appl Environ Microbiol

,

2003

, vol.

69

(стр.

5787

-

92

) 17.

Hernandez

E

,

Girardet

M

,

Ramisse

F

,

Vidal

D

,

Cavallo

JD

.

Чувствительность 94 изолятов Yersinia pestis к антибиотикам к 24 противомикробным агентам

,

J Antimicrob Chemother

,

2003

, vol.

52

(стр.

1029

-

31

) 18.

Girard

JM

,

Wagner

DM

,

Vogler

AJ

и др.

Дифференциальная динамика передачи чумы определяет генетическую структуру популяции Yersinia pestis в локальном, региональном и глобальном масштабах

,

Proc Natl Acad Sci U S A

,

2004

, vol.

101

(стр.

8408

-

13

) 19.

Клевицкая

AM

,

Цена

LB

,

Schupp

JM

,

Worsham

PL

,

Wong

J

,

Keim

Идентификация и характеристика тандемных повторов с переменным числом в геноме Yersinia pestis

,

J Clin Microbiol

,

2001

, vol.

39

(стр.

3179

-

85

) 20.

Massin

L

,

Legrand

J

,

Valleron

AJ

,

Flahault

A

.

Моделирование борьбы со вспышкой легочной чумы

,

Epidemiol Infect

,

2007

, vol.

135

(стр.

733

-

9

) 21.

Viseltear

AJ

.

Эпидемия легочной чумы 1924 года в Лос-Анджелесе

,

Yale J Biol Med

,

1974

, vol.

47

(стр.

40

-

54

) 22.

Kool

JL

.

Риск передачи легочной чумы от человека к человеку

,

Clin Infect Dis

,

2005

, vol.

40

(стр.

1166

-

72

) 23.

Nishiura

H

,

Schwehm

M

,

Kakehashi

M

,

Eichner

M

.

Потенциал передачи первичной легочной чумы: неоднородная по времени оценка на основе исторических документов сети передачи

,

J Epidemiol Community Health

,

2006

, vol.

60

(стр.

640

-

5

) 24.

Анисимов

AP

,

Amoako

KK

.

Лечение чумы: перспективные альтернативы антибиотикам

,

J Med Microbiol

,

2006

, vol.

55

(стр.

1461

-

75

) 25.

Li

HL

,

Li

M

,

Wang

H

и др.

Эффективность комбинированного лечения множественными антибиотиками инфекции Yersinia pestis у экспериментальных кроликов (на китайском языке)

,

Chin J Zoonoses

,

2007

, vol.

23

(стр.

205

-

6

) 26.

Li

M

,

Song

Y

,

Li

B

,

Wang

Z

,

Yang

R

,

Jiang

L

.

Бессимптомная инфекция Yersinia pestis, Китай

,

Emerg Infect Dis

,

2005

, vol.

11

(стр.

1494

-

6

) 27.

Gould

LH

,

Pape

J

,

Ettestad

P

,

Griffith

KS

,

Mead

PS

.

Факторы риска человеческой чумы, связанные с собаками

,

Зоонозы Public Health

,

2008

, vol.

55

(стр.

448

-

54

) 28.

Орлоски

КА

,

Эйдсон

М

.

Инфекция Yersinia pestis у трех собак

,

J Am Vet Med Assoc

,

1995

, vol.

207

(стр.

316

-

318

) 29.

Chomel

BB

,

Jay

MT

,

Smith

CR

,

Kass

PH

,

Ryan

CP

,

Barrett

LR

.

Серологический надзор за чумой у собак и кошек, Калифорния, 1979–1991

,

Comp Immunol Microbiol Infect Dis

,

1994

, vol.

17

(стр.

111

-

23

) 30.

Li

B

,

Guo

Y

,

Guo

Z

и др.

Серологический обзор дозорных животных для надзора за чумой и скрининга дополнительных диагностических маркеров к антигену F1 с помощью белковой микроматрицы

,

Am J Trop Med Hyg

,

2008

, vol.

79

(стр.

799

-

802

) 31.

Colman

RE

,

Vogler

AJ

,

Lowell

JL

и др.

Детальное определение наиболее вероятного источника заражения человека чумой

,

Emerg Infect Dis

,

2009

, vol.

15

(стр.

1623

-

5

)

Заметки автора

© Автор 2011. Опубликовано Oxford University Press от имени Общества инфекционных болезней Америки.Все права защищены. Для получения разрешений обращайтесь по электронной почте: [email protected]

Обзор

: напряженная ночь (2016)

Напряженная ночь

情况

Китай, 2016, цветное, 2.35: 1, 86 мин.

Директор: Ван Ли 王莉.

Оценка: 7/10.

Развлекательная комедия с каперсами выигрывает от сильного сценария и в целом хорошего актерского состава.

ИСТОРИЯ

Пекин, конец июня 2015 года. Водитель мопеда Ню Давэй (Ли Цзин) везет беременную Сунь Тинтин (Ма Ли) в Пекин, чтобы увидеть своего мужа Ван Голяна, также известного как Гоу (Линь Сюэ), с неожиданным визитом, чтобы родить ребенка. столица. Niu Dawei 牛 大伟. Гоу («Собака»), который управляет зоомагазином в своей квартире в захудалой части города, долго открывает дверь, а Сунь Тинтин даже проверяет признаки любовницы. За ужином Ню Давэй спрашивает Гоу, видел ли он недавно Лю Дань (Цзинь Бейнбэй), девушку первого, которая, похоже, исчезла; Гоу звонит и говорит, что только что уехала из Пекина, чтобы вернуться домой. Гоу ссорится с Сунь Тинтингом, и эти двое уходят прочь. Самостоятельно проезжая по улочкам, Ню Давэй видит молодую женщину, ползающую по земле. Gou 阿狗. Где-то в тот же день Гоу и его любовница Лю Дань репетируют, как схватить женскую сумку. На подземной автостоянке они выхватывают сумочку Ду Сяоми (Шэн Ланси), когда она разговаривает по телефону со своим отцом Ду Цзяньфэном (Цинь Пей), главой Guohua Securities; но они случайно вырубили ее. Ду Цзяньфэн, думая, что его дочь похищают, предлагает заплатить любой выкуп, а Лю Дань спонтанно требует 100 000 юаней. Они с Гоу несут ее обратно в квартиру Гоу и кладут в шкаф; Лю Дань также крадет ее кольцо с бриллиантом, которое выглядит так же, как ее собственное поддельное.Затем они слышат, как Сунь Тинтин стучится в дверь, поэтому Лю Дань прячется в красно-бело-синей парусиновой сумке; когда все уходят, она обнаруживает, что не может открыть сумку. После скандала за ужином Гоу и Сунь Тинтин мирятся, но у нее схватки, и ее нужно срочно доставить в больницу. Вернувшись в свою квартиру, Гоу обнаруживает, что Лю Дань ушел. Чжоу Ян и Лили 周 阳 и Лили. Ранее в тот же день дом Ду Цзяньфэн пикетировали журналисты и инвесторы, которые хотят вернуть свои деньги. Ду Цзяньфэн симулирует истощение и уезжает в больницу Кандэ со своими помощниками Чжоу Янгом (Цао Юньцзинь) и Лили (Чжоу Вэйтун), которые также являются любовниками.Однако затем Лили обнаруживает, что Ду Цзяньфэн и его дочь планируют вылететь в Лос-Анджелес на следующий день и оставить их лицом к лицу с музыкой. Чтобы остановить их, Чжоу Ян нанимает своего зятя Гоу, чтобы тот схватил сумочку Ду Сяоми с ее паспортом, хотя Гоу не объясняет, почему. Когда он и Лили узнают от Ду Цзяньфэна в больнице, что его дочь была похищена с целью получения выкупа в размере 100 000 юаней, они думают, что Гоу пытается спекулянт. В квартире Гоу они находят красно-бело-синюю сумку, но ошибочно думают, что это Ду Сяоми, которая внутри.Они накачали ее и положили сумку в багажник машины. Тем временем Ду Сяоми просыпается в шкафу Гоу и неуверенно выползает на дорогу, где ее видит Ню Давэй, возвращаясь домой с ужина. Их 他们. В больнице Кандэ репортер (Цуй Тан) и его оператор (Ли Лу) проверяют, действительно ли там зарегистрирован Ду Цзяньфэн. В то же время вбегает Ню Давэй, неся бессознательную Ду Сяоми в своих руках, а Гоу ухаживает за своей женой, которая идет в родильное отделение на носилках.Это будет долгая и сложная ночь для всех.

ОБЗОР

Хорошо написанный пример криминальной комедии «Одно ведет к другому», которую в последнее десятилетие особенно любили материковые кинематографисты, A Busy Night 情况 不妙 также является большим шагом вперед для Уроженка Хэбэя Ван Ли 王莉, сценарист и режиссер, чуть старше 30, чьей единственной театральной особенностью была солидная, но стандартная согревающая сердце. New Coming Teacher Lee 新 来 的 李 老师 (2010), действие которой происходит в начальной школе в сельской местности Шэньси. , режиссером и соавтором которого она являлась.Комедия « Night » представляет собой увлекательную комедию, основанную на искусно построенном сценарии, который действительно имеет смысл и не исчерпывается через час, а также чувством ансамбля, которое делает персонажей больше, чем просто бегающими по кадрам вырезами. . Возможно, из-за отсутствия звездной силы фильм не произвел впечатления на выпуске; но сценарий Night имеет необходимую структуру, чтобы нести более громкие имена и четкое направление.

Благодаря ограниченному количеству основных локаций (квартира, переулок, больничная палата, морг) и небольшому центральному составу, Night иногда напоминает пьесу - и может быть легко адаптирован к одному из них.Ван написал и поставил и пьесу (麻将 人生, 2009), и мюзикл (至爱, 2010), и то, что в противном случае было бы полностью завязанным на сюжет, заводным произведением, безусловно, выиграет от наличия актеров с театральным опытом (актрисы Ма Ли 马丽 и Ли Ман 李曼 как беременная жена главного героя и обслуживающий большую заправочную станцию, в то время как Цао Юньцзинь 曹云 金 входит в число тех, кто питает центральную часть), а также такой актер, как Цинь Пей 秦沛 [Пол Чун], имеющий в целом огромный опыт.

Ван, похоже, изучал жанр, так как, как и лучшие криминальные комедии со штопором, Ночь начинается с простой настройки и развивается оттуда, проявляя себя через временные сдвиги (хотя и без подписей вроде «на три часа раньше») и упаковка всего дела в течение ограниченного периода времени (здесь примерно 24 часа).Действие начинается с того, что жена владельца зоомагазина на поздней стадии беременности навещает своего заблудшего мужа в Пекине, и когда ему нужно время, чтобы открыть дверь, публика просто понимает, что что-то не так. Чтобы ответить на этот вопрос, требуется около 15 минут, но к тому времени сюжет уже расширился с трех человек до восьми, включая мошенника, который планирует уехать из страны со своей дочерью, и двух его сотрудников, которые пытаются его остановить. В 30-минутный момент все персонажи сходятся в больнице по разным причинам и в значительной степени остаются там в течение следующих 40 минут, с несколькими поездками в его морг.

В районе часовой отметки темп фильма немного упал, и Ван, похоже, не знал, как ставить сцены морга; но она приберегает кое-что на последние 15 минут, которым предшествует красиво сыгранная пауза для дыхания на крыше больницы на рассвете. Как помощники мошенника, которые тайно работают против него, и Цао (имеющий опыт работы в стендап-комедиях), и актриса-модель из меньшинства Шуй Чжоу Вэйтон 周韦彤 (обладающая значительным физическим присутствием) составляют сильную пару, и им удается противостоять Цинь в полной мере проявил себя как ветеран-мошенник.Всего за несколько минут экранного времени всегда надежный Ма представляет собой сильную подозрительную беременную жену из другого города, в то время как известный стендап-комик / ведущий Ли Цзин 李 菁 хорош в роли любезного водителя мопеда, который только хочет найти девушку, которая его бросила.

Любопытно, что единственный актер, который, кажется, не соответствует ансамблю, - это ветеран персонажа Линь Сюэ 林雪 [Лам Сует], 52 года. Хотя он сильно отождествляется с Гонконгом, благодаря его фильмам для режиссера Ду Цифэна 杜琪峰 [Джонни То], Линь на самом деле родился в Тяньцзине, на севере Китая, и не эмигрировал в Гонконг до 14 лет.В Night он прекрасно себя ведет на своем родном Тяньцзиньском мандарине, но, будучи дородным владельцем зоомагазина, который попадает в ловушку махинаций, которые он не может контролировать, он демонстрирует буйную игру, в которой нет команды, необходимой для такой ведущей роли .

Не считая довольно хаотичных сцен с моргами, с ручной плохо освещенной фотографией, пленка выглядит прекрасно благодаря d.p. Цзянь Ливэй 简 立 威 ( Go Lala Go! 杜拉拉 升职 记, 2010; Impossible 不可 思 异, 2015). Музыка Луан Хуэй 栾 慧 оживляет комедию и боевик вместе с бас-гитарой, пиццикати и другими часто используемыми устройствами.Название фильма на китайском языке означает «Ситуация не лучшая», что также можно перевести как «Ситуация нормальная, все испорчено».

КРЕДИТОВ

Представлено Beijing Hairun Pictures (CN), Zhejiang Hengdian Film & TV Investment (CN), Beijing Sun Entertainment Culture (CN), Zhejiang Dongyang Xiaoyuzhou Film & TV Media (CN).

Сценарий: Ван Ли. Фотография: Цзянь Ливэй. Монтаж: Он Сиси. Музыка: Луань Хуэй. Художественное направление: Хо Ли. Звук: Сюй Инь. Исполнительное руководство: Лю Цзяси.

В ролях: Ли Цзин (Ню Давэй), Цао Юньцзинь (Чжоу Ян), Линь Сюэ [Лам Сует] (Ван Голян / Гоу), Ма Ли (Сунь Тинтин), Чжоу Вэйтун (Лили), Шэн Ланси (Ду Сяоми), Цинь Пей [Пол Чун] (Ду Цзяньфэн), Ли Ман (дежурный на АЗС), Цзинь Бэйбэй (Лю Дань), Суй Цуньи (Цян, телохранитель Ду Цзяньфэна), Цуй Тан (Дин, репортер), Ли Лу (оператор Дина) ), Ци Гуан (служитель морга), Гао И (старший служитель морга), Ду Циньи (оператор коммутатора).

Релиз: Китай, 29 июля 2016 г.

(PDF) Различия в составе кишечной микробиоты на основе оценки состояния тела у собак

Профилирование кишечной микробиоты у 24 здоровых гончих

240 | https://www.ejast.org https://doi.org/10.5187/jast.2020.62.2.239

Синдром раздраженного кишечника также обнаруживается при нарушении состава микробиоты кишечника. Баланс

состава кишечной микробиоты также участвует в балансе между проканцерогенным и антиканцерогенным колоректальным раком [2,4–6].

Сообщалось, что состав и функция кишечной микробиоты связаны с ожирением

у мышей и людей. У мышей с ожирением состав Firmicutes был увеличен, а Bacteroidetes - на

уменьшен [7]. Bacteroides уменьшилось у тучных людей и увеличилось у них после

потери веса с помощью рукавной гастрэктомии [8]. Есть несколько исследований, подтверждающих связь между ожирением

и микробиомом кишечника. Микробиота производит SCFAs в качестве конечных продуктов ферментации после

переваривания неперевариваемых ферментов [9,10] и используется в качестве источника энергии для организма хозяина [11].Ацетат,

, который является одним из SCFA, передается в мозг через периферическое кровообращение, что снижает потребление пищи в остром периоде

[12]. Фактически, концентрация SCFA была выше у лиц с избыточной массой тела [13,14].

Кроме того, увеличение липополисахарида (ЛПС), который является компонентом мембраны микроба

, вызывало ожирение, воспаление и инсулинорезистентность, когда мышей кормили диетой с высоким содержанием жиров [15].

Микробиота кишечника также влияет на здоровье и болезни собак.Подобно тому, что наблюдается у других животных, микробный состав кишечника связан с метаболизмом собаки во многих процессах. У

здоровых собак содержится 102–109 КОЕ / г в тонкой кишке и 108–1011 КОЕ / г в толстой кишке

бактерий [16,17]. Состав микробиоты кишечника собаки менялся в зависимости от типа диеты, например, количество белка или углеводов

[18]. Диеты с высоким содержанием белка и низким содержанием углеводов больше повлияли на микробиом собак с ожирением, чем у худых собак [19].Для сравнения, микробиота собак на

больше похожа на микробиоту человека, чем микробиота свиней или мышей согласно метагеномическому анализу

микробиома [18]. Микробиом кишечника собаки был бы более полезным для изучения на людях, чем на

свиньях или мышах. Однако энергетический баланс собак не сильно зависит от микробиоты, в отличие от

человека, потому что у них относительно более простой желудочно-кишечный тракт, как у других хищников [20], даже

, хотя собаки ближе к всеядности и могут потреблять значительное количество углеводов.Для здоровья и благополучия

собаки необходимо знать характеристики ее собственной кишечной микробиоты. К сожалению,

В настоящее время имеется ограниченная информация о микробиоте кишечника собак.

Собаки были одомашнены давно и стали основными домашними животными [21].

В настоящее время благополучие и долголетие домашних собак является главной заботой владельцев, и они

прилагают много усилий, чтобы сохранить здоровье своей собаки как члена семьи.Чтобы сохранить здоровый образ жизни

собак, управление питанием имеет решающее значение. Для этого важна сбалансированная кишечная микробиота

в отношении усвоения пищи и поддержания здоровья желудочно-кишечного тракта. Однако информации о микробиоте кишечника собак на

меньше. В этом исследовании мы изучили таксономические профили микробиоты

кишечника собак. Кроме того, мы проанализировали различие таксономических профилей кишечной микробиоты

на основе балльной системы оценки состояния организма.Это открытие будет способствовать пониманию разнообразия кишечного микробиома собак

и взаимосвязи микробиоты кишечника с набором массы тела у собак.





Всего было применено двадцать четыре здоровых бигля (возраст 24 месяца). . Исследования на животных были одобрены

Комитетом по уходу и использованию животных Национального института науки о животных

, Корея (номер разрешения: NIAS201

). Собак кормили коммерческой диетой (33%

сырого протеина, 20% сырого жира, 3% жирной кислоты, 13% сырой золы, 1% кальция, 0.8% фосфора, 12% влажности (

туров и 4100 ккал / кг ME) на основе метаболической массы тела два раза в день и воды с

свободной оценкой. Собак содержали в единственном питомнике и тренировали на открытом воздухе два раза в день. Собак регулярно содержали

, и в этом исследовании не было никакого дополнительного лечения или дополнительной диеты. За всеми

собак ежедневно наблюдали и при необходимости осматривали ветеринары.

Администрация сельского развития, Корея.



Авторы выражают признательность программе стипендий RDA

2019 Национального института зоотехники

, развития сельских районов

Администрации Кореи.



По разумному запросу наборы данных

этого исследования могут быть можно получить у автора-корреспондента

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *