Перейти к содержимому

Бурятская овчарка: Бурят Монгольский волкодав: характеристики породы собаки, фото, характер, правила ухода и содержания

Содержание

Бурят Монгольский волкодав: характеристики породы собаки, фото, характер, правила ухода и содержания

Размер

Крупный

Возраст

12–14 лет

Группа породы по МКФ

Не признана

Краткие сведения

  • Другое название породы — хотошо;

  • Превосходная служебная порода;

  • Спокойные и уравновешенные собаки.

Характер

Бурят-монгольский волкодав — аборигенная порода собак. Ещё в древности эти животные сопровождали кочевые племена, которые проживали на территории современной Бурятии и Монголии. Собака была помощником человека: она охраняла дом, сторожила стада овец и защищала от хищных зверей. Кстати, другое название породы — «хотошо» — в переводе с бурятского буквально означает «дворовая собака».

После почти полного исчезновения породы её удалось восстановить. Профессиональные кинологи-заводчики Николай Батов и Марика Терегулова из Бурятии возродили породу. А официальный стандарт хотошо был принят в РКФ в 2000 году.

Бурят-монгольские волкодавы — спокойные интеллигентные собаки с уравновешенным характером. Они не будут лаять попусту. Это преданные и верные животные, смыслом жизни которых является служение человеку. Издавна они использовались в качестве служебных собак и защитников семьи. И сегодня они прекрасно справляются со своими обязанностями.

Несмотря на грузность и внешнюю тучность, бурят-монгольский волкодав — подвижная и очень энергичная собака. Лениво лежать весь день — это не про неё, хотошо требует физических нагрузок и нуждается в дрессировке. Если у владельца нет опыта, желательно обратиться за помощью к профессиональному кинологу.

Собаки этой породы взрослеют медленно, поэтому социализировать и приучать их к внешнему миру необходимо постепенно. При неправильном воспитании хотошо может быть своенравен и самонадеян.

Бурят-монгольский волкодав — достаточно независимая и самостоятельная собака. Да, он любит похвалу и ласку, но никогда не станет навязывать свое общество хозяину. Хотошо не боится одиночества, но предпочитает всегда находиться рядом с человеком. Эта собака станет отличным компаньоном для большой семьи.

Хотошо — отличные няни, забота о хозяйстве, в том числе и о детях, у них в крови. Нежные, ласковые и очень терпеливые, эти собаки подолгу будут возиться с малышами и никогда не дадут их в обиду.

Бурят-монгольский волкодав отлично ладит с другими животными, особенно если он рос вместе с ними. Впрочем, и к незнакомым кошкам и собакам представители этой породы относятся нейтрально.

Уход

Хотошо неприхотлив в уходе. Его грубую шерсть необходимо пару раз в неделю вычесывать с помощью массажной расчески. Надо сказать, его шерсть обладает замечательным свойством самоочищения, поэтому купают представителей породы не так часто.

Нельзя забывать о здоровье глаз и зубов питомца. Их рекомендуется еженедельно осматривать и проводить регулярную чистку.

Условия содержания

Бурят-монгольский волкодав — определенно не квартирная собака, питомец будет счастлив жить за городом. Этих собак вполне можно содержать в вольере или просто на территории двора. Густая шерсть позволяет им подолгу находиться на улице даже зимой.

Поскольку это довольно крупные собаки, в период их взросления очень важно следить за здоровьем суставов и костей питомца.

 

Бурят-монгольская собака - породы собак

Добавить отзыв об этой породе   

Описание

Местное название " хотошо" переводится с бурятского как "дворовый волк". Он очень привязан к дому. Ему не свойственна "охота к перемене мест", хорошо известная многим владельцам собак. Таежники называют их "собаками база" - в дальнем походе псы предпочитают охранять базы - место привала, где складывают все вещи и припасы.

Он многолик, как бредбериевский Марсианин. Он самостоятелен как кавказец, контактен и дрессируем как овчарка, любит воду и плавает как ньюфаундленд, как Лабрадор готов играть, движения его скупы и неуловимо стремительны как у большинства бойцовых пород; вот только не уступая им в силе и ловкости, "бурят" никогда не задирается первым. С точки зрения внешней декоративности "буряты" вряд ли станут лидерами шоу - выставок, но как рабо- чая собака он может проявить себя в разных направлениях: бдительный сторож, прекрасный пастух, заботливая нянька, веселый компаньон, надежный защитник. Он - пластичный, податливый материал в наших руках. Лишь бы руки были добрыми.

История породы

Порода зарегистрирована в РКФ в 90-х годах XX века. В качестве исходного типа были приняты бурятские пастушьи собаки, используемые для защиты овец от хищников. «Волкодавом» эта собака является в той же самой степени, что и другие крупные овчарки, поэтому весьма удивительно, почему она названа «волкодавом», а не бурят-монгольской овчаркой. Состоит в близком родстве с овчарками Монголии и Средней Азии, являясь, по сути, продуктом их скрещивания. В отличие от густонаселенного Кавказа и открытых всем ветрам просторов Средней Азии Бурятия во многом до сих пор является "терра инкогнита". Таежные дебри скрывают следы не одной исчезнувшей экспедиции и останки бесчисленного количества легкомысленных путешественников. Видимо, поэтому у советских чиновников от кинологии не дошли руки до местных собак. Описания "монгольской овчарки" встречаются в ранних изданиях основоположника советской кинологии А. П. Мазовера, в частности, в своей книге "Экстерьер и породы служебных собак" издательства Осоавиахима СССР 1947 г. он пишет: "Самым близким потомком этих (тибетских) собак является современная монгольская овчарка. Широко распространена она в Бурят - Монгольской АССР... где используется в качестве пастушьей собаки. Монгольская овчарка, сохранившая все типичные черты и особенности тибетской собаки, является ее разновидностью".

В ряду отечественных пород бурят-монгольский волкодав (БМВ) - особый случай. Буддизм, исповедуемый в Бурятии и Монголии, - единственная из восточных религий, где собака не только не является нечистой, - она священное животное. "Четырехглазая" - черно-подпалая собака, по поверьям, приносит в дом счастье. Поэтому вход в жилище "бурятам" не просто не запрещен, они живут в прямом смысле бок о бок с хозяевами, не только охраняя имущество и скот, но и с колыбели опекая детей. Люди, которым довелось служить в Монголии и на советско-монгольской границе, до сих пор с теплотой вспоминают огромных лохматых псов, которые, встав на подножку "Урала", легко заглядывали в кабину через окошко. Они свободно жили при гарнизонах, являясь надежными охранниками части и заботливыми няньками для офицерских ребятишек. Не будучи навязчивым, "бурят" тем не менее очень отзывчив на внимание и ласку, при этом проявляя почти детскую непосредственность. На этом легко строится вся система воспитания БМВ - активно поощряя все правильно сделанное и отвлекая или выражая свое неудовольствие по поводу нежелательных действий, вы получите собаку, которая не доставит вам лишних хлопот.

Размеры

Кобели- не ниже 73см. Суки- не ниже 67см. Вес: 45 - 70 кг

Окрас

Черный, черно-подпалый, рыжий разных оттенков от палевого до медно-красного, коричневый. Допускается небольшое белое пятно на груди, не выступающее за пределы плечевого сустава, белые отметины на передних конечностях не выше середины предплечий, на задних -не выше середины плюсны. Допускается небольшая белая "кисточка" на хвосте. На стадии формирования породной группы допускается зонарный и тигровый окрасы.

Голова

Массивная с широкой черепной частью и сильно развитыми рельефно очерченными скулами. Лоб широкий плоский. Переход от лба к морде недлинный, заметный, четко обозначенный. Надбровные дуги хорошо выражены. Морда короче черепной части, мало заостренная с толстыми, но сухими плотно прилегающими губами, хорошо заполнена в подглазничной области. Мочка носа крупная, широкая, черная. У коричневых собак -коричневая.

Лапы

Большие, округлой формы, сводистые в комке.

Хвост

Высоко посажен, опущенный вниз, доходит до скакательных суставов или ниже их. Серпообразный, крючком или кольцом.

Уход за шерстью

Длинная шерсть не требует особого ухода.

Недостатки

Не городская собака. Хорошо подходит для охраны загородного дома. Длинная шерсть не требует особого ухода.

Собаки породы Бурят-монгольская собака на Догстере



неизвестные факты о породе — Агинское 24

Вы думаете, собаки не попадают в рай? Я уверяю: они будут там раньше каждого из нас.»

Роберт Льюис Стивенсон

Древнейшей породой собак принято считать тибетских мастифов. А вот о бурят-монгольском волкодаве или хотошо мало кто знает. Хотя многие профессиональные собаководы, проводящие исследования, называют именно хотошо самой древней породой.

Историческая справка

Эти мощные животные были распространены в Средней Азии, Бурятии и Монголии. Бурят-монгольский волкодав считался универсальным солдатом в быту: собака охраняла дом и скот, участвовала в охоте, нянчила детей.

Интересный факт!
В странах, где проповедуют буддизм, собаки породы хотошо – священные.

Селекцией этой породы никто не занимался. Выживали самые сильные щенки помета. А в конце столетия бурят-монгольский волкодав чуть было не исчез. Только благодаря Терегуловой Марики и Батову Николаю породу удалось спасти. Селекционеры отыскали несколько особей в Бурятии и занялись разведением.

Несмотря на то, что существуют стандарты (с 2006 года) породы и монопитомники, хотошо до сих пор не получила официального признания. Порода до сих пор малочисленна.

В местах обитания монгольского волкодава эту собаку еще называют кавказец, тибетская собака, монгольская овчарка, гуннская собака и волкодав.

Особенности породы

Хотошо имеют особенность в психологическом развитие. Особи медленно созревают. Животное считается полностью взрослым только к трем годам. Суки развиваются немного быстрее кобелей.

Но этот факт не мешают собакам выполнять свою главную задачу – охрана хозяина и его семьи.

Справка
Средняя продолжительность жизни – 12-14 лет. Высота кобеля в холке – 0,74 метра. Суки – 0,66 метра. Вес особи – до 80 кг.

Монгольский волкодав нуждается в общении. Заводить эту породу и не уделять животному время, значит обречь пса на несчастную судьбу.

Кого действительно любят волкодавы, так это детей. Эти огромные собаки никогда не обидят маленьких обитателей дома.

Животные этой породы настороженно относятся к чужакам. Но пес не нападет без команды хозяина или очевидно провокационного поведения соперника.

Породы овчарок - Породы овчарок

Овчарка особо выделяется среди всех пород служебных собак, так как это настоящий охранник, друг, помощник. Данная порода собак имеет острый слух, обладает прекрасными поисковыми способностями, которые имеется возможность развивать до бесконечности.

Как известно, овчарка относится к породам собак, которые называют собаки — пастухи. В самом начале своего эволюционного пути, данная порода использовалась в практических целях: помогала организовывать выпас скота.

На данный момент начитывается примерно около 50 разновидностей этой породы.

Немецкая

Порода берет свое начало в далеком 1899 году, так как именно в это время ее начинают разводить в Германии, где она приобретает особенную популярность.

В стране производился планомерный отбор особей с Центральной части страны, которые имели прекрасные качества пастухов животных.

Собака имеет прекрасную мускульную массу, отличается прекрасными качествами охранника, что позволяет ей, относится к служебной породе.

Пик развития немецкой овчарки приходится, наконец, 1939 года: активно используется в армии вермахта.

Сама собака имеет во взрослом возрасте вес около 30 килограмм

. Отличительной особенностью породы являются ее уши: они постоянно находятся в стоячем положении.

Бельгийская

История собаки начинается в 1891 году. Предки простые пастушьи собаки. По фактуре собака имеет достаточно сбитое телосложение, которое обладает гармоничностью.

Средний вес ровняется в пределах 25-30 килограмм.

По своему характеру эти четвероногие друзья отличаются высокими качествами: отличные сторожа, друзья семьи. Изумительно поддаются тренировкам.

Эта ветвь собак имеет несколько генеалогических ответвлений: грюнендаль, малинуа, тервюрен.

Порода относится к служебному виду, что поспособствовало ее размножению в различных странах. Собака используется в подразделениях полиции, армии.

Кавказская

Большая собака, которая имеет хорошо развитый скелет с большой мышечной массой, которая позволяет ей, относится к числу грозных охранников.

Селекционная работа по этой породе началась примерно в двадцатых годов двадцатого столетия.

Следует отметить, что это достаточно агрессивная порода овчарки, которая не потерпит присутствия чужого человека на вашем участке, а для своего хозяина- это лучший товарищ и защитник, которые в любом случает выполнит свою защитную миссию.

Масса взрослой особи составляет примерно 50 килограмм. Особи обладают преимущественно одним окрасом: серый цвет со светлыми тонами.

Среднеазиатская

Другое более распространенное название этой породы, алабай. Особи этой ветви овчарок имеют прекрасные охранные качества.

Достаточно часто используется в фермерских хозяйствах для охраны поголовья скота.

С хозяином это дружелюбный, большой друг, но чужаку будет непросто, так как пес четко выполняет свои охранные обязанности.

Предки этой породы с древних времен проживали в Азии, Китае, Тибете.

Вес примерно 50 килограмм.

Хорошо развита мускулатура и скелет. Цвет варьируется от чисто белого к черному цвету с белыми пятнами.

Разводчики алабая заметили, что их четвероногие товарищи достаточно сильно привязываются к одному хозяину, что еще раз подтверждает их преданность человеку.

Австралийская

По классификации собак, эта порода имеет название аусси.

Родина породы США.

Порода вывелась путем сложных генетических действий: скрещиванию подлежали овчарка пиренейского происхождения с породой колли. В результате получилась достаточно пушистая собака, которая имеет фактурную форму собаки пастуха.

Цвет шерсти напоминает белый гранит: черные пятна на белом фоне. Шерсть среднего размера, немного закрученного типа.

Данная порода прекрасно подойдет для большой семьи, так как особи отличаются добрым характером, практически не проявляют агрессию, но в нужный момент всегда защитят своего хозяина.

Английская овчарка

Собака получила свое признание в 1943 году. Изначально создавалась для нужд мелких фермерских хозяйств. Выведена при помощи скрещивания следующих пород: колли, простые пастушьи собаки.

Результат превзошел все ожидания: особи этой породы имеют хороший охранный инстинкт, который позволяет их использовать для охраны мелки хозяйств.

Обладает особой преданностью, и, не смотря на маленький рост, имеет храбрый характер.

Все взрослой собаки составляет примерно 20 килограмм. Преобладает черно-коричневый окрас шерсти. Однако есть одно но, собаки данной породы не получили признание мировых кинологов.

Анатолийская

Международное название этой породы овчарок кангал.

Достаточно древняя порода собак, которая в своем большинстве использовалась для охранных функций.

Родина породы Турция.

Имеет хорошие охраненные функции, но особо себя не проявляет, так как впадает в агрессию только в крайних ситуациях: хозяину грозит опасность. Особи этой породы сильно привязываются к своему хозяину.

Окрас преобладает чисто белый с темными окрасами. Масса взрослой особи составляет около 45 килограмм. Отличается тонким умом и достаточно спокойно ведет себя с чужими людьми, которые не проявляют по отношению к ней агрессии.

Болгарская

Порода не признана мировой кинологической службой. Древняя собака пастухов, так как изначально использовалась для охраны мелких отар овец в Болгарии.

Характерные черты породы: большая голова, крупное, мускулистое туловище. Шерсть средней длины.

К сожалению, данная собака не получила распространения по всему миру. В своем большинстве ореол ее обитания сводится к Болгарии. Средний вес составляет около 60 килограмм.

Имеет добрый, покладистый характер, но не сильно любит ласку, так как сказываются дикие корни породы. В редких случаях может агрессивно себя вести по отношению к своему хозяину.

Греческая овчарка

Овчарка, которая широко распространена на территории Греции. С древних времен использовалась для охраны.

Важно отметить, что данный экземпляр отличается низкой способностью к дрессировке, иногда проявляет необоснованную агрессию против человека.

Данный пес с легкостью может в одиночку одолеть волка. Породу греческой овчарки не признает ни одна кинологическая служба.

Вес взрослой особи составляет примерно 45 килограмм. В окрасе преобладает преимущественно белый и черный цвета. По мнению собаководов, данную овчарку не следует заводить в семье с детьми, так как велик риск агрессивного поведения в отношении детей.

Бергамская

Родиной данной собаки является Северная Италия. Имеет достаточно длинную шерсть, за которой нужен уход, так как она склон к слеживанию.

В 1959 году, порода получает признание ведущих кинологических служб мира.

Вес в пределах 45 килограмм, особи достаточно крупные. Собака обладает прекрасными скоростными качествами, которые ее унаследованы от своих древних сородичей, которые использовались в качестве пастушьих собак.

Она не проявляет практически ни какой агрессии, является отменным пастухом. Хорошо привыкает к детям и не может причинить им зла. Прекрасно переносит суровые погодные условия.

Каталонская

Впервые эта собака появилась в восемнадцатом веке. Родина испанский регион Каталония.

В 1954 году получает всеобщее признание, так как она одобрена всеобщей кинологической организацией.

Порода берет свои истоки от простых пастушьих собак. Замечено, что особи ведут себя довольно спокойно, но при обнаружении опасности, могут проявить жесткую агрессию.

Вес колеблется в пределах от 16 до 18 килограмм. Самое важное то, что овчарка каталонская довольно сдержанно терпит детей, прекрасно справляется со своими охранными задачами, изумительно пасет крупный рогатый скот.

В окрасе преобладает белый цвет вперемешку с черным цветом.

Мареммо-абруццкая

Это эталон пастушьих собак, так как имеют прямые корни, которые их роднят с беспородными собаками, которые были распространены на территории Италии.

Обладает следующими чертами: спокойный, не агрессивный характер, который всегда позволяет ей оценить происходящее.

В случае опасности, не особо размышляя, бросается на противника. Интересно то, что особи этой породы никогда не буду лаять по пустякам, так как имеют инстинкты охотника и не привыкли себя обнаруживать.

Вес взрослых особей колеблется в районе от 60 до 70 килограмм. Окрас в своем большинстве имеет чисто белый, иногда наблюдаются мелкие вкрапления черного цвета.

Богемская овчарка

Имеет довольно мирный характер, по пустякам не проявляет агрессии, в сложных ситуациях всегда проявляет сдержанность, умеет четко оценить сложившуюся ситуацию.

Собака появилась в Чехии в четырнадцатом веке.

Официальное признание порода получает в 1984 году. Она ведет себя достаточно адекватно с детьми, ни когда не причинит им зла, но в нужный момент обеспечит безопасность.

Прекрасно поддается тренировке, используется практически во всех силовых подразделениях.

Средний вес составляет 56 килограмм. В странах Западной Европы, данный вид овчарки используется для охраны частных владений.

Египетская

Овчарка данной породы не имеет чувства страха — это отличный охранник, который всегда доведет начатое дело до конца, он в любом случае защитит своего хозяина.

Собака появилась давно: войска Наполеона привезли в Египет французских овчарок, которые были скрещены с местными собаками.

Порода не получила признания кинологических служб. Отличительной чертой ее характера является то, что это очень игривый друг, который всегда будет рядом, он ни когда не предаст своего хозяина, но в нужную минуту всегда защитит.

Вес около 30 килограмм. В цветовой гамме присутствует разнообразие: серый цвет с черными вкраплениями, черный с коричневыми оттенками.

Польские овчарки

Данный вид овчарки имеет две разновидности: польская низинная, татранская. Обе породы имеют уравновешенный характер, всегда уверенны в себе, так как всегда чувствуют свое превосходство.

Эти породы собак всегда готовы к атаке, они не будут долго думать в сложной ситуации, так как всегда привыкли действовать на опережение.

Две породы признаны мировой кинологической службой.

Вес в районе 50-70 килограмм. Этим овчаркам присущ только белый цвет. Прекрасно уживаются в семье, где есть дети, так как принимают их за хозяев.

Хорошо переносят холод, так как имеют мягкую шерсть с теплым подшерстком.

Исландская

Интересно то, что эта собака впервые упоминается в летописях викингов. Прекрасный друг, который ни когда не бросит. Однако этот парень всегда ждет задачу, задачу, которую перед ним поставит его хозяин.

Можно смело быть уверенным, что он ее выполнит на все сто процентов.

В 1972 году, порода внесена в списки кинологической службы. Обладает мирным, не конфликтным характером, но в сложный момент, всегда сможет защитить своего хозяина. Вес взрослой особи примерно 10 килограмм.

У этой собаки очень интересное строение шерсти: низ короткий, верх длинный. Именно эта особенность позволяет ей легко переносить холода.

Норвежская овчарка

Ее прямой родственник простой шпиц. Эта овчарка имеет небольшой рост, но отличается достаточно отважным характером, который позволяет ей всегда выходить из сложных ситуаций победителем.

В 1963 году эти особи получили всеобщее признание кинологической службы.

Собаки впервые появились у викингов, которые использовали их для своих охранных целей: охрана мелкого ската. В цветовой гамме присутствуют два окраса: темно- светлый, черный.

Довольно спокойная собака, который всегда находит общий язык с людьми. В сложной ситуации всегда действует решительно. Вес взрослой особи приблизительно 15 килограмм.

Уэльская

Красивая собака, которая имеет низкую посадку, так как лапы достаточно короткие, но все эти недостатки компенсируются ее крепким телосложением.

Очень веселый друг, который всегда придет на помощь, в сложной ситуации всегда действует решительно.

Масса взрослой особи составляет 10 килограмм. В цветовой гамме преобладают в основном светло- коричневый цвет. По словам владельцев, эти особи обладают особенной привязанностью к своим хозяевам, отлично ладят с детьми, ни когда их не оставят в беде.

Собака имеет прекрасные корни пастушьих собак, зачастую используется в мелких подсобных хозяйствах, так как имеет суровый охотничий характер.

Пикардийская

Родина Франция. В страну попала в девятом веке. По словам заводчиков это синтез бельгийской овчарки с местными породами французских пастушьих собак.

Признание кинологической федерации получила в 1925 году.

Душевный компаньон, отличный пастух, прекрасный и ответственный охранник, который четко знает свое дело.

Собака обладает твердым, решительным характером, слушается только своего хозяина, так как полностью ему доверяет.

Не конфликтует с детьми. Люди, которые обладают этой удивительной породой собак, утверждают: он ни когда не сможет перенести одиночества. Вес половозрелой особи составляет примерно 30 килограмм.

Крашская

Данный вид овчарки имеет глубокие исторические корни: впервые появилась в Словении.

В своем большинстве, ее использовали пастухи, так как собака имеет прекрасные качества, которые позволяют ей контролировать крупное стадо скота.

В 1939 году получает признание мировой кинологической службы.

Обладает спокойным характером, всегда четко продумывает свои действия, ни когда не проявляет агрессию к своему хозяину, так как просто его уважает.

В окрасе преобладает серый цвет с оттенками черного цвета. Вес овчарки в среднем составляет 30 килограмм.

Заводчики утверждают, что данный друг никогда не будет бес причины лаять, он всегда трезво оценивает ситуацию.

Староанглийская

Это настоящий английский аристократ, который знает себе цену. Собака обладает сильным, независимым характером, но всегда и во всем слушается своего любимого хозяина, который является для нее авторитетом.

Обладает громким лаем, который всегда предупреждает хозяина о надвигающейся опасности.

Прекрасно ладит с детьми, не проявляет попросту агрессию. Заводчики утверждают, что у данной породы наблюдается хорошо развитый интеллект, который помогает ей понять хозяина с полуслова.

Этому другу не нужно ставить задания, он все поймет без слов. Особи имеют хорошо сложенное телосложение, обладают развитой мышечной массой, идеально подходят для содержания на частном подворье.

Масса взрослых особей примерно 30-35 килограмм.

Южнорусская

Родина данной собаки Украина, юг России. Широко применяется в охранной деятельности, так как имеет прекрасные охранные качества.

Данный вариант собаки прекрасно подойдет для уличного содержания в вольере, так как имеет достаточно длинную шерсть, которая защищает ее от холода.

Эта порода имеет свои стандарты, которые постоянно контролируют заводчики: выносливость, спокойный характер, иногда может проявлять агрессию, но всегда отвечает за свои действия. Быстро привыкает к хозяину.

Используется в силовых подразделениях, так как имеет замечательный нюх, который позволяет ей определить наркотические вещества.

Шелти

Данный вид овчарки родом с Шетландских островов, именно там она была выведена методом скрещивания местной породы колли и простых островных собак.

Шелти преданный друг, который ни когда не подведет, он всегда вступится за своего хозяина.

Она достаточно общительная, всегда готова к общению со своим хозяином. Довольно осторожно ведет себя с чужими людьми, но, ни когда не проявляет агрессию.

Цвет шерсти сильно схож с настоящей колли: белый цвет с коричневыми вставками.

По своей сути, это настоящий пастух, сказываются исторические корни. Масса взрослой особи примерно 25 килограмм. Идеально подходит для квартирного содержания.

Тувинская

В народе эту породу называют просто: тувинская собака. История породы начинается в далеком восемнадцатом веке, так как именно в это время ее начинают разводить тувинские народности.

Это истинный пастух, который четко знает свое дело.

Порода не признана мировой кинологической службой, но это, ни как не влияет на ее прекрасные характеристики. Интересно то, что этот вид не нуждается в постоянном контроле, так как он обладает изумительной самоорганизацией.

Достаточно независимый, имеет свой характер, который иногда выдает его особенную игривость. Хорошо относится к детям, прекрасно справляется с охранными задачами.

Хорватская

Родина собаки Хорватия, он является коренным аборигеном, которого издревле использовали для охраны. Его основные особенности: очень ловкий пес, прекрасный пастух, отважный охранник, который ни когда не даст в обиду своего хозяина.

Достаточно быстро привыкает к человеческому обществу, а в отсутствии общения просто начинает грустить.

Это собака праздник, так как с ней нужно постоянно находиться в движении, она не даст грустить своему хозяину. Прекрасно подойдет для семьи, так как не проявляет агрессии, любит детей.

Цветовая гамма однотонная: преобладает чисто черный цвет. Вес в районе 45 килограмм.

Французские овчарки

Это большой подвид семейства овчарок, которые исконно проживали на территории Франции.

Изначально это были пастушьи собаки, но со временем их начали заводить простые люди, так как данный тип собак имеет великолепные охранные качества.

Следует выделить две основные ветви породы:

Босерон это пастух, охранник, верный друг.

Шерсть короткая. Цвет темно-коричневый.

Это достаточно упрямая собака, которая четко знает свою цель.

Имеются случаи неповиновения своему хозяину, сказываются дикие корни торфяной собаки. Вес взрослой особи примерно 40 килограмм.

Бриар является настоящим охотником и пастухом.

Длинная шерсть позволяет переносить сильные холода. Данный вид овчарки имеет своенравный характер, но собака прекрасно чувствует своего хозяина, и всегда готова выполнить любую поставленную задачу.

Он всегда настроен доброжелательно по отношению к детям, прощает им мелкие обиды.

Бриар ни когда не показывает свое раздражение, так как обладает железным характером. Вес взрослой собаки составляет примерно 25 килограмм. Цвет шерсти преобладает светло- рыжий.

Румынская карпатская

В первую очередь это настоящий спасатель, так как в сложных ситуациях, собака всегда приходит на помощь, она ни когда не оставит своего хозяина в беде.

Данная порода овчарок характеризуется полным отсутствием чувства страха, трусости, она всегда готова идти до победного конца.

Свое международное признание получила лишь в 2015 году. Имеет прекрасную реакцию, которая позволяет ей проводить стремительную атаку врага, идет в бой, не раздумывая, так как всегда уверена в своих силах.

Хорошо относится к детям, но всегда держит социальную дистанцию. Быстро привыкает к своему хозяину. Преобладает пепельный окрас.

Венгерские овчарки

К этой ветви относят породы: комондор, муди.

Комондор настоящий пастух, имеет длинную шерсть белого цвета.

Этот друг всегда готов придти на помощь, защитить своего хозяина.

Однако ни когда не позволит себя жалеть, ласкать, так как имеет твердый характер, который иногда может проявлять в жестких агрессивных формах. Вес взрослой собаки примерно 50-60 килограмм.

Муди, это собака воин, так как она полностью принадлежит своему хозяину.

Для него она готова пойти на все. Она послушная собака, которая выполнит любую команду хозяина.

Обладает особенной выносливостью, которая позволяет ей проводить долгое время в суровых климатических условиях, сказываются корни пастушьей собаки.

Твердый характер не позволяет ей проявлять слабость, всегда сдержанно себя держит, даже в самых сложных ситуациях, так как привыкла все держать под контролем.

Голландские овчарки

Порода хердер

К этой ветви собак относят следующие породы овчарок: хердер, шапендуа.

шапендуа

Обе породы имеют прекрасные данные охранных собак.

К своему хозяину испытывают особое уважение, нейтрально относятся к детям.

По своей сути, это добрые семейные псы, которые всегда защитят, просто скрасят время, так как обладают особенной игривостью.

Шотландская

По-простому ее называют пастушья собака, так как имеет древние корни, всегда использовалась в целях охраны стада.

Имеет покладистый характер, ни когда не проявляет агрессии, всегда ведет себя сдержанно, но при острой необходимости всегда выступит на защиту своего хозяина.

Цвет шерсти в воем большинстве светло-коричневый, иногда бывают особи черно-белого цвета. Шерсть длинная.

Собака прекрасно подойдет для квартирного содержания. Любит детей, ни когда не причинит им боль. Быстро привязывается к хозяину.

Шилонская

Родина США. Достаточно молодая порода охранных собак.

Это собака друг, она ни когда не подведет своего хозяина, всегда защитит его в сложной ситуации.

Прекрасно зарекомендовала себя в роли пастуха. Она отзывчива, всегда идет на контакт с хозяином, но в тоже время, постоянно держит дистанцию. Прекрасно ведет себя с детьми.

Бурятская

Родина этой собаки Монголия. Это настоящий охотник, который имеет выносливый характер, обладает особенной смелостью и силой.

Зачастую использовался, как собака для упряжки.

Порода не признана всемирной кинологической федерацией. Идеально подходит для охранных функций.

Прекрасно переносит суровые климатические условия. Вес взрослой собаки равен 60-70 килограмм.

Афганская овчарка

Настоящий боец, так как ему просто не ведомо чувство страха.

Особи очень агрессивные, иногда полностью отказываются выполнять команды, но свои охранные функции выполняют на все сто процентов. Не рекомендуется к содержанию в семье, так как имелись случаи необоснованной агрессии против детей.

На нашем сайте «Породы овчарок» вы сможете найти подробную информацию о каждом виде этих прекрасных собак, узнать, какими чертами обладает тот или иной вид, и какого пса лучше завести именно вам. А  также вас ждут совету по уходу за верными четвероногими друзьями и много полезной информации в различных разделах нашего блога.

Мероприятия - НКП Хотошо (бурятская собака).

 

                   Дорогие друзья!

В марте планируются совместные встречи руководства НКП Хотошо, членов НКП, представителей питомников, владельцев и просто любителей породы, а так же всех желающих поучаствовать в этом меропрятии.

Президент Национального клуба породы Хотошо - Наталья Парнова, вице Президент - Николай Батов, члены президиума - Евгения Маныкина и Алла Кулакова планируют провести 2 встречи хотошистов Байкальского региона.

Первая встреча пройдёт в Бурятии в Улан-Удэ, 14 марта, в 12 часов, в Урочище Тологой.

В программе:
    - смотр поголовья хотошо Бурятии,
    - фотосессия и промеры,
    - мини семинар.
Подробности о встрече в Улан-Удэ по телефону:
+79834339006 Ирина Лескова, Viber, WhatsApp.

Вторая встреча состоится в Иркутске, 15 марта, в 11 часов, в кинологическом центре "Остров Собак", по адресу Верхняя Набережная, 167/1, Цокольный этаж.
В программе:
    - особенности воспитания и дрессировки хотошо,
    - ринговая подготовка и показ
    - обсуждение, вопросы.
Перерыв.
Практическая часть:
    - смотр, промеры, фото, видеосъемка.

16 марта для владельцев хотошо, посещение Байкала, практические занятия.
Подробности о встрече в Иркутске: по телефону:
+79021717909 Ольга Петрова, Viber, WhatsApp, Telegram.

Целенаправленная работа по сохранению тех крупиц породы, которые были найдены, была начата в восьмидесятых годах прошлого века, кинологами Бурятии Николаем Батовым и Марикой Терегуловой и успешно ведется до настоящего момента.
В 2005 году был принят первый официальный стандарт породы, который был опубликован в Вестнике РКФ № 3 (56) от 2005г.
В 2019 году, 24 июля, принята новая редакция Стандарта породы Хотошо (Бурятская собака) решением Президиума СОКО РКФ. Следующий этап - признание породы FCI, международной кинологической федерацией.

Цели и задачи проводимого мероприятия:
- объединение хотошистов,
- изучение современного поголовья и состояния породы в разных регионах,
- сбор фото и видео материала для комментариев к стандарту,
- на базе собранных материалов изготовление видео презентации нашей породы.

 


 

Великолепный банхар - ВОСТОЧНАЯ ОКРАИНА — ЖЖ

   

              Банхар - монгольская овчарка, реликтовая первопорода на Земле, обладающая выдающимися качествами, делающими ее превосходящей над другими породами. У забайкальских бурят-монголов эта порода называется хотошо. Конечно у нас в Забайкалье эти собаки часто встречаются со значительной примесью других пород, но тем не менее есть и собственно банхары или хотошо, в основном по глухим, отдаленным селам. Я кстати первый раз познакомился с этой породой, как раз, когда жил в одной из глухих деревушек, где стояла ГРП моего отца. Мне было лет 5-6, но я до сих помню и фамилию хозяев собаки и ее кличку. Хозяев звали Цыреновы, а собаку, да простят меня "белогвардейцы", собаку звали Колчак. Надо сказать, свирепый был пес, этот Колчак, в моем конечно представлении.



 
           В мире насчитывается более 500 пород собак, и хотя  «на вкус и цвет товарищей нет»,  чем древнее порода собаки, тем выше уровень ее интеллекта, здоровее физиология, мощнее жизненная приспособляемость.

Речь пойдет, собственно, о монгольской овчарке-банхаре, возраст породы которой насчитывает около 14 тысяч лет. В российской кинологической литературе из книги в книгу, из статьи в статью кочует ссылка на монгольскую овчарку,  как на предка среднеазиатских и кавказских  овчарок.

Монгольская овчарка, эта порода собак – само совершенство в мире собак. Местное название у которых  «монгол банхар», где «банхар» это пухлый в щеках, богатый пухом, или более древнее и реже используемое, - баавгай, бавгар (медведь, медвежьеподобный).  Все эти названия отлично характеризуют особенности этой  породы.

Например, знаменитый на всю Монголию охотник Ч.Лувсан за 20 лет с помощью монгольской аборигенной собаки – банхара  добыл 22 000 сурков, 200 рысей, 900 волков, 40 медведей! Диапазон возможностей – от норной зверушки сурка до громадного хищника медведя! Никакая  охотничья собака на такое не способна, только: или-или. Иногда среди зверовых лаек встречаются более-менее универсалки, способные и по белке, и по соболю идти, и не побояться лося или медведя тормознуть. Ведь лайки – это тоже очень древняя порода собак.

  Читать полностью ЗДЕСЬ   и  еще статья описывающая уникальные свойства нашей собаки ЗДЕСЬ

Собака наелась костей и не может сходить в туалет


Собака 2х месяцев наелась костей! SOS! Нужен совет срочно.

Вазелиновое масло из спринцовки. В ротик и в попу. Приблизительно по 30 - 40 мл.

Смотря каких костей. Если трубчатых, то пора к ветеринару. Как щенок в 2 месяца вообще умудрился куда-то залезть и съесть кости? Даже, если взрослая собака нажрется костей, это пасно. Везите к ветеринару.

Совет чем быстрее, тем лучше? Быстрее и лучше будет обратиться к ветклинику! Там вам должны дать сульфат бария и направить на рентген!

Может косточка застряла... к ветеринару лучше

СРОЧНО К ВЕТЕРИНАРУ !!!Им до года нельзя давать куринные косточки

Не тяните время - к ветеринару срочно!

Есть удивительные йогурты с бифидобактериями, совсем не вредными для здоровья. Хороший эффект при не сварениях в желудках. Лично я на коте пробовал, всё прошло на ура: зашевелился, обрадовался, покакал. Советую....

SROCHO v VET-lecebnicy!!!!

КисЮлька правильно советует! Для начала сделай это и потом к ветврачу.

сливочное масло дать покушать а в попку свечку или клизму с растительным маслом или вазелином. Вообще от куриных костей бывает прободение кишечника так что если свечка не поможет везите к врачу.

ветиренар лучшие средство

У меня такое было, тоже уц щенка - ветеринар сказала вавзелиновое масло, частями, как можно больше. итогом она сходила в туалет, но не сразу, а где-то часов через 5. А если не поможет, то рентген.

touch.otvet.mail.ru

Собака не может сходить в туалет! - Пищеварительная система, отравления, глисты, зубы, анальные синусы - Лабрадор.ру собаки

Собака не может сходить в туалет! - Пищеварительная система, отравления, глисты, зубы, анальные синусы - Лабрадор.ру собаки - ретриверыJump to content
pavlusha    0
  • Новичок
  • Пользователи.
  • 0
  • 18 posts
  • City:Moscow
Тинатин    4,361
  • Аксакал
  • Пользователи.
  • 4,361
  • 10,708 posts
  • Sex:Женский
  • City:Москва
Дениска    19,296
  • Аксакал
  • Пользователи.
  • 19,296
  • 29,261 posts
  • Sex:Женский
  • City:Москва, метро Беговая, г. Александров Владимирской области
pavlusha    0
  • Новичок
  • Пользователи.
  • 0
  • 18 posts
  • City:Moscow
Aннaбель    27,360
  • Аксакал
  • Аннабель
  • 27,360
  • 23,541 posts
  • Sex:Женский
  • City:Москва, Юг
Селунская Ксения    7,750
  • Аксакал
  • Пользователи.
  • 7,750
  • 16,734 posts
  • Ветеринар, хендлер
  • Sex:Женский
  • City:Москва, Верхние Поля (Люблино)
Дениска    19,296
  • Аксакал
  • Пользователи.
  • 19,296
  • 29,261 posts
  • Sex:Женский
  • City:Москва, метро Беговая, г. Александров Владимирской области
pavlusha    0
  • Новичок
  • Пользователи.
  • 0
  • 18 posts
  • City:Moscow
Дениска    19,296
  • Аксакал
  • Пользователи.
  • 19,296
  • 29,261 posts
  • Sex:Женский
  • City:Москва, метро Беговая, г. Александров Владимирской области
pavlusha    0
  • Новичок
  • Пользователи.
  • 0
  • 18 posts
  • City:Moscow
Дениска    19,296
  • Аксакал
  • Пользователи.
  • 19,296
  • 29,261 posts
  • Sex:Женский
  • City:Москва, метро Беговая, г. Александров Владимирской области
pavlusha    0
  • Новичок
  • Пользователи.
  • 0
  • 18 posts
  • City:Moscow
pavlusha    0
  • Новичок
  • Пользователи.
  • 0
  • 18 posts
  • City:Moscow
Селунская Ксения    7,750
  • Аксакал
  • Пользователи.
  • 7,750
  • 16,734 posts
  • Ветеринар, хендлер
  • Sex:Женский
  • City:Москва, Верхние Поля (Люблино)
pavlusha    0
  • Новичок
  • Пользователи.
  • 0
  • 18 posts
  • City:Moscow

labrador.ru

что делать и чем помочь питомцу

Владельцы собак хоть раз в жизни сталкивались с отсутствием дефекации питомца или его затруднением. Но далеко не все знают, как бороться с этой проблемой и чем можно помочь четвероногому другу. Всегда ли запор является поводом для обращения к ветеринару и что делать, если запор у собаки?

Если человек завел собаку, то он должен и внимательно относиться к ее здоровью. Что же может подсказать, что у питомца не все в порядке с кишечником?

Прежде всего, здоровая собака ходит в «по большому» минимум два раза в сутки. Если она стала опорожняться реже или же совсем перестала, то это повод приглядеться к ее общему состоянию, при этом не стоит впадать сразу в панику. Количество дефекаций животного во многом зависит от его размеров, физиологии и возраста.

Прежде всего, необходимо оценить, как себя ведет питомец. Если он бодрый, веселый, с хорошим аппетитом, а кал имеет однородную тугую консистенцию, то особых поводов для беспокойства нет.

На можно заметить, что собака пытается сходить в туалет, тужится, усиленно напрягаясь, но безрезультатно. В этот момент можно услышать, как она , так как запор причиняет болевые ощущения и дискомфорт.

Кроме того, существует несколько симптомов, явно свидетельствующих о том, что у собаки запор:

  • вздутие живота – в кишечнике скапливаются газы, и у собаки часто урчит в животе;
  • – при непроходимости кишечника, в большинстве случаев, питомцы отказываются от пищи;
  • у собаки может быть ;
  • она пьет большое количество воды;
  • общее недомогание – собака без большого энтузиазма воспринимает сообщение о выгуле, мало двигается и стремится домой.

В некоторых случаях можно помочь питомцу самостоятельно, но не всегда. Обращаться за медицинской помощью необходимо при наличии следующих признаков:

  • если в кале присутствует кровяная примесь, пена, частицы непереваренного корма;
  • фекалии имеют явный запах гнили и сырости.

Что же может вызывать подобное состояние?

Неправильное питание и другие причины запора

От зависит многое, в том числе количество и качество опорожнений. Причиной запора может стать следующее:

  • собака съела большое количество костей, особенно трубчатых отварных;
  • питомца кормят крутым бульоном;
  • в рационе присутствует большое количество клетчатки;
  • перекармливание собаки.

Также затрудненную дефекацию может вызвать кормление сухим кормом, который не подходит питомцу.

Нередко запор является не самостоятельным заболеванием, а лишь одним из симптомов более тяжелого состояния:

  • заболеваний органов желудочно-кишечного тракта, печени и почек;
  • проблем неврологического или ортопедического характера;
  • и простаты у самцов.

Попадание в организм питомца инородных предметов также может спровоцировать непроходимость каловых масс. Если причину запора выясняет ветеринар, то назначается рентген брюшины, общий анализ крови, ультразвуковое исследование.

Лечение запоров у собак

Терапевтическое лечение включает в себя применение препаратов лактулозы, размягчающих каловые массы – Дюфалак, Лизолак, Лактусан, Ливо-лак, Порталак. Кроме того, в этих целях можно использовать вазелиновое масло.

Самым эффективным методом избавления питомца от запоров, а также для предупреждения их, являются клизмы. Они успешно очищают кишечник от затвердевших каловых камней.

Если диагностическое исследование показало, что кишечник собаки заполнен осколками костей, то нередко для их удаления требуется оперативное вмешательство, проводимое под общим наркозом.

Если запоры сопровождаются обильной рвотой и полным отсутствием аппетита, то назначается поддерживающая терапия в виде капельниц, защищающая организм от обезвоживания.

В более осложненных случаях ветеринары могут прибегнуть к ампутации фрагмента толстого кишечника вместе с массами, его наполняющими.

Коррекция питания при запоре

www.medidi.ru

Собака съела кость от свинины

Можно померить температуру, чтобы понять может уже сегодня нужно бежать к ветеринару. Следить за состоянием собаки, рвота понос? ? Желательно дать растительный сорбент. Если есть для животных, типа лигнитина. Если нет-обычный активированный уголь. И на будущее не давайте собаке костей от свинины. Что за питание такое кости, арбуз???

так вы ей уже и так дали то, что не следовало.... ведите к вету

вам сколько лет, стесняюсь спросить... такой текст мог написать только ребенок.. . кости свинные не могут повлиять на поведение.. а вот плохое самочувствие может. собаку не кормить и сходить раза 4 погулять.. так как после костей они часто ходят в туалет.. . если завтра не очухается, то к вету.

Есть вариант что косточка застряла где-нибудь у неё вот и болеет) а то что рычит при кушанье еды то это все собаки так делают) они жадины)

touch.otvet.mail.ru

собака описание породы банхар характер щенки бурят-монгольский волкодав хотошо подходящая кличка

Содержание

  1. История
  2. Особенности породы
  3. Характер и поведение
  4. Уход
  5. Еда
  6. Образование и обучение
  7. подходящих ников

О монгольской овчарке у себя на родине знают все, а за пределами страны об этой породе слышали немногие. Тем не менее, это одна из древнейших пород собак, наделенная многими достоинствами.Это прекрасный пастух, охранник и для каждого человека. Порода еще не признана Международной ассоциацией, но этого не приходится долго ждать благодаря энтузиазму заводчиков.

История

Овчарка Монголии известна под разными именами:

  • банхар - "набитая (богатая) шубка", "пухлый в щеках";
  • хотошо — «дворовый волк», «сторожить двор»;
  • Тибет;
  • Волкодав;
  • монгол;
  • дурбэн ньюдетей хара нохой - Четырехглазый пёс;
  • бавгар — как медведь;
  • Гуннская собака.

Порода существует более 14000 лет. Считается, что древняя порода собак намного здоровее физически и наделена высоким интеллектом, лучшей приспособляемостью и рядом рабочих свойств. Монгольский бархан не зря считается одной из древнейших пород собак. Все эти имена хорошо отражают внешность овчарки.

Монгольское хотошо веками использовалось во всех сферах жизни. Их выращивали, отбирали, просеивали и дрессировали.Четвероногие друзья очень высоко ценятся, а с процветанием буддизма в Монголии овчарки и вовсе стали прославляться как священные животные. Воспитанием банхара занимаются монгольские кинологи - каючи, непревзойденные мастера дрессировки. Во время вылазок на охоту они могут одновременно управлять сотнями собак.

В Монголии кроме банхара существуют четыре национальные породы: уземчи, борзая тейга-нохой и шарайд. Любой представитель этих пород может быть пастухом, а вот банхар - очень самостоятельным и надежным.до сих пор монголы развивают скотоводство как ценный сельскохозяйственный сектор, имеющий большое значение для местного населения. Таким образом, исходные собаки остались стандартными.

В древности монгольские волкодавы использовались для охоты, выслеживания скота и охраны имущества. Эта порода всегда считалась культовой и даже священной в Монголии. Монголы считают, что в дюнах течет кровь пяти волков, и это исконная тибетская догама.

Но путать с тибетским мастифом не надо!

Местное население Монголии считает, что банхары умеют молиться о благословении для своих хозяев. Даже собаку называют молитвой.

К сожалению, в 80-х гг. прошлого века чистокровных представителей монгольского хотошо фактически не осталось. Порода перешла в статус редкой, и была вероятность, что она полностью исчезнет. И если в 1932 г. банхар с честью служил в сибирском НКВД, а в 1937 г. завоевал медали и почетные места на выставке собак служебных пород, то в 1940 г. породу было приказано уничтожить.

Решение их расстрелять было принято на основании ошибочных выводов ученых.Академики рассказали об опасности банхаров как переносчиков тяжелых заболеваний для человека. Когда не удалось доказать, что это неправда, банхара уже уничтожили.

В Бурятии редкой породой заинтересовались два заводчика - Марика Терегулова и Николай Бахт. Они начали разведение породы и дали ей имя хотошо. Произошло это на закате 80-х годов и началось с того, что Н.Бахт отправился в экспедицию в Монголию. Заводчики собирают абсолютно все сведения о породе, черпая их из легенд, раскопок и буддийских документов.На основе полученной информации и был разработан необходимый стандарт породы. На радость заводчикам собака стала национальным достоянием России.

В марте 2000 года бурят-монгольский волкодав попал на почетную страницу племенной книги Российской Федерации. Через шесть лет собаку зарегистрировали в РКФ. Монгольская овчарка как домашнее животное получила большую популярность в Китае, Южной Корее и Японии. Говорят, что ее присутствие в доме сулит достаток.

Особенности породы

Габаритные размеры банхара довольно крупные - среднего роста или выше среднего по телосложению собака очень плотная и сильная, с хорошо развитой мускулатурой. Животное достигает веса 30 кг и более. Нижний показатель в росте у кобелей стандарта - 60 см, у сук - на 5 см ниже.

Кобели этой породы крупнее и массивнее сук. Голова овчарки продолговатая, пропорциональная, черепная часть широкая. Хорошо развиты скулы, а холм на спине плавно сглажен.

На лбу имеется широкая глубина борозды. Морда фактически тупая на конце, к основанию симметричная, широкая. Сверху он имеет форму трапециевидного клина.

Особенностью является вздутие морды. Нос у банхара аккуратный, небольшого размера, треугольный. Нижняя челюсть банхара массивная и широкая. Спрятан за плотными, довольно сухими губами, имеет складку в уголке.

Стандарт

предполагает висячие треугольные уши, посаженные на линии глаз или чуть ниже их уровня. Овальные глаза косо посажены широко.Они выразительные, темные, располагаются под сухими веками. Зрачки настолько малы, что свет сводится к точке.

Зубы банхара белые, крупного размера. Челюсти имеют прямой и очень плотный прикус. Шея низко посажена, сильная, сильная. Грудная клетка развернута широко. Окончательно формируется к трем годам.

Банхар живот подтянут, спина ровная и прямая, поясница слегка выпуклая. Круп слегка наклонный. Передние ноги широко расставлены, их высота составляет 60% от общей высоты собаки.

Задние ноги банхара прямые и поставлены чуть шире передних. Толстый хвост имеет высокий ворот. Возбужденная собака бросает его на спину, поворачивая кольцо, а в состоянии покоя хвост свободно опускается.

Стандартный окрас описания: черно-подпалый, рыжий и чисто черный. В любом варианте окраса на грудном банхаре обязательно имеется отчетливое белое пятно. Шерсть черных собак характеризуется рыжевато-коричневым оттенком.

Еще одна особенность уникального волкодава – «точки» в виде дополнительных бликов на шерсти вокруг глаз.

В этой особой породе монгольский пух. Это волосы очень мягкой и тонкой структуры, светло-пепельного оттенка или серо-бежевого оттенка. Во время линьки до банхара можно счесать до 1 кг.

Вещи из этого пуха отличает хорошая носкость и малая склонность к скатыванию. Вещи после стирки становятся более пышными и не теряют прочности. Кроме того, они обладают лечебными свойствами и могут способствовать лечению заболеваний опорно-двигательного аппарата.

Пух не пахнет, поэтому порода рекомендуется даже владельцам с аллергией.

Шерсть этих собак гладкая, с приятным блеском, практически без запаха, плотно прилегает к телу. Текстура покровного волоса плотная, жесткая, тонкая и гладкая. Пуховые волосы отличаются густотой и более светлым оттенком. Шерсть имеет свойство впитывать запах места жительства. Это помогает маскировать банхара во время охоты — другие животные его никогда не учуют.

Щенки по мере роста практически не меняют структуру шерсти. На шее и плечах покрыта длинной и похожей на гриву.Буксировка и находятся на задней части ног. Хорошо заметны отросшие побеги на ушах, между пальцами, на боковых частях ног и на хвосте.

Длина шерсти монгольского волкодава различается в зависимости от региона. Чем севернее, тем больше длина шерсти у собак. Считается, что эта структура не имеет покрова ни над одной породой.

Характер и поведение

По темпераменту банхар - довольно флегматичная и уравновешенная собака.Овчарка бдительна и не лишена ума. Она дружелюбна к семье и проявляет подозрительность и агрессию по отношению к недружелюбно настроенным людям.

Сохраняет уверенность банхара . представители породы самодостаточны, но не доминируют. У них ярко выраженные коммуникативные способности. Эти стайные собаки прекрасно подчиняются иерархии и чувствуют себя комфортно среди соплеменников.

К малышам банхары всегда очень терпеливы и дорожат ими. Спокойно принимает скот и домашних животных, оберегает их, а также других членов принимающей семьи.Проблемы с пониманием возникают только при проживании рядом других однополых собак.

Собак этой породы часто можно встретить у храмов на их родине. Собаки, проживающие при монгольских буддийских монастырях, отличаются контактностью и добрым нравом, а пастухи-спутники часто проявляют свирепость и нелюдимый характер. Особо агрессивные особи были отмечены перед шеей красными нарукавными повязками. Они сигнализировали незнакомым людям, что приближаться к собакам опасно.

Но в принципе банхары никогда не оставляют человека без уважительной причины.

В Монголии существует множество ролей крупных овчарок: пастух, защитник стада, охранник дома и имущества, егерь и охотник на добычу разных размеров, телохранитель. Это также ездовая (гужевая) собака, наделенная интеллектом. Ей не требовалась помощь и человеческая поддержка для наведения порядка в стае.

Банхар сопровождает стадных животных на пастбище и водопое, не допуская смешивания с другими стадами. Они могут самостоятельно определить район охраны и пункт наблюдения за скотом.Во время работы собаки ведут себя спокойно и уверенно, редко устраивают «переговоры» с коллегами.

Ночью «монголы» в основном бодрствуют, а днем ​​спят в офисе, но чутко, неусыпно охраняют свой очаг и жилище. Такое поведение демонстрируют даже неопытные подростки. Увидев незнакомца, молодые собаки сразу бросаются ему навстречу, а миссия более опытных собак — остаться с объектом охраны. После того, как они подключаются к злоумышленнику в случае необходимости. Банхар характерен боевым приемом: захватом дула противника изо рта до удушения.

Уход

Волкодавы - категорически не подходят для содержания вида в квартире. Собаки способны приспособиться к жизни в пределах частного дома с собственным подворьем. Оптимальным для этой породы считается проживание на ферме. Большую часть дня собака гуляет по карте. В Монголии было принято решение поместить овчарку в изолированные клетки.

При необходимости ограничить их движение, банхары надевают на цепи на расстоянии, достаточном для того, чтобы они не доставали друг друга.

Будка

Банхар должна располагаться на высоте около 25 см от земли. Оптимальный размер собачьего укрытия - 100х200х200 см. Крышу нужно делать плоской с небольшим уклоном, для собак, соблюдающих удобство для окружения собственного жилища. Вход в кабину с юга, задний — с севера, что создает дополнительную толщину ДВП.

Собачья будка не утеплена во избежание создания внутри теплицы вредного и даже губительного для здоровья человека.

Внутрь будки не вносили никакого мусора типа тряпок старой шубы из меха или овчины. Они не нуждаются в качестве тепла, скорее, они способствуют накоплению грязи и шерсти, а значит паразитов. Банхару необходимо дать очень хорошее упражнение. Им важно не только работать, но и регулярно выходить на прогулку, имея возможность резвиться с другими собаками, купаться и охотиться.

На многих фото банхар густо покрыт множественными колтунами: на ушах, в области шеи и на хвосте.Это говорит о том, что хозяевам лень вычесывать питомцев. Но тут дело не в лени хозяев, просто лучшие маты – это собаки, защищенные от укусов хищника своего рода толстым шерстяным щитом. Специальными шампунями монголы своих пастухов никогда не моют, ухаживать за собаками не принято.

Они купаются в водах теплой погоды.

Еда

Пищеварение монгольских овчарок больше приспособлено к перевариванию натуральной пищи, но позволяет кормить собаку и качественными готовыми сухими кормами.Меню подбирается в зависимости от возраста, размера животного, его физиологического состояния. Основной рацион щенков младше 4 месяцев жизни составляют кисломолочка, каши из круп, мясных продуктов, овощей и растительных масел.

Яйца дают по правилам: 1-2 раза в неделю. Белок вводят в рацион через 4 месяца.

В фазе активного роста собак обязательно нужен витаминно-минеральный комплекс, подобранный ветеринарным врачом индивидуально. Банхар 11-15 месяцев кормят два раза в день. На ночь кладут мясо в количестве 500 г, два раза в неделю дают по 200 г творога. После года кормление только одно - вечером. Периодически овчаркам этой породы полезно проводить разгрузочный день, следя за тем, чтобы чистая вода в достаточном количестве находилась в собачьей миске. Кроме воды в этот день собакам не полагалось.

Образование и обучение

Свободу-гордого банхара нужно воспитывать с первых дней пребывания в доме.Очень важно, чтобы собака с самого начала знала, кто в доме хозяин, и росла послушной ему.

В принципе, хозяева могут начать дрессировку и позже, когда щенок подрастет и намочит ноги. Тренировать банхара можно и даже рекомендуется игровыми методами. Для этой породы не будет использоваться стандартная схема DCD для тренировки условных рефлексов или американский стандарт IPO 1-2-3. Все потому, что у волкодавов хорошие мысли и от природы ум, они способны принять решение и занять нужную позицию в сложной ситуации.

Собаки живут, чтобы заботиться о тех, кто находится в их стае.

Четырехлапых для «Монгола» характерно особое поведение, которое владельцы должны уметь понять и принять. Поймите, заводчики не отдают банхара в руки тем людям, которые ранее держали кавказцев, внушая страх и психологическое давление на самостоятельную собаку. С пользой собака будет участвовать в разных сферах жизни хозяев. Это и поездка на море, и поход по магазинам, и ежедневные пробежки. Ему необходимо постоянное общение с людьми и другими животными.

подходящие ники

Ознакомившись с основами воспитания и тонкостями ухода за монгольской овчаркой, стоит приобрести щенка и назвать его. Если вы купили девушку, то можете подобрать что-то из популярных вариантов: Алан Шоола, Эртеки, Салаши, Жандов, Оила, Пэт, Фатих, Хойн, Жалдыз, Мапа, Геза или придумать свое имя. Решать в любом случае только собственникам.

Конечно, если собака не взята из питомника имеет кличку в документах.

Маленький кобелёк однажды станет большим, сильным, красивым и гордым банхаром. поэтому даже если очень хочется, не давайте ему милых и смешных прозвищ. Он должен отвечать на какое-то особое имя. Например, собака может быть упомянута ДАВЛАТОВ, Ильхан, Хал, улуг, Чикишев, Эль, Шамолов, Тезом, Якин, Талапов, Севмоком, батыров Адылов, НУКЕР, Аджархом. Или придумать что-то подобное, но непременно звучное и величественное.

Подробнее о монгольских овчарках можно узнать из следующего видео.

Собака Банхар | Проект монгольской собаки банхар

Собака банхар

Исторически Банхар был неотъемлемой частью жизни кочевого скотовода. Традиционное приветствие при приближении к монгольскому гер — «Держи свою собаку!»

В Монголии считается, что собаки банхары имеют «один дух» с людьми, а собаки — единственные животные, которым дают имена. Когда банхар умирает, его останки обычно помещают на вершину горы, чтобы он был ближе к богам и духовному миру и чтобы люди не ходили по его костям.Считается, что люди могут перевоплощаться в собак, а собаки в людей. После смерти собаке отрезают хвост, чтобы, если ее дух возродится человеком, у человека не было смущающего хвоста!

Собаки были и остаются огромным предметом гордости кочевых семей. К сожалению, за последние 80 лет в Монголию были завезены современные породы. Банхары, которые исторически были единственными собаками в Монголии, теперь очень редки.

Банхарские собаки — это древняя местная порода, не порода, а тип собак, сформированный в результате тысячелетней совместной эволюции с людьми, движимой потребностью в эффективном стороже домашнего скота в монгольских степях.Банхар большие, спортивные, защищающие и нуждаются в сравнительно небольшом количестве еды для своего размера. Они прекрасно адаптированы к интенсивным экосистемам Монголии.

Банхар также может быть прародителем всех собак-охранников домашнего скота. Недавние исследования указывают на происхождение домашней собаки из Центральной Азии около 15 000 лет назад. Наши образцы ДНК использовались для подтверждения этой гипотезы, и в статье (доступной здесь) Дуг Лалли был соавтором вместе с профессором Корнельского университета Адамом Бойко, доктором философии, среди прочих.

Что случилось с Банхаром?

Килгор — один из наших молодых самцов в нашем питомнике. Показывает большие надежды с овцами. Высокий и спортивный (более 31 дюйма) в 1,5 года.

В коммунистическую эпоху Монголии, длившуюся с 1920-х по 1990-е годы, когда Монголия была государством-сателлитом Советского Союза, собак банхар выпускали на волю или истребляли, когда кочевников насильно переселяли в поселения социалистического типа. Кроме того, собаки Банхар стали мишенью из-за ошибочного представления о том, что собаки передают болезни людям и домашнему скоту.Шкуры банхара стали модными для стильных русских шуб, а самых крупных собак убивали, чтобы прокормить растущую индустрию шуб для собак.
В целом советская коммунистическая система образования привела к потере знаний о том, как разводить, дрессировать и использовать собак для защиты скота.

Нынешняя опасность для населения Банхара - скрещивание с модным тибетским мастифом. Мастифы генетически отличаются от банхаров и не являются рабочими собаками. Гены смешанных мастифов в генофонде банхаров ухудшили качество генов рабочих собак банхаров. Настоящих собак банхаров осталось немного. Монгольский проект по изучению собак банхаров идентифицировал их с помощью анализа ДНК и изолировал этих собак для разведения следующего поколения настоящих рабочих собак-охранников банхаров.

О собаках для защиты скота

Собаки для защиты домашнего скота (LPD) использовались людьми на протяжении тысячелетий для защиты стад домашнего скота и коз от хищников. Эффективность LPD в снижении хищничества скота хорошо задокументирована на каждом континенте.

В настоящее время более 50% овцеводов на западе США используют собак для защиты скота в рамках своих программ управления.

Что такое Ландрас?

Банхар, как и многие другие собаки-хранители домашнего скота в Азии и Европе, — это не порода, а «ландрас». Местная раса — это одомашненный вид животных, который развивался с течением времени в естественной и культурной среде и в данном случае адаптировался к местным сельскохозяйственным и пастбищным условиям под руководством кочевников-скотоводов. Это важное отличие от слова «порода». Собаки банхар развивались и эволюционировали вместе с людьми, чтобы соответствовать очень конкретной нише. Причина, по которой собака банхар выглядит и ведет себя так, заключается в том, чтобы максимизировать ее эффективность и результативность в качестве рабочего животного для защиты скота.

Это означает, что на казахстанских банхаров будет больше влияний казахстанских собак (это всего лишь естественные региональные вариации среднеазиатской овчарки, не путать с одноименной современной выставочной породой).То же самое относится и к тибетским собакам-хранителям домашнего скота. Именно этот континуум признаков и непрерывный поток генов поддерживает высокое генетическое разнообразие. Высокое генетическое разнообразие гарантирует, что собаки способны эффективно адаптироваться к изменениям или ролям, а также помогает избежать экспрессии вредных рецессивных генов в популяции или у отдельного человека.

Наша политика заключается в том, чтобы избегать обозначения банхар как породы и не проводить существенного отличия ее от других форм больших ландрасов собак от Испании до Монголии. Мы считаем важным, чтобы наши собаки представляли собой естественно эволюционировавшие вариации банхаров, обитающих в Монголии. Мы используем анализ ДНК, чтобы убедиться, что наши собаки не имеют генов современных пород собак. Однако мы не отличаем гены от «соседних» естественных типов собак, поскольку эти гены всегда входили и выходили из генетического состава банхаров.

Описание:

Высота: самки 26-29 дюймов в холке и кобели 28-33 дюймов в плече

Вес: самки 80-90 фунтов, самцы 85-125 фунтов

Окрасы: возможны все окрасы шерсти, но белый встречается редко.Чаще всего встречается черный и красное дерево с пятнами красного дерева над глазами и белым пятном на груди (эта окраска известна как монгольская четырехглазая собака), но также распространены рыжевато-коричневые, черно-белые. Монголы традиционно любят более темных «четырехглазых» собак, поскольку они помогают им отличить своих собак от волков. Также считается, что «дополнительные» глаза смотрят в духовный мир.

Шерсть: Зимой шерсть банхаров очень пышная и длинная (3-4 дюйма или около 9 сантиметров) с очень густым подшерстком.Однако из-за обширности Монголии и изменчивости климата банхары, по-видимому, пластично реагируют на климатические условия и не имеют такой густой шерсти в более теплых регионах. Это, конечно, относительно, так как Монголия является одним из самых холодных мест на земле с температурой от 110°F до -55°F (от 43°C до -48°C) со среднегодовым значением 31°F (-1°C). ).

Общий:

Эти собаки легче сложены и более атлетичны, чем их близкие родственники тибетский мастиф или среднеазиатская овчарка.Анализ ДНК, проведенный Корнельским университетом, показывает, что у банхаров очень высокое генетическое разнообразие (это связано с более примитивным геномом и большим потоком генов между региональными «расами» местных сортов по сравнению с уменьшенным генетическим разнообразием стандартизированной породы).

Банхар сравнительно долгоживущие. Примеры 15-18-летних собак, работающих с кочевниками в полевых условиях, не редкость — это представляет интерес, поскольку большинство банхаров никогда не получают ветеринарную помощь и питаются исключительно вареными внутренностями домашнего скота, рисом или лапшой и костями.

Заболевания костей, такие как дисплазия тазобедренного сустава, встречаются очень редко. Это может быть артефактом выживания; если бы у собаки были такие проблемы, она бы не выжила в Монголии. Однако мы не получили никаких сообщений от кочевников, когда-либо сталкивавшихся с проблемами, которые можно было бы объяснить заболеванием костей.

Наш опыт и данные показывают, что банхар размножается один раз в год в Монголии (одной из самых холодных стран мира). Возможно, в менее враждебном климате они будут размножаться чаще — мы просто не знаем.

Темперамент:

Банхар, как и большинство собак-охранников скота, имеют независимый характер и склонны думать самостоятельно. Они очень лояльны к своим подопечным и защищают их ценой своей жизни. Они, как правило, не являются собаками, которые преследуют хищников на огромных расстояниях, но они без колебаний нападут на хищников, если хищник не отступит или немедленно не покинет территорию.

Банхары не очень агрессивны по отношению к людям, если их не воспитывать. После появления рабочий банхар обычно игнорирует человека и возвращается к своей работе по защите.Банхар не подпустит людей к своим подопечным, если их не сопровождает человек, которому собака доверяет. Хорошо воспитанные и социализированные с людьми, банхары, как и любая другая домашняя собака, заслуживают доверия и являются частью общества.

Мне нравится

Кто такие "ХОТТОШО"?.Свято-Троицкий Ново-Голутвин женский монастырь.

Кто такие "Хоттошо"?

 

На «Евразии-2005» собаки неизвестной породы привлекли внимание всех внимание. Название породы «хоттошо-банхар». «Хоттошо» по-бурятски означает «домашний волк», а «банкхаар» в переводе с монгольского означает «лохматый». Что все это значит? Еще одна «древняя» новая порода, восстановленная по описаниям и фотографии методом репродуктивного скрещивания собак разных пород похожий на желанную породу, или забытый "реликт", со временем нашедший себя в области «цивилизованной» кинологии? В кольцах "Евразия" красное хоттошо смешали с леонбергерами, черных - с ньюфаундлендами, а чернопаленных кто-то принял за ховавартов или Zenenhounds, но когда на ринге появились собаки, недоумение исчезло, и все вопросы были решены – мы увидели породная порода собак, которые отлично двигались, эти собаки, пожалуй, скорее похожи, по сравнению с современными "азиатами", которые, порой, похожи друг на друга только купированными ушами и хвостом.

Давайте поговорим об истории этой породы. В советское время в довоенных книг по кинологии и отчетов о выставках служебных собак было упоминания о «монгольских овчарках». Последняя выставка, где еще можно было см. «Монголы» прошла XI Всесоюзная выставка служебного собаководства, проводимая ОСОАВИАХИМ СССР 23-25 ​​августа 1935 г. По данным кинологов Ю.М.Пищиков и А.П.Мазовер, в послевоенные годы монгольские овчарки были сосредоточены в Семипалатинской области, куда они были завезены кочевниками пастухи - монгольские араты в годы Великой Отечественной войны.В своей книге «Наши друг» (Пильщиков, Мазовер; Алма-Ата, 1973) описание этих собак данный. Бурятско-монгольских собак в Туве называют «кадырчыыт» - пастух. собака, в Монголии — «хоточ нохой» — четырехглазая собака. Их также называли собака хунну - по имени древнего великого народа хунну, кочевавшего по степи Юго-Восточной Сибири, Бурятии и Монголии в период примерно с 300 г. до н.э. по 300 г. н.э. Этносы исчезают или смешиваются с другими этносами, но собаки остаются, и смотрят на нас таинственно из глубины тысячелетий, как будто хотел сообщить нам что-то важное… (фото 1, 2, 3, 4, 5).

В 1980 году энтузиасты из Улан-Удэ вывезли несколько аборигенные собаки из некоторых неясных районов Читинской области и Монголии и начали работать с этой породой, периодически скрещивая их с "Аборигены" недавно завезенные из Монголии. Николай Батов и Марика Терегулова заявили их в Российской Кинологической Федерации (РКФ) как существующую породу. 18 апреля 2000 года на заседании Племенной комиссии РКФ была утверждена родословная. порода собак была зарегистрирована под общим названием бурят-монгольская волкодав (БМВ).Улан-Удэ также работал параллельно с Москвой. Другие любители "античности" - Захаров-Гезехус Илья Артемьевич - д.б.н., профессор, член-корреспондент РАН, директор ИОГенРАН вместе со старшим научным сотрудником С.Н.Каштановым, привезенным из Тувы и Алтая, где принимали участие в научной экспедиции, аборигенных собак, отличавшихся от "бурятской" породы немного, только более легкий тип телосложения. Зарегистрировали собак в Союзе кинологических организаций России. (UCOR) под названием тувинская овчарка кадырчыт.

Собак также вывозят в Калмыкию, где аборигены кинологи взялись за возрождение вымершей калмыцкой овчарки, и для этой цели они используют собак, завезенных ими из Монголии.

Кстати, собак осталось очень мало в местах их традиционного проживания (Тува и Алтай в приграничных с Монголией районах, некоторые невнятные районы Читинской области), и нечастые рассказы о них можно слышали от участников научных экспедиций, туристов и пограничников.В Монголии собак больше, но, к сожалению, монгольские кинологи кажутся пока не заинтересован в сохранении породы.

В Бурятии была ликвидирована популяция около 40 собак. выработан за 15 лет работы с породой. Они представлены на выставках в г. Улан-Удэ и Чита. Восемь лет назад в Москву привезли собак из Бурятии. Евгения Маныкина стала первым продюсером Хоттошо в Москве. Есть много собак в ее питомнике, и все они охраняют разные объекты. (Фото)

Пять лет назад Марика Терегулова сдала немного Хоттошо собак в питомники "Конвент" и "Гром". В настоящее время в Москве и Московском области имеется популяция из 40 собак, которые регулярно появляются на выставках. основе и в этом году 12 собак разного возраста были представлены на «ЕВРАЗИЯ-2005» впервые.

В октябре 2004 года «Межрегиональный Клуб В Москве была создана организация «Бурят-монгольские собаководы» (МКБС).

В феврале 2005 года комиссия по стандартам РШФ приняла стандарт для этой породной группы.Эта комиссия приняла решение о изменение названия породы с учетом национальных традиций. Настоящее название племенной породы «хоттошо-банхар» (бурятско-монгольское собака)".

Ну и как выглядит хоттошо? Это большой, от 60 до до 80 см высоты в плече, собака с сильным и мощным, но не грубым скелет. У них крупная голова с несколько сглаженным переходом, массивная, но не короткая морда. Висячие уши довольно высоко поставлены. Маленькие глаза поставить достаточно глубоко окрашены от янтарного до темно-коричневого, однако встречаются желтоглазые собаки, и это не вина.Отличительная черта: иногда желтоглазые 4-месячные щенки к одному году становятся темноглазыми. Шерсть грубая, длинная; может быть также промежуточный тип шерсти. Окраска подавляющего большинства черно-палевый или вороной, но также много рыжих или рыжеватых собак, а также бледно-желтый с черной маской. Редко можно встретить зонаро-серо-палевых собак. Щенки могут часто менять свою окраску таким непредсказуемым образом, что невозможно указать их окраску в карте щенков. Может кардинально измениться из коричневого в рыжий или соболиный к 10-месячному возрасту; или из черного в опаленный или зональный.Кстати, это явление характерно для многих пород аборигенных горные собаки, лайки и борзые. По общему впечатлению хоттошо скорее молоссы, чем лайкоиды, точно так же, как чау-чау более лайкоидны, чем молоссы. Очевидно, что эти породы развивались параллельно и, вероятно, в в разные исторические периоды они пересекались друг с другом. Как и любой аборигенной породы, хоттошо не представляют собой некую однородную массу.

Популяция собак велика, а породные типы варьируются от почти типа лайки-овчарки на бореальных границах обитания до типичных прамолосс на юго-востоке (предгорья Тибета).Судя по всему, породная порода бурят-монгольские собаки — тип очень древней среднеазиатской пастушеско-сторожевая порода, являвшаяся реликтовой и прародительницей многих современных пород овчарок, хаски и молоссов. Историки указывают на восточную и Юго-Восточная Азия как родина первых прирученных и одомашненных собак… (фото 1, 2, 3, 4, 5, 6)

А теперь зададим главный вопрос, который задает человек глядя на собаку и желая приобрести ее. Каков его характер и что это такое способен?

Бурят-монгольская собака всегда использовалась кочевниками в качестве пастушеско-сторожевая, ездовая и травильная собака.Немигрирующие народы использовали его как сторожевая и охотничья собака. Собаки занимаются одним и тем же ремеслом до сих пор. настоящее время. Тувинцам помогают травить яков, монголам – коров, овец и лошадей. И сегодня в Монголии с этими собаками охотятся практически на всех видов зверя. На охоте собаки выполняют обязанности как лайки, так и гончей. В 1920-е годы в нашей страны монгольские овчарки использовались для охраны юго-восточных рубежей Государственная граница и специальные объекты на Дальнем Востоке. Пограничники подчеркнули высокую злобу собаки.

Сегодня хоттошо работают по патрулированию подворий и некоторых спец. объектов, они также успешно эксплуатируются МЧС, а также как травяной скот в подмосковных хозяйствах. Оставаясь настоящим многоцелевым рабочая собака с ярко выраженным территориальным инстинктом, хоттошо проявляет удивительная склонность к послушному поведению и похож на немецкого овчарка по степени прилипчивости к хозяину, хотя ближайший соседи - "кавказцы" и "азиаты".(Фото 1, 2,)

Внимание к аборигенным породам домашних животных, усилия по их сохранению является одной из глобальных тенденций во всем мире, по сути, они являются живым культурным наследием человечества. Программы национальных пород сохранения поддерживаются как государственными структурами, так и официальными кинологических организаций во всех передовых странах. Так почему мы ценим иностранный, «заморский», больше, чем наш, родной?! Не пора ли вспомнить что еще можно спасти вятских и месенских пород лошадей, пород бореальных аборигенных лаек, бурят-монгольской собаки и других бесценных пород домашних животных, служивших людям тысячи лет и вдруг стал незаслуженно забытым!

В питомнике "КОНВЕНТ" есть щенки бурят-монгольской собака хоттошо.

Информация по телефону: 8-916-789-23-32

Монгольская овчарка

Сейчас в мире насчитывается более пятисот пород собак, многие из которых выведены человеком относительно недавно. Практика подтверждает, что представители более древней породы всегда обладают лучшей жизненной приспособляемостью, а среди других своих сородичей отличаются высоким интеллектом и здоровой физиологией. Все это в полной мере относится к баньши, которые вот уже почти 14 тысяч лет верно сопровождают пастухов, помогая им пасти свои стада на огромных монгольских равнинах.

История монгольской овчарки

Эти собаки считаются предками среднеазиатских и кавказских овчарок, но мало связаны с тувинской овчаркой и бурят-монгольским волкодавом. Местное название этой породы – монгольский банхар, что означает пухлощекие или богатые пухом. Реже этих собак на родине называют Баавгаи (медвежьи), что визуально характеризует своеобразие этой древней породы.Изображения монгольской собаки Банхар можно встретить на надгробиях, петроглифах, на образцах религиозной живописи. Ходят легенды, повествующие о том, как в Монголии появилась порода собак Банхар. Предание гласит, что один паломник вернулся из Тибета вместе с белогрудым псом-компаньоном, который своей второй парой глаз мог видеть страшную нечисть.

Привычка некоторых собак этой породы засыпать сидя с открытыми глазами привела к появлению у местных жителей веры в то, что они молятся богам за своих хозяев.Они даже желают, чтобы их мертвые питомцы вернулись в Тибет и переродились там людьми. И убийство собаки в этих краях всегда не было благотворительной деятельностью, и даже древние законы защищали их от посягательств злых рук, чего нет ни в одной другой стране мира.

Описание породы монгольская овчарка

Шерсть челки можно сравнить с мехом соболя или морского котика, такая блестящая и красивая. Кончик хвоста украшен кисточкой из грубого «конского волоса», которая длиннее каркаса.Такого орнамента вы больше нигде не найдете – это характерная черта только монгольской овчарки. Вообще шерсть — это тема для особого разговора. Где вы увидите 75 процентов пуха в подшерстке. Такого показателя не удостоился ни один из представителей млекопитающих нашей планеты.

Встречаются монгольские овчарки трех окрасов - черноподпалый очкарик, черный очкарик и гораздо реже можно встретить чисто рыжую банхару. Все они имеют наследственное белое пятно на груди.Рыжевато-коричневый отлив на своей черной шерсти, по мнению большинства специалистов, эти собаки получили от своих диких предков — рыжих волков, населяющих Среднюю Азию. Густая шерсть у самцов достигает в длину 15 см, а на голове и шее образует своеобразную гриву.

Представители монгольской овчарки имеют средний или выше среднего рост, плотную мускулатуру. Кобели обычно крупнее сук. Нижняя граница роста суки – 55 см, кобеля – 60 см. Голова бангара массивная с широким черепом.Особенность их морды в том, что она имеет припухлость за счет увеличенной жировой прослойки, что способствует сохранению тепла и предохраняет от перегрева носовые пазухи. Уши маленькие, треугольной формы и низко посажены.

Собаки этой породы прошли хорошую закалку в суровых условиях Великой степи, отлично справляются с хищниками, защищая от них стада. Даже в отсутствие своего хозяина они могут пасти домашний скот и охотиться на зверя. Пожалуй, только эта порода собак обладает таким же стайным интеллектом и чувством организованной команды, как и их главные противники - волки.Все, кто имел с ними дело, поражались верностью запретов, управляемостью и хорошим интеллектом. По своей натуре они больше похожи на флегматиков, в любой ситуации стараются выглядеть крутыми и крутыми. В последнее время возник интерес к этой породе, и все чаще можно встретить объявления о продаже щенков монгольской овчарки, что дает возможность увидеть красавиц банхаров не только на фото или видео, но и вживую. .

Custom Собака - настоящий друг человека.Футболка для малышей Lovely Red Puppy Buryat Монгольская собака от Kemnabi

Стандартные условия покупки/возврата продукта на Artist Shot

Предложения, предлагаемые на Artist Shot и в магазинах-партнерах на веб-сайте, служат необязательным запросом клиента на покупку заказа в Artist Shot.

Заполняя заявку на заказ и отправляя запрос на покупку «продукта» на сайте Artist Shot, покупатель делает обязывающее предложение о заключении договора купли-продажи контентного продукта, предлагаемого на сайте.Затем покупатель получит электронное письмо с подтверждением заказа. Это электронное письмо подтверждает и только информирует покупателя о том, что его заказ был получен Artist Shot, и не предполагает одобрения предложения. Контракт принимается и становится активным только тогда, когда Artist Shot отправляет заказанный продукт покупателю и подтверждает отправку продукта покупателю во втором электронном письме.

Договор считается расторгнутым при полной доставке по адресу, указанному покупателем для Artist Shot.Artist Shot попытается заменить продукт идентичной замещающей сделкой, если произойдет какое-либо нарушение доставки продукта. Если Artist Shot не включает недоступный продукт в установленные сроки, покупатель должен быть немедленно проинформирован о недоступности продукта и услуги. Если покупатель уже произвел оплату, платеж подлежит возврату.

Artist Shot оставляет за собой право отклонить любые заказы по любой причине с уведомлением клиента.Artist Shot также может отменить заказ, если считается, что он нарушает настоящее соглашение или нарушает права любого лица или любого закона. Заказ на купленный продукт может быть отменен, даже если он был подтвержден и покупатель произвел оплату. Мы сохраняем это право до тех пор, пока клиент не получит заказанный товар. Если такое аннулирование происходит после того, как клиент произвел оплату продукта, взимаемая сумма будет возвращена обратно на счет клиента.

Покупатели/Пользователи могут приобретать товары на веб-сайте Artist Shot, используя действующую кредитную карту или систему PayPal, и им не обязательно быть участником, чтобы приобрести продукт.Цена приобретаемого товара фиксируется на момент оформления заказа. Стоимость товара взимается в момент оформления заказа.

Artist Shot имеет право полагаться на надежные сторонние службы для обработки платежа. В случае просрочки платежа со стороны заказчика, Artist Shot имеет право передать претензии агентству по взысканию долгов вместе с личной информацией, необходимой для обработки платежей, третьим лицам.

Покупатели/пользователи/клиенты обязаны предоставить правильный адрес доставки. Artist Shot не несет ответственности за любой продукт, который клиент не получил из-за неправильного адреса, указанного для отправки в Artist Shot.

Вы не можете отменить заказ после того, как он был отправлен, если не указано иное. Как только начинается печать продукта, отмена не может быть выполнена. Заказы поступают в процесс печати уже в тот же день или на следующий рабочий день после размещения заказа на веб-сайте.

Отмена заказов до начала печати может быть произведена с уплатой сбора за отмену до пятнадцати процентов (15%) от общей суммы заказа.Пятнадцатипроцентный сбор за отмену включает в себя расходы, связанные с подготовкой заказа, включая обработку художественных работ, допечатную подготовку и расходы на подготовку материалов. Заказы обрабатываются уже через несколько минут после их размещения на Artist Shot.

Возврат или обмен после того, как заказ был напечатан и/или отправлен, невозможен ни при каких обстоятельствах. Как только покупатель получает купленный товар с нашего веб-сайта, а полученный товар не соответствует заказанному товару или физически поврежден из-за ошибки с нашей стороны или продавцов, Artist Shot свяжется с продавцом, чтобы решить вопрос о замене товара. после получения разумных доказательств вопроса от покупателя.Если вы получили поврежденный продукт, вы должны связаться со службой поддержки Artist Shot в течение 14 дней с момента получения, чтобы сообщить характер повреждения и организовать бесплатную отправку вам нового продукта.

Покупатели/клиенты должны знать, что опубликованные продавцом продукты регулируются и контролируются продавцом, а Artist Shot не проверяет весь контент на веб-сайте. Поэтому обязанностью клиентов является проверка качества контента, включая, помимо прочего, грамматические ошибки, опечатки в словах или наличие продукта в целом перед совершением покупки.Политика Exchange не применяется к содержимому, а только к физическому продукту.

Вы понимаете, что даже несмотря на то, что у нас есть законные предупреждения в отношении продуктов на нашем веб-сайте, контент может быть размещен с неверной ценой или информацией или может отсутствовать. Вы понимаете и признаете, что мы не можем выполнить заказ, в котором существует такая ошибка, и настоящим сообщаете нам об отмене такого заказа, когда мы можем предпринять другие необходимые действия.

Заказанный товар будет доставлен по адресу, указанному покупателем, поставщиком почтовых/доставочных услуг, выбранным Artist Shot, и будет оплачен покупателем во время покупки.Стоимость доставки будет варьироваться в зависимости от размера, веса, цены и места доставки заказанного товара. Заказанный товар будет отправлен в течение нескольких дней. В зависимости от места доставки время прибытия заказанного товара может варьироваться. Доставка доступна в США и других странах мира.

Кроме того, вы уполномочиваете Artist Shot выбрасывать и утилизировать любые продукты, которые становятся излишними из-за возмещения, перепечатки, мошенничества, образцов продукции или рекламных мероприятий любым способом.

мировой голос: монгольская собака


В мире насчитывается более 500 пород собак, и хотя вкусы различаются, собаки ранее сформированной породы оказываются более умными, физически крепкими и обладают лучшей приспособляемостью. Кроме того, спектр конкретных достоинств шире.
В этой статье рассказывается о монгольской овчарке. Возраст породы около 14 тысяч лет. Почти в каждой книге или статье по собаководству в России монгольская овчарка упоминается как предок как среднеазиатской, так и кавказской овчарки.И часто в единственном экземпляре журнала Мальгинова «Собаководство» (№2, 1932 г.) упоминается его уникальное описание, которое вне всякого сомнения принимается за единственный эталон.
По моему личному мнению, монгольская овчарка — это совершенство в мире собак. Впервые я увидел его в Верхайгальском аймаке в 80-х годах 20 века. Это было время, когда пастухи могли позволить себе иметь десять и более великолепных монгольских собак. Их местное название банхар бангхар (с пухлыми щеками и богатым пухом), или более древнее и реже употребляемое название баавгай или бавгар (медвежий).
Я остановился у прилавка – так называемого хоттона, чтобы найти какую-нибудь информацию о скоте. Вечером, отдыхая в юрте кочевника, я играл с несколькими щенками нежной яркой монгольской девочки. Люди пустили их, пока шел дождь. Когда снаружи раздался шум из-за волков, собака испугалась. Потом подтолкнула ко мне щенков, как бы прося присмотреть за ними во время работы, и взлетела, как выстрел из ружья. Только неподготовленному человеку может показаться, что в беге собак нет порядка.Возникла реальная угроза, и тут же включился стадный инстинкт. Их взаимодействие является конкурентоспособным и гармоничным. Окружив отару и охраняющий ее шатер, собаки бежали примерно на одинаковые расстояния, чтобы волки не могли найти ляпов. В сумерках бегающие кругом монголы, обращенные к небу и ухмыляющиеся, лающие и воющие хриплым басом, с красными, как горящее пламя, глазами, имели дьявольский вид. Кстати, в монгольской религиозной живописи эти собаки изображены с красно-оранжевыми глазами и тоже похожи на чертей. Изредка в темноте появлялись и исчезали зеленые искры волчьих глаз. Также были слышны короткие бои между собаками и волками. Собаки прогнали волков, но сами стояли на страже, защищая людей и скот.
Прошли годы, и у меня были другие задачи, но мне явно предрекали возвращение в Монголию на поиски. Находясь под впечатлением от статьи Мальгинова (а многие были), я тоже подумал, что в бурятских семьях раньше было по две-три монгольские овчарки.Но потом я разглядел, что для западного человека, как Мальгинов, нет разницы между понятиями «бурят» и «монгол». Но разница между ними есть, и говорят, что разница велика, несмотря на родовую общность. Даже республика в то время именовалась бурят-монгольской автономией.
Я начал искать информацию о монгольской овчарке в библиотеках Улан-Удэ, используя универсальную сеть библиотек России. Затем я изучал историю, краеведение, этнографию, прикладное искусство бурятского народа, его богатый национальный фольклор.Я опросил всех ученых Бурятской сельскохозяйственной академии (БСХА), Бурятского научного центра (БНЦ), но не нашел никаких доказательств существования монгольской овчарки в бурятской культуре, а такое явление имеет под собой серьезные основания. . Существует старинная бурятская легенда о происхождении людей, которая гласит, что люди были презираемы злобным божеством по вине собаки. Легенда прослеживается в менталитете, и собака была проклята навеки. Некоторые ученые говорят, что на территории Бурятии были монгольские собаки.Люди называли их тибетскими. Но все они заявляли, что таких собак редко можно было встретить даже в то время.
Особой «бурятской» породы собак не существовало. Хотя скотоводство имело важное значение, буряты не занимались собаководством. в бурятском языке всего три слова для обозначения собаки: нохой - собака, гульге - щенок и хотоше - дворняга, домашняя собака. Домашней собакой может быть любая беспородная или породистая собака, а в Сибири любая собака, чтобы не мерзнуть зимой.Логической связи между понятием «дворняга» и понятием «порода» в природе нет.
Географическая структура Бурятии сильно отличается от невероятных просторов Великой Степи - Гоби. Поэтому скотоводы-буряты составляли не такие большие стада, примерно в 500 голов. В Монголии количество крупного рогатого скота на отара достигало 4000 голов. Кроме того, в Бурятии более распространено обезжиренное скотоводство, а в Монголии оно носит круглогодичный кочевой характер. Для монгольской овчарки это одна из главных причин иметь несколько собак для отары, тогда как бурятская овчарка могла справиться с этим сама или с помощью одного помощника.
Если в культурном наследии бурят нет слов, обозначающих пастушьих собак, то в культуре монголов очень много сведений о собаках на самом высоком уровне. В словаре монгольского языка слово нохой – собака – имеет 138 значений, которые могут выражать современные представления о собаководстве, селекции. Это единственный язык, в котором есть такое явление. Что это означает? Значит, у монголов богатейшая культура развитого собаководства. Мне кажется, что современное мировое собаководство хуже монгольского! Монгольские специалисты – канючи – умели управлять одновременно сотнями и тысячами собак на охоте! Об этом писал Марко Поло. Затем постепенно утратила свою актуальность сталкинговая охота, а вместе с ней и высочайшее мастерство дрессировки собак. Но язык, петроглифы, легенды и песни, письменные свидетельства современников тех лет все же есть. Но все это касается только Монголии и монголов. Никакой связи с Бурятией и бурятами нет, несмотря на то, что часть их коренные монголы.
Читатель может встретить изображения монгольской овчарки на петроглифах, на надгробных камнях, в декоративно-прикладном искусстве, в скульптуре, в религиозной живописи.О них говорится в легендах, в шаманских рассказах, в улигерных мифах, в поэмах, в уролах – особых рассказах. Они есть в традициях содержания, воспитания и захоронения собак, и даже в государственных законах, защищающих собак. Против убийства собак выступили. Аналогов в других странах нет.
Но позвольте мне перейти к делу. Первые сведения о монгольских овчарках были обнаружены в архивах Русского географического общества (РГО), находившихся в Хранилище восточных рукописей (ХВР). О них упоминали в отчетах путешественников прошлых веков, в китайских летописях, в научных изысканиях археологов. В начале поисков я полагал, что первые собаки "появились в Монголии, откуда они ушли в Тибет и другие стороны. Собранные доказательства привели меня к убеждению, что собаки появились в Тибете и затем распространились по всему миру. Ясно, что нет. только для знатока, что монгольские овчарки очень похожи на тибетских мастифов.
Иркутские археологи в Усть-Хайте обнаружили череп собаки 8300 лет, внешне очень похожий на череп монгольской овчарки.Расхождения весьма незначительны, учитывая восьмитысячелетнюю разницу в возрасте черепов. Получение доказательств того, что хотя бы одна порода имела своего предка, — вопрос времени.
Ученые Шведского королевского технологического института в Стокгольме исследовали ДНК более 500 пород собак со всего мира. Четырехлетние исследования генетики собак включали изучение митохондриальной ДНК. По мнению старшего офицера института Питера Саволяйнена, современные собаки несут в себе гены не менее пяти волков. «Получается, что собаки зародились в Восточной Азии, откуда они расселились по всему миру», — говорит ученый. Ну а центр Восточной Азии - Тибет.
Естественно, погони за монгольской овчаркой привели меня в Монголию. Там любую пастушью собаку называют хонч-нохой (овчарка, от слова хонин - овца). А пасти скот могут все пять национальных монгольских пород собак: банхар, узамчи, таега-нохой, барз-нохой, шараид. А вот банхар лучший по надежности и независимости мышления.
Во многих монгольских легендах прямо говорится, что аборигенная монгольская собака в то время мигрировала из Тибета. Один паломник отправился в Тибет, чтобы поклониться буддийскому божеству Эхе Джуу. Он вернулся с необычным альхумчином (собакой-компаньоном). Это был банхар с белой грудью и «дурвен нудтай», то есть «четырехглазый». Считалось, что они видят злых духов «второй парой глаз» даже во сне. Некоторые банхары имеют привычку сутулиться с закрытыми глазами. Монголы верят, что они молятся за хозяев.Поэтому таких собак в Монголии называют «зуугииннохой» (молитвенная собака), они считаются божественными животными, которых благословил бог Джуу. Давая особое благословение такой мертвой собаке, говорится, что ее дух возродится после возвращения в Тибет: «В следующей жизни родись человеком в стране богов». Значит лама, значит надо было хоронить собаку на вершине снежной горы, головой "лицом" на юг, то есть в Тибет. И хотя современные специалисты по собаководству знают, что наличие 4 глаз является рецессивным генетическим признаком, многие из них все же предпочитают его: это твердая вера в чудо.
Собаки – потомки тибетских собак – скорее всего, распространились по миру вместе с кочевниками Азии, неважно, были ли они скифами, гуннами, тюрками или монголами. Несмотря на прошедшее тысячелетие, потомки тибетских собак - банхаров в основном не изменились: массивная голова, достаточно мощный костяк, врожденные охотничьи и пастушье-сторожевые навыки, а главное - высокий природный интеллект.
Поскольку происхождение от тибетского мастифа свидетельствует о направлении распространения монгольских овчарок с юга (Тибет) на север (Россия), мы берем за основу древнемонгольское название этой собаки — «бавгар», т. е. лохматый, медвежий, что вполне соответствует внешности собаки.Но в современном разговорном языке это имя используется редко. В Монголии эту собаку зовут «банхар», то есть пухлая на щеках или богатая пухом. Это название сегодня более популярно, что исследуется гистологическими исследованиями.
Итак, имя:
- МОНГОЛЬСКАЯ ОВЧАРКА – бавгар или банхар.
В чем разница между монгольской овчаркой и тибетским мастифом?
  • Все млекопитающие Тибета обладают общими признаками приспособленности к резко континентальному, холодному и высокогорному климату.Если взять, например, тибетских домашних животных: коз, овец, яков, лошадей, собак. Все они с крупной головой, широкими плечами, с короткой шеей, с объемным, хорошо выраженным затылком, с расширенной грудной клеткой, с укороченными конечностями. Можно сделать вывод: если у монгольской овчарки нагружен затылок, то у тибетского мастифа он перегружен.
  • Нет другой породы собак степного или долинного происхождения с такой аномально широкой, то есть «сердцевидной» грудной клеткой, свойственной всем собакам высокогорного Тибета. Хотя, по-видимому, это могло быть для скоростного движения (развитые легкие), например, для гончих.
  • В разреженном горном воздухе нет кислорода. Чтобы компенсировать это, увеличивается количество эритроцитов – переносчиков кислорода, увеличивается и объем легких, поэтому происходит усиленное расширение грудной клетки. Необходимость дотянуться до добычи заставляет собаку быстро передвигаться в горах, и это аномальное расширение грудной клетки хорошо выражено. Для борьбы с хищниками, защиты скота и, особенно, для победы необходима хорошо развитая дыхательная система.Кроме того, короткая шея с низкой осанкой дает свободу дыхательному горлу и ведет к кратчайшему прямому пути к легким.
  • Например, узкая, высокая и длинная головка нагревается медленнее, чем широкая и короткая головка, приближенная к форме шара, имеющая части одинакового объема. По крайней мере, поверхность будет отдавать тепло медленнее, чем любая другая форма. Чем меньше поверхность, тем меньше атмосферное давление на единицу площади. Это адаптивный механизм к атмосферному давлению в горах по сравнению с долиной.Если посмотреть на высокогорных аборигенных животных анфас, большая голова на короткой шее с выраженным затылком кажется втянутой в плечи, а шишка приближается к форме шара. У тибетских собак, например, усеченная широкая морда с нависшими бровями и широкая, округлая форма черепа, слишком приближенная к шару. Когда человек замерзает, он обычно вовлекает голову в плечи, и все животные стараются собраться в кучу.
  • У всех животных Тибета центр тяжести находится в передней части туловища, примерно, на линии плечевого пояса.Этот «высокогорный» атрибут необходим для вертикального движения. В этот момент механизм инертности задней части туловища работает по остаточному принципу. То есть, если животное резко прыгнет вверх, оно не должно напрягаться, чтобы восстановить равновесие, как если бы центр тяжести находился посередине. Можно сказать, что если сдвинулась передняя часть туловища, то и тело подпрыгнуло вверх. Также, если животное резко спрыгнуло, его вторая половина туловища по инерции не обрушит первую половину.
  • А у животных долинных обитателей при скоростном движении центр тяжести обязательно находится посередине, чтобы конечности полностью раскрывались в прыжке. Например, при беге на полном галопе за счет инерции задние конечности животного выносятся далеко вперед. Это, наоборот, помогает удерживать равновесие, когда сила тяжести приходится на середину тела.
  • Конечно, зимой в Монголии холодно, но Великую Степь (Гоби) нельзя сравнивать с леденящими ветром высочайшими горами Тибета, к тому же из-за недостатка кислорода кажется холоднее, чем есть на самом деле.Тем не менее, несмотря на «высокогорную» грудную клетку, анализ крови монгольской овчарки показал равнинный или степной адаптивный признак обитателя. Итак, остаточным признаком происхождения можно считать «высокогорную» грудную клетку, как и широкую черепную часть головы, и короткую шею с низким осанком.
  • По известным причинам, по сравнению с параметрами тибетского мастифа, морда монгольской овчарки немного вытянута и имеет расстояние не меньшее, чем от «стопа» до затылочного горба. Морда не такая тяжелая и объемная, как у современных заводских тибетских мастифов, которых в последние десятилетия разводят на потомках - сенбернарах. Формат туловища, в котором центр тяжести сближен с его серединой и ниже плечевого пояса, несколько растянут. Ноги стали длиннее, а их массивность уменьшилась, потому что не было необходимости карабкаться в горы или иметь устойчивость при нападении хищников, а появилась необходимость не отставать от стада в степи.Таким образом, спустившись с гор, собака постепенно утрачивает необходимость сохранять «высокогорные» адаптивные признаки и снижает экстерьерные параметры. Все остальные признаки, связанные с проживанием в экстремальных климатических условиях, собака сохраняет, так как и Средняя Азия, и Южная Сибирь расположены выше уровня Мирового океана.
  • Согласно изображениям тибетских собак в древних книгах о Тибете и в религиозной живописи, их индекс высоты ног приближается к 50 %, что меньше, чем у монгольских овчарок, имеющих эти параметры в размере 59-60 %. .Вероятно, низкие бабки на задних конечностях также являются остаточным признаком высокогорного происхождения.
  • Как и тибетские мастифы, монгольские овчарки долгожители, их средний возраст 16-18 лет. Иногда собаки могут дожить до 23-25 ​​лет.
Говоря о монгольских овчарках, нельзя не сказать о древнем национальном календаре монголов, официально введенном в Монголии в 1210 году.
Каждое животное обозначало определенное хозяйственное назначение места, традиционно с ним связанного.Так, Собака - символ охоты, в северо-западной части юрты под воздыханием собаки монголы хранили оружие и т. д. Год Собаки считался твердым, мужским годом. Рожденный в год Собаки, мужчина считался воином и охотником. Монгольская пословица «Скотоводу нужна собака, охотнику — ружье», она сравнивает собаку с орудием производства.
Например, известный монгольский охотник Ч. Лувсан с помощью аборигенной монгольской собаки – банхара – за 20 лет добыл 22 000 сурков, 200 рысей, 900 волков, 40 медведей! Диапазон от маленького сурка до крупного хищника, как медведь! Ни одна другая охотничья собака на это не способна. Иногда среди лаек встречаются более-менее «универсальные», способные охотиться на белку и соболя, и не бояться ни лося, ни медведя. На самом деле хаски тоже очень древняя порода собак.
В монгольских законах того времени, например «Уложении монгольских ойратов» и «Общественном приказе Халхи» 1709 г., имелись указания, запрещающие бить и убивать собак. В историческом законодательном документе «Уложение Халхаса Монголии» есть пункт закона, в котором сказано: «Нельзя убивать здоровую лошадь, белокурого гуся, змею, лягушку, турпана, козленка. антилопа, жаворонок и собака.А человек — свидетель убийства, — имел право отобрать у преступника лошадь». В этом же документе банхар, тайган и шараид были признаны неприкосновенными для чиновников и кышыктенов; банхар или его щенок причислялись к имуществу, которое нельзя было отобрать у простого человека. Также за убийство этой сторожевой собаки заплатил двухлетний бычок.
Таким образом, тот факт, что человек не имел права посягать на собаку как на чужую собственность, свидетельствует о том, что собака почиталась монголами как любимица. Кроме того, до конца жизни монгольская овчарка была верна хозяину, плохо переходила и тяжело привыкала к другому хозяину. Известны факты, когда после смерти хозяина или его ухода навсегда собаки умирали от тоски.
Если проанализировать монгольское слово нохой - собака, то оно произошло от слова нохор - первый товарищ, близкий друг.
В лечебной практике используют желудочный сок монгольской аборигенной собаки и сложные ферменты слюны (лизоцин и муцин.): В старинном сочинении «Монгольская драгоценная бусина» сказано, что «эта монгольская собака умна; находясь дома, охраняет двор, охотится, ловит диких животных.Он описывает монгольскую собаку как «бешеную собаку крупных размеров, с 4 сильными ногами, с широкой энергичной грудью, обладающую хорошей дрессировкой, выносливостью, силой воли».
В Монголии невозможно встретить живущих в квартире монгольских овчарок, а в городах они большая редкость. Но собаки, охраняющие жилища, привязанные цепью, вряд ли смогут победить волка, хотя он и храбр. Хорошая пословица «волки живут своими ногами» означает, что волк всегда в бегах, то есть в прекрасной физической форме.Банхары, которые постоянно ходят на охоту и работают по охране скота, не менее накачаны и от природы имеют хорошо развитое дыхание. Если не считать сложившегося веками «табу» на убийство домашней живности, эти собаки обладают практически равноценными с волками способностями. Но по некоторым параметрам банхары лучше. Кстати, монгольские овчарки, охотящиеся на крупных животных, тоже являются хищниками. Там, где скот выпасают вдали от цивилизации, банхары иногда устраивают бои с волками, суть которых «убей или будь убитым».Жизненный инстинкт и идея защитить собственность и мастерскую работу. Если в стае есть гонящаяся самка, срабатывает могучий механизм репродуктивного инстинкта. По этим причинам монгольские овчарки идут убивать волков (которые могут противостоять только голодной ярости и хищному инстинкту), не давая им шансов, и фактически становятся волкодавами. Эти собаки получают клички Гарге, Хасар или Босар — их смысловое значение — волкодав. Упомянутые случаи случаются зимой, в декабре-феврале, когда у самок монгольских овчарок бывает гон и голод приводит волков в бешенство.Волк набегает на стадо и режет овец без всякой цели, потому что тащит единственную. После каждого нападения волка потери исчисляются десятью и более убитыми головами крупного рогатого скота. Конечно, это бывает не каждый год, но все же. Где собака собьет волка, об этом помнят и люди, и волки, и другие хищники. Пока живы те, кто помнит, скот пасется под присмотром собак, словно под какой-то сверхъестественной защитой. Любые хищники проходят мимо.Хотя монгольские овчарки не ищут конфликтов, они воюют не только с волками, но и с рысями, мануалами, шакалами, и даже с хищными птицами, которые могут убить и опрокинуть ягненка.
Советские офицеры, служившие в Монголии, помнят, что призывникам предписывалось не приближаться к стаду, охраняемому монгольскими овчарками, у которых к ошейникам подвязаны красные попоны. Такие собаки жестоко расправляются с любым желающим приблизиться к скоту, хотя и позволяют подойти к чуме и поговорить с хозяином, но подходят и молча наблюдают за незнакомцем.
Это еще один повод гордиться тем, что монгольская овчарка не является заводской породой собак. Как писал Булат Шибизаров в рассказе «Великий пастух»: «У трусливого хозяина не может быть настоящего волкодава. Он не может навязать собаке то, чего нет у него самого, - мужество и благородство. Вот наше зеркало! Причина не в породе, а в силе воли! »
Шаманы Монголии, Тувы и Калмыкии, призывающие Духа Собаки – домашнего благодетеля, описывают одну и ту же собаку.По некоторым версиям шаманов, призывам от 9 до 12 тысяч лет или, возможно, на одну-две тысячи лет больше. Вот один из призывов, который записал тувинский ученый, поэт-шаман К.Л.Монгушем.
«…Ты верен своему хозяину,
Лежишь у порога, несешь службу охраны палатки.
Ты собака, охраняющая парковку.
Вы ведете наблюдение за стадом домашнего скота.
Ты стоишь там тайком, куда может прийти волк.
Сразу слышишь шорох, сразу киваешь головой и лаешь.
Ты лежишь крепкий, твое тело оберегает нас от беды.
Я стою пою, алгымышем зову собачью душу.
Я представляю, что ты носишь очки,
Ваше лицо предсказывает неприятности с неприятным запахом.
Родство страха заставляет протяжно выть,
Близость грозы заставляет быстро выпрыгнуть.
Твой хвост мохнатым валетом красуется дивно,
В ушах чудесные и эффектные серьги.
Гнедая с желтоватыми отметинами собака, шерсть у вас из темного бархата.
Я ищу твою душу; Я зову твою душу, начинающую петь алгышы».
Практически это описание собаки, которое сохранилось до наших дней сквозь века. Здесь есть и описание экстерьера, и образная характеристика достоинств на службе.
  • «…ты верен хозяину», - это правда, существуют легенды и песни об отчаянной верности монгольских собак, которые без страха быть убитыми защищают хозяина от опасности и даже умирают от тоски после его смерть.Поэтому сегодня можно говорить о «собачьей верности»;
  • «…Вы лежите у порога, неся службу охраны палатки.», - выражение «нести службу охраны» очень значимо и правомерно, поскольку монгольская овчарка «САМ ВЕДЕТ службу охраны». Значит, собака использовалась для охраны жилища с древнейших времен.
  • «…Ты собака, охраняющая стоянку.», - человечеству известно немало фактов приспособления как злобных, так и опасных хищников, верой и правдой служивших человеку, но только собаке мы доверяем, и только собака могла стать настоящим хранителем дома и в некоторых переводах приобретает смысловое значение - хранительница огня;
  • «…Ты собака, охраняющая парковку», - чтобы быть наблюдателем, надо хорошо подумать.До сих пор монгольские овчарки могут пасти скот самостоятельно, без хозяина. То есть собака должна:
    • уметь вести скот по сочной траве;
    • следить за теми животными, чтобы не сломать ноги по дороге на пастбище;
    • вовремя привести стаю на водопой;
    • не допускать смешивания с другим стадом на водопое или в пути;
    • не подвергать опасности стадо;
    • всегда защищайте крупный рогатый скот от любых хищников, чтобы предотвратить дальнейшие нападения;
    • вернуть скот на хоттон-стоянку, то есть вовремя домой.
  • «…Ты стоишь тайно там, где может прийти волк» - оказывается, что интеллект монгольской овчарки круче и мощнее, чем у волка, если она может поймать, понять и перехитрить волка, которым обладает природа. создан как самое умное и самое хитрое животное. Об этом свидетельствует тот факт, что волк, единственный из хищников, охотится на расстоянии 50 и даже 100 км от берлоги. А главное свойство его шерсти - отсутствие особого запаха, подтвержденное гистологическими исследованиями, помогает волку не слишком рано чувствовать собаку.Но по моему личному мнению, самым, потрясающим качеством и уникальным свойством монгольской овчарки является отсутствие запаха шерсти, кожи и животного. Монгольская овчарка всегда пахнет так, как пахнет место, где она находится, это великолепная маска, лучше всего придуманная. В чем суть и смысл этого явления? Это адаптивный признак, который сохранился до сих пор для лучшего охотника, чем любой хищник. В дикой природе запах — единственное средство получить какую-либо информацию о животных. Как правило, все хищники имеют резкий специфический запах как средство отпугивания и дополнительного устрашения. И хищникам сложно поймать и перехитрить друг друга. Любое существо на Земле имеет свой запах. Но у монгольской овчарки он наименее слышен и восприимчив для животных только на очень близком расстоянии, для человеческого обоняния он вообще недоступен. При таких способностях у монгольской овчарки практически больше шансов подобрать добычу на кратчайшем расстоянии.Поэтому до сих пор при необходимости монгольская овчарка может жить в дикой природе без помощи человека и самостоятельно охотиться. Если человеку случается сильно обидеть собаку, она навсегда уходит жить в лес. В настоящее время это не является необычной ситуацией. Когда в Монголии шла кампания по уничтожению собак, монгольские овчарки убегали в леса за день до прихода ликвидаторов, прятались там неделями и возвращались через день после ухода. Но возвращались всегда сытыми и упитанными.
  • «…Сразу слышишь шорох, тотчас киваешь головой и лаешь», — то есть у собаки было особое чутье и хороший слух; оно работало на людей, предупреждая их о любой опасности;
  • «…Ты лежала крепкая, тело твое хранило нас от беды», выражение «ты лежала…крепкая» означает, что она была как бы крепостью, защитой; еще он показывает огромные размеры монгольской овчарки, что подтверждается петроглифами того же периода: монгольские овчарки изображены там большими, как быки, лошади и люди;
  • «…я представляю тебя в очках», - монгольские овчарки имели прозвище «шилт нохой – в очках», а тувинцы называли таких собак «костух – в очках» из-за светлых линий вокруг глаз, а не потому, что светлых бровей в виде пятен над глазами, за что собаку прозвали «четырехглазкой». Кстати, очкарик является частью пятнисто-черного окраса собак, он широко распространен, присутствует более чем у 100 пород, и не является прямым признаком породы;
  • «…Ваше лицо предвещает неприятности с дурным запахом», - это, скорее всего, означает следующее: 1) уникальные обонятельные способности монгольских овчарок, которые могут брать след в любую погоду и при любой температуре; 2) интуиция, благодаря которой монгольская овчарка считается способной защищать людей от злых духов.Общение с этими собаками убедило меня в том, что в древности я был прав.
    Чтобы доказать это, у меня есть довольно интересный пример. На окраине коллективного сада пьяный водитель сбил столб с электрокабелем. Свет был отключен совсем, и была почти полная темнота. Я решил пойти домой возле сломанной колонны, чтобы сократить путь. Шуудер побежала вперед, но как раз перед разбитой колонной остановилась и начала лаять на меня, стараясь не дать мне пройти.Было уже темно, и я разозлился, поэтому я закричал на нее, как будто хотел ударить ее, чтобы она меня отпустила. Тогда Шуудер бросился на валявшиеся на земле провода кольцом и сильно ударил ее, даже подбросил. Выбросив все фрукты и ягоды, я бросился спасать собаку. Я даже не знаю, как мне это удалось, но с собакой на руках я пробежал 2 км до ветеринара, но собаку спасли. Выяснилось, что провода сохраняли так называемое «ступенчатое напряжение» и ток в них шел, несмотря на отключение.Откуда собака может знать о «ступенчатом напряжении»? Не сканирование любого человека. Если бы не инстинкт и самоотверженный порыв моей собаки, я был бы мертв после того, как наступил на провода под током.
  • «…Сродство страха заставляет протяжно выть»,- Древние люди обозначали смерть как «страх», а в наши дни эти собаки воют, когда предчувствуют смерть;
  • «… Близость грозы заставляет быстро выпрыгнуть. », — то есть реакция монгольской овчарки была опережающей молнию.И теперь впечатляет молниеносная реакция монгольских овчарок, особенно поразительная из-за их спокойствия и сдержанности.
  • «…Ваш хвост чудно красуется лохматым валетом», - действительно, длина волос бороды у хвоста до 30 см с бахромой и очень густой подшерсток. Вот «мохнатый валет» в виде загнутого под острым углом плотно закрученного хвоста-колечка;
  • «…В твоих ушах серьги чудесные и эффектные» - на внутренней стороне уха светлая и длинная полоска шерсти, собранная в небольшой пучок.Эта линия образует тонкую полоску, покрытую тончайшим слоем жира, по которой стекает жидкость (дождь или снег). Поэтому такая щепка наматывает из полинявшей шерсти серьгу;
  • «…Гнедая с желтоватыми отметинами собака, шерсть у вас из темного бархата» - «Гнедая» в данном контексте означает линяющий мех без подшерстка. На диалекте алари «бухта» означает тупой (относительно силуэта, строения). На хори-туматском диалекте «бухта» означает «без всего». Например, гнедая корова обозначает корову без рогов.На диалекте нохой-аил «гнедой» — коричнево-серый с крыльями (дали тай нохой — крылатая небесная собака). В отношении крылатой собаки есть понятийно-смысловой аспект. Силуэт и структура, возможно, подразумеваются как без чего-либо, например, без шерсти. Это означает, что даже линяющая собака выглядит и прикасается к ней «темной и бархатной».
В 18 веке В.Н.Татищев писал, что «…Волки в Сибири бывают трех родов:
  • Черные, похожи на черную собаку, но под горлом белая и шерсть у них мягче серая.Они довольно необычны и покупаются по 10, а то и до 15 рублей.
  • Белые, лучшие туруханы с их мягкой и белой шерстью покупаются по 4 и до 7 рублей, редко их количество до 200.
  • Серый, везде много, но в самых холодных местах они лучшие и продаются от 1-2 рубля, а в степи меньше рубля».
Биологи считают, что черных волков не бывает. Встречаются дворняги волка и черной собаки, особенно в Сибири.Даже если есть некоторые факты получения меланиста, они являются исключением из правил и не могут рассматриваться как порода черных волков. Речь идет о черных волках, у которых на груди имеется белое пятно. Качественной характеристикой меха мы признаем первоначальное описание шкуры монгольской овчарки как собаки, с шерстью темной и бархатистой. Тогда предположим, что местные волки скрещивались с монгольскими овчарками, так что появились «черные волки», с белым пятном под горлом, с качественной шкурой, которая в 15 раз дороже шкуры серого степной волк.И все это – с учетом современных гистологических исследований монгольской овчарки Осора, подтверждающих высокое качество ее шкуры – вполне логично. Этот небольшой исторический пассаж Татищева косвенно доказывает существование монгольских овчарок на территории Сибири и подтверждает высокое качество меха этих собак, которое встречается и в наши дни.
Следует пояснить следующий факт. Как было сказано выше, прямое скрещивание волка с монгольской овчаркой дает в первом поколении фенотип в пользу монгольского.Если условно принять canis lupus за старший подвид в биологическом виде, то версия происхождения домашней собаки от волка сомнительна. Получается как раз наоборот. Ну вообще это вопрос к биологам, зоологам и генетикам.
О мощном интеллекте приведу примеры. Однажды я привез монгольскую овчарку Шуудер вместе со щенком азиатской собаки (ее подсосной), которые были проданы в питомник мясокомбината, чтобы она охраняла всех продаваемых там щенков. Так она ночью устроила подкоп, откусила часть забора и убежала вместе с сосущим щенком, причем прошла незамеченной ни внутренней охраной, ни наружной, камерами видеонаблюдения. Зная Шуудер как действительно хитрую собаку, я пришел на работу до 6 часов утра, но она уже ушла.. Допросив охрану, я побежал искать ее в поселке, пришел в дом, а она ждала я со щенком возле ворот, прячась в левом гараже.Ее отчаянные глаза, поддвигая щенка ко мне, бегая рядом со мной, она собиралась спросить: «Как ты мог оставить меня и моего ребенка там? Что мы будем делать без тебя?»
Монгольский ученый, доктор наук Амгааседин Осор в 80-90-х годах 20 века всесторонне изучил, исследовал и доказал практическую ценность этой эндемичной собаки. Это {в его диссертации. Он заявляет, что по сравнению с другими породами собак монгольская овчарка обладает более мощным иммунитетом и системой регенерации, свойственной организму древних аборигенных животных, благодаря чему они так долго живут в экстремальных условиях.
Современные ученые назвали этот фактор «экологической пластичностью».
Возможно, изучив механизм создания и поддержания мощного иммунитета этой уникальной собаки, человек продлит среднюю продолжительность жизни, например, на сто лет. А исследованный механизм его уникальной системы регенерации поможет людям в решении проблемы восстановления утраченных конечностей.
Мало кто знает, что с 1932 года и до 2-й мировой войны монгольские овчарки находились на службе в сибирских войсках НКВД.К счастью, в архивах сохранились бесценные свидетельства службы монгольских овчарок. Золотым и Серебряные медали. Очень высоко ценились монголы за свою охранно-следственную службу, а также за неприхотливость к суровым условиям местности.
Служебные качества монгольской овчарки таковы: они могут работать как при температуре 40 градусов выше, так и ниже нуля, так как порода веками формировалась в резко-континентальном климате Бычковой части Монголии.
Кто еще, как не монгольские овчарки, может во время пыльной бури или метели собрать в кучу тысячу бестолковых и слепых овец и привести их к хоттон-поселению?
Биолого-хозяйственные особенности этих животных в совокупности со всеми их кочевыми качествами позволяют им круглогодично работать по охране и управлению скотом как незаменимым помощником человека. Кроме того, морфо-физиологические особенности и тип психики, с помощью которого эти собаки веками побеждали хищников (волков, рысей, медведей), позволяют предположить, что монгольские овчарки стали очень серьезным соперником для среднеазиатских и кавказских овчарок. в традиционных собачьих боях у народов Средней Азии, ныне не только там.
В новых условиях перехода к рыночной экономике и практически исчезнувшей государственной поддержки аграрного сектора экономики возникает проблема обеспечения населения экологически чистой, без использования генномодифицированного материала, сельскохозяйственной продукцией.С этой точки зрения наиболее предпочтительным является кочевое животноводство, которое было основой традиционного природопользования кочевых народов Азии.
Например, монгольское животноводство невозможно представить без использования овчарок. Монгольские овчарки признаются, что каждая собака заменяет как минимум двух рабочих и двух охранников, не считая оружия и амуниции. Если бы не использовали собак, транспортные расходы на розыск и передачу животных увеличились бы в 2-3 раза, утяжелился бы труд животноводов, а потери скота и себестоимость продукции увеличились бы более чем в два раза.
Сегодня в Бурятии фермеры охотно берут этих собак для работы со скотом, убедившись, что монголы способны оказать большую помощь людям.
Общей чертой кочевого животноводства является то, что многие виды аборигенных животных являются исчезающими видами из-за их бессистемного скрещивания с культурными породами.
Если разведение монгольских овчарок будет передано только общественным кинологическим организациям, это приведет к неэффективному размножению из-за утраты уникальных способностей реликтовой собаки.Это может происходить из-за отсутствия в этих организациях исследовательской базы и штатных специалистов-селекционеров. Поэтому сохранение уцелевшего становится в настоящее время центральной проблемой, требующей серьезных интеллектуальных усилий и государственной поддержки.
Мы приглашаем к сотрудничеству людей, заинтересованных в проблеме, и готовы попасть в выращивание этих уникальных редких животных под руководством нашего генофонда научно-экспериментального питомника «Монгольдой». Даже если пастухи и любители собак просто разводят, охраняют и занимаются разведением чистокровных монгольских овчарок, это будет означать, что монгольская овчарка веками служила людям и служит до сих пор.
P.S. Как автор этой статьи я должен пояснить, что монгольские овчарки не имеют ничего общего с, так называемыми, «бмв-хотошо».
Череп из ритуального захоронения Усть-Хайтино, 8300 лет.

Череп современного бангара, ритуальное место захоронения на реке Туок, Монголия.
Собаке 22 года, она умерла от застарелых ран.

 

Характеристика генома патогенного штамма ротавируса свиней В, выявленного в Республике Бурятия, Россия в 2015 г.

Патогены.2018 июнь; 7 (2): 46.

, 1, 2, * , , 3, 4, 5, 6 , 1 , 7 , 1 , 1, , 2 , 7 , 7 , 7 , 2, 7 , 7 , 7 , 7 , 1, 2 , 8 , 9 , 10, и 9, *

Пенин Алексей Анатольевич

3 А.Институт физико-химической биологии им. Н. Белозерского Московского государственного университета им. М.В. Ломоносова, Москва 119991, Россия; [email protected]

4 Институт проблем передачи информации РАН, Москва 127051, Россия

5 Лаборатория экстремальной биологии, Институт фундаментальной биологии и медицины, Казанский федеральный университет, Казань 420021, Россия

6 Кафедра генетики биологического факультета Московского государственного университета им. М.В. Ломоносова, Москва 119991, Россия

Евгений А.Непоклонов

8 Министерство сельского хозяйства Российской Федерации, Орликов пер., д. 1/11, Москва 107139, Россия; [email protected]

Диана М. Эррера-Ибата

9 Ветеринарно-диагностическая лаборатория, Колледж ветеринарной медицины, Университет штата Канзас, 1800 Denison Ave, Manhattan, KS 66502, США; [email protected]

Фрэнсис К. Шеперд

10 Департамент ветеринарии и биомедицинских наук, Колледж ветеринарной медицины, Миннесотский университет, Сент-ЛуисПол, Миннесота 55108, США; [email protected]

Douglas G. Marthaler

9 Ветеринарно-диагностическая лаборатория, Колледж ветеринарной медицины, Университет штата Канзас, 1800 Denison Ave, Manhattan, KS 66502, США; [email protected]

2 Федеральное государственное бюджетное научное учреждение «Федеральный научный центр ВИЭВ», Москва 109428, Россия; ur. [email protected] 3 Институт физико-химической биологии им. А. Н. Белозерского Московского государственного университета имени М.В. Ломоносова, Москва 119991, Россия; мок[email protected]

4 Институт проблем передачи информации РАН, Москва 127051, Россия

5 Лаборатория экстремальной биологии, Институт фундаментальной биологии и медицины, Казанский федеральный университет, Казань 420021, Россия

6 Кафедра генетики биологического факультета Московского государственного университета им. М.В. Ломоносова, Москва 119991, Россия

8 Министерство сельского хозяйства Российской Федерации, Орликов переулок, 1/11, Москва 107139, Россия; ур[email protected] 9 Ветеринарно-диагностическая лаборатория, Колледж ветеринарной медицины, Университет штата Канзас, 1800 Denison Ave, Manhattan, KS 66502, США; [email protected] 10 Департамент ветеринарных и биомедицинских наук, Колледж ветеринарной медицины, Миннесотский университет, Сент-Пол, MN 55108, США; ude. [email protected]

Эти авторы в равной степени внесли свой вклад в исследование.

Поступила в редакцию 5 марта 2018 г.; Принято 13 апреля 2018 г.

Лицензиат MDPI, Базель, Швейцария.Эта статья находится в открытом доступе и распространяется в соответствии с условиями лицензии Creative Commons Attribution (CC BY) (http://creativecommons.org/licenses/by/4.0/). Эта статья цитировалась в других статьях в PMC. .

Abstract

Вспышка кишечной болезни неизвестной этиологии с заболеваемостью 60% и смертностью 8% поросят-отъемышей произошла в ноябре 2015 г. на ферме в Республике Бурятия, Россия. Метагеномное секвенирование выявило присутствие ротавируса В в фекалиях больных поросят, в то время как другие патогены не были идентифицированы.Клиническое заболевание было воспроизведено у экспериментально инфицированных поросят, что дало 11 сегментов гена RVB для штамма Buryat15 с констелляцией генотипов RVB G12-P[4]-I13-R4-C4-M4-A8-N10-T4-E4-H7. Это созвездие генотипов также было идентифицировано в Соединенных Штатах. Хотя в белке Buryat15 VP7 отсутствуют уникальные аминокислотные различия в предсказанных нейтрализующих эпитопах по сравнению с ранее опубликованными свиными штаммами RVB G12, этот отчет о RVB у российских свиней расширяет наши эпидемиологические знания о глобальной распространенности и генетическом разнообразии RVB.

Ключевые слова: свиной ротавирус группы В, РВБ, желудочно-кишечные заболевания, кишечная болезнь свиней, филогенетический анализ

1. Введение

Ротавирусы (РВ) впервые были выделены в 1973 г. от детей в Австралии [1,2]. После идентификации у свиней два года спустя [3] RV были признаны основными этиологическими агентами острого вирусного гастроэнтерита у людей и домашнего скота во всем мире [4,5,6]. Геном RV, принадлежащий к семейству Reoviridae , состоит из 11 сегментов двухцепочечной РНК [7].Восемь видов RV (RVA-RVH) и два предварительных вида (RVI и RVJ) были идентифицированы с помощью классификации внутреннего капсидного белка 6 (VP6) на основе последовательностей [8,9,10]. RVA, RVB, RVC и RVH были обнаружены как у людей, так и у животных, в то время как RVD-RVG, RVI и RVJ были обнаружены только у животных. Пять из десяти видов РВ были описаны у свиней (РВА, РВБ, РВК, РВЭ и РВГ) [11,12,13].

Из видов РВА РВА наиболее распространен и хорошо охарактеризован как у животных, так и у людей из-за его высокой распространенности и патогенности.РВА свиней был выделен в 1975 г. [3] с последующей идентификацией РВК свиней [14] и РВБ [15,16]. Недавнее двухлетнее исследование обнаружило RVB в 31,8% образцов диареи от североамериканских свиней, что указывает на более высокое обнаружение RVB, чем наблюдалось ранее [16,17]. Аналогичные показатели обнаружения свиного RVB (25,9%) были выявлены в Японии [18]. Несмотря на более низкие показатели, чем в Северной Америке и Японии, RVB свиней также был обнаружен в Европе, Южной Африке, Индии и Бразилии [19,20,21,22].

Несмотря на неожиданно высокие показатели выявления RVB у свиней, патогенез RVB был установлен только у гнотобиотических и кесаревых поросят, лишенных молозива [16,23]. Невозможность культивирования RVB и ограниченные данные о последовательностях всего генома препятствуют пониманию передачи и эволюции у свиней. Чтобы восполнить эти пробелы в знаниях, в этом исследовании было использовано метагеномное секвенирование для идентификации РВБ свиней в результате кишечной вспышки на ферме из Южной Сибири, определена его болезнетворная способность с использованием экспериментальных экспериментов по инокуляции и изучено его филогенетическое родство с ранее охарактеризованными штаммами РВБ свиней. .

2. Результаты

Поздней осенью 2015 г. произошла вспышка кишечной болезни у трехдневных поросят-сосунов на ферме, расположенной в Республике Бурятия, Россия. Приблизительно 60% пометов страдали водянистой диареей (продолжительностью 3–5 дней), а уровень смертности составлял примерно 8%. У выживших поросят снизилась прибавка в весе и отсрочка отправки на рынок. Образцы кала и кишечника инфицированных поросят были переданы в НИИ диагностики и профилактики болезней человека и животных для выявления причины заболевания. Образцы дали отрицательный результат на TGEV (вирус трансмиссивного гастроэнтерита), RVA, ASFV (вирус африканской чумы свиней), PCV-2 (цирковирус свиней типа 2), CSFV (вирус классической чумы свиней) и PRCV (респираторный коронавирус свиней) с использованием ELISA и Коммерческие наборы для ПЦР производства Ветбиохим (Москва, Россия). Образцы кала пассировали на Vero, ST и PK-15. Культивирование клеток останавливали после шести слепых пассажей, поскольку цитопатического эффекта (ЦПЭ) не наблюдалось. Образцы фекалий и кишечника были отрицательными в отношении бактериальных патогенов на чашках с кровяным агаром.Поскольку патоген не был идентифицирован как возбудитель заболевания, очищенная РНК из образцов кишечника была отправлена ​​​​на секвенирование следующего поколения (NGS). Сборка прочтений de novo привела к образованию двух контигов, которые при анализе BLAST (NCBI) показали 83% и 86% идентичности нуклеотидов с генами VP3 и VP4 свиного штамма RVB LS00011_Ohio, соответственно. Других возбудителей в данных NGS обнаружено не было.

Поросенка заразили отфильтрованным фекальным материалом и смешали с инокулированным поросенком для изучения этиологии и передачи, связанной со свиным RVB штаммом Buryat15.У зараженного фекалиями поросенка развилась диарея в течение 12 часов, в то время как у поросенка, подвергшегося имитации, развилась диарея через 24 часа после инокуляции (PI) из-за того, что он смешался с инфицированным поросенком. Гомогенаты тонкого и толстого кишечника двух свиней дали отрицательный результат с помощью ранее описанных коммерческих наборов ELISA и PCR от Vetbiochim. Пассирование гомогенатов тонкой и толстой кишки в клетках Vero, ST и PK-15 отсутствовало CPE после шести пассажей. Тестирование кишечных гомогенатов с помощью NGS выявило добавление девяти генных сегментов штамма RVB Buryat15.NGS не выявил других патогенов в кишечных гомогенатах.

Одиннадцать генных сегментов Buryat15 имели самую высокую нуклеотидную идентичность с генами RVB, доступными через GenBank, и им была присвоена комбинация генотипов G12-P[4]-I13-R4-C4-M4-A8-N10-T4-E4- H7 на основе пороговых значений нуклеотидов всего генома RVB, предложенных Shepherd et al. (рукопись в рецензии). Таким образом, филогенетический анализ был сосредоточен на сравнении со штаммами свиного происхождения. Филогенетический анализ штамма Buryat15 выявил происхождение свиней смешанного географического происхождения (A–K).

Филогенетические деревья для 11 сегментов генов свиного RVB ( A K ) со значениями начальной загрузки, представленными в узлах (500 повторов). Значения начальной загрузки ниже 80% не отображаются. Выбранные клады генотипа были застегнуты и представлены треугольниками. Российский штамм Buryat15 выделен красным жирным шрифтом. Шкала баров представляет собой 10 нуклеотидных изменений на нуклеотидный сайт. Генотипы отмечены скобками для всех штаммов, кроме VP7, где генотипы G указаны в названии штамма.

Ген VP7 имел близких общих предков с японскими штаммами, в то время как ген NSP2 был наиболее тесно связан со штаммом свиньи из Индии. Ген VP6 разветвился с японским штаммом PB-107-G16, но оба попали в более крупную группу штаммов США. Ген NSP5 был наиболее тесно связан с геном cogent штамма свиней из Вьетнама. Ген VP1 имеет общую кладу со свиными штаммами RVB из Вьетнама и США. Ген NSP3 имеет общую кладу со свиными штаммами RVB из США.Штамм USA/LS00011_Ohio, адаптированный к культуре тканей, был близкородственным сегменту гена Buryat15 VP3. Гены VP4, VP2 и NSP4 из бурят15 не имели близких соседей на филогенетических деревьях.

Для изучения антигенного разнообразия Buryat15 идентичность аминокислот VP7 сравнивали с ранее охарактеризованными свиными штаммами RVB генотипа G12 по предсказанным антигенным сайтам [24] (). Buryat15 имеет аспарагин в гипервариабельном остатке 65, который является общим только для штаммов RVB, выделенных в Иллинойсе, США.Штаммы Buryat15 и японский PB-S24-11 имеют глутаминовую кислоту в остатке 91, в то время как все штаммы RVB имеют остаток аланина.

Таблица 1

Сравнение предсказанных антигенных сайтов на VP7 [24] для свиных штаммов RVB G12. Точки представляют те же самые остатки по сравнению с консенсусом, определяемым большинством аминокислотных остатков выравнивания.

9 9 9 9
Прогнозируемая эпитоп Расположение 33 34 36 37 39 40 65 66 67 89 90 91 92 130 158 159 160 161 179 180 181
консенсус D D Н D К В X Н y k k y a a y D P D S N N
N
Russia / Buryat15 / 2015 . . . . . . Н . . . . Е . . . . . . . . .
Япония/PB-S24-11/2002 . . . . Е . Д . . . . Е . . . . . . . . .
Япония/PB-S40-1/2003 . . Т Е . . В С . . . . . . . . . . . . .
CAN/11/2016 . . Т . . . Д В . . . . . . . Н . . . С .
США/PA-30/2012 . . Т . . К Д . . . . . . . . . . . . . .
США/MN-129/2015 . . Т . . К Д . . . . . . . . . . . . . .
США/MN-128/2015 . . . . . . Е . . . . . . . . Н . . . . .
США/ИЛ-13/2012 . . Т . . К Н Д . . . . . . . . . . . . .
США/Ил-5/2011 . . Т . . К Н Д . . . . . . . . . . . . .
США/Ил-6/2011 . . Т . . К Н Д . . . . . . . . . . . . .
США/Ил-4/2011 . . Т . . К Н Д . . . . . . . . . . . . .
США/Ил-14/2012 . . Т . . К Н Д . . . . . . . . . . . . .
США/IN-140/2015 . . . . . . Г . . . . . . . . . . . . . .
США/OH-119/2014 . . . . . . Q . . . . . . . . . . . . . .
США/PA-34/2013 . . . . . . Е . . . . . . . . Н . . . . .
США/IA-25/2012 . . . . . . Д . . . . . . . . Н . . . . .
США/NE-115/2014 . . . . . . Е . . . . . . . . Н . . . . .
США/MS-76/2013 . . . . . . Е . . . . . . . . Н . . . . .
США/PA09-10/2009 . . Т . . К Д . . . . . . . . . . . . . .
США/MO09-21/2009 . . Т . . К Д . . . . . . . . . . . . . .
США/OK09-50/2009 . . . . . . Е . . . . . . . . Н . . . . .
США/MN09-54/2009 . . . . . . Q . . . . . . . . . . . . С .
США/MN09-30/2009 . . . . . . я . . . . . . . . . . . . . .
США/MN09-27/2009 . . . . . . Q . . . . . . . . . . . . . .
США/MN09-24/2009 . . . . . . Е . . . . . . . . Н . . . . .
США/MN09-68/2009 . . . . . . Е . . . . . . . . Н . . . . .
США/LS00011_Огайо/XXXX . . Т . . К С Д . . . . . . . . . . . . .

3. Обсуждение

Доступна ограниченная информация о видах, не относящихся к RVA, у человека и домашнего скота из России. Единственная рукопись описывает РВК у людей из Новосибирской и Омской областей России [25], в то время как РВБ в России до сих пор не сообщалось.До недавнего времени RVB не считался важным патогеном для свиней, хотя ранние исследования продемонстрировали патогенез RVB у гнотобиотических поросят [16]. В то время как инфекции РВК распространены среди новорожденных поросят, о вспышках РВБ у новорожденных поросят обычно не сообщается, поскольку инфекции РВВ преимущественно выявляют у пожилых свиней [11]. Наши результаты показывают, что RVB способен вызывать кишечные заболевания у неонатальных поросят, выращенных традиционным способом, и подчеркивают способность RVB вызывать и воспроизводить клиническое заболевание у поросят.Эти результаты еще больше улучшают наше понимание сложности, связанной с RVB как патогеном для свиней.

Клиническое заболевание, воспроизведенное у поросят, выращенных традиционным способом, вызвало тяжелую водянистую диарею через 12 ч PI. В то время как образцы были отрицательными для других бактериальных и вирусных патогенов традиционными методами обнаружения и NGS, все еще возможно, что инфекция RVB может вызвать заболевание совместно с другими видами RV или бактериями. Тем не менее, несколько факторов позволяют предположить, что RVB был возбудителем кишечных заболеваний у поросят.Во-первых, в данных NGS не было идентифицировано никаких других патогенов, что позволяет предположить, что RVB был основным возбудителем болезни в образце. Кроме того, очищенный образец фекалий, использованный для заражения поросенка, не содержал бактерий, а РНК RVB была обнаружена у смешанных поросят с фиктивной инокуляцией, что свидетельствует о передаче RVB. Однако для подтверждения этой гипотезы необходимо окрашивание IHC или гибридизация in situ, которые не были доступны во время исследования.

Штаммы RVB от разных видов хозяев генетически отличаются друг от друга [26, 27, 28], что согласуется с нашим анализом, поскольку Buryat15 имеет самую высокую нуклеотидную идентичность со штаммами RVB свиней.Длинные ветви с Buryat15 на филогенетических деревьях VP2, VP4 и NSP4 указывают на недостаток информации о генетическом разнообразии штаммов RVB свиней. Сегменты гена Buryat15 тесно сгруппированы со штаммами RVB свиней из разных стран, включая Вьетнам, Индию, Японию и США. Реассортация является обычным явлением среди видов RV [27, 29, 30, 31], и штаммы RVB свиней из Индии и США имеют недавних общих предков со штаммами RVB японских свиней [20, 31]. Сходное генетическое родство между RVC японских и североамериканских свиней также было продемонстрировано [32].

Созвездие генотипа Buryat15 ранее не было идентифицировано у свиней, но оно тесно связано с созвездиями, ранее идентифицированными у свиней из США (Shepherd et al., рукопись в обзоре). Buryat15 и штамм культуры ткани LS00011_Ohio имеют одинаковые генотипы для всех генов, кроме NSP3 (T4 против T6, соответственно), в то время как штаммы Buryat15 и США IL11, IL13, IL5 и IL7 имеют общие генотипы для всех генов, кроме VP7. Российский штамм также был связан со свиньями США на основании его сходства по предполагаемому антигенному сайту со свиными штаммами RVB из США [24].Однако количество сегментов гена RVB, доступных для сравнения, ограничено, особенно для нескольких сегментов гена NSP, и более точное разрешение эволюции RVB и антигенного разнообразия может быть получено путем секвенирования дополнительных штаммов RVB.

Хотя данные NGS убедительно свидетельствуют о том, что РВБ был ответственен за вспышку диареи в Республике Бурятия, иммунофлуоресцентное окрашивание антигенов РВБ и гибридизация in situ нуклеиновой кислоты в фиксированных энтероцитах клинических и экспериментальных животных подтвердили инфекцию и репликацию вируса.Тем не менее, это исследование демонстрирует способность штамма RVB вызывать заболевание у поросят, выращенных традиционным способом, и иллюстрирует потенциал реассортации в эволюционной истории RVB у свиней. Будущие эпидемиологические исследования должны быть выполнены для продолжения характеристики распространенности и разнообразия российских и мировых штаммов RVB у свиней.

4. Материалы и методы

В ноябре 2015 г. у новорожденных поросят (в возрасте 3–5 дней) была зарегистрирована тяжелая водянистая диарея.Образцы были отправлены в Научно-исследовательский институт диагностики и профилактики болезней человека и животных для диагностических испытаний. С помощью диагностических наборов ИФА и ПЦР выявляли: TGEV и RVA, ИФА; ASFV, ELISA и PCR; PCV2, PCR; CSFV, ПЦР; и TGEV / PRCV, PCR; были использованы в соответствии с рекомендацией производителя (ветбиохим, Москва, Россия). РНК-экстракция проводилась с помощью Genejet Viral DNA / РНК Очистительная очистка (Thermo Science, Waltham, Ma, USA). После того как RVB был идентифицирован NGS, последующие образцы были протестированы с использованием праймеров RVB с помощью ПЦР (VP4-I-823-842-F: CGTATATATATCACAAAGCCACACGGGGGGA и VP4-I-1008-1028-R: TGGGCCCCCTTTTTTTTTCCAGTGTGT), которые были разработаны с использованием грунтовки. Интернет-программное обеспечение и Buryat15 VP4 Sequence {«Тип»: «Энтрез-нуклеотид», «attrs»: {"текст": "KU744407", "term_id": "1016111789", "term_text": "KU744407"}} KU7444407.Синтез кДНК проводили в соответствии со случайным протоколом праймеров с использованием набора для синтеза кДНК RevertAid H Minus First Strand (Thermo Scientific). ПЦР проводили с использованием ДНК-полимеразы True-Start с 10 мМ dNTPs mix (Thermo Scientific) в соответствии с протоколами производителя.

Образцы фекалий поросят, страдающих диареей, разводили 1:10 в минимальной основной среде (MEM), содержащей 1% актиномицина и 1% заменимых аминокислот (Gibco, Гранд-Айленд, Нью-Йорк, США), и очищали центрифугированием.Супернатанты последовательно фильтровали через шприцевые фильтры 0,8 мкм, 0,45 мкм и 0,2 мкм, серийно разбавляли и добавляли к пятидневным монослоям клеток Vero, клеток яичка свиньи (ST) и почки свиньи 15 (PK-15). Было проведено шесть слепых пассажей с клеточными линиями, и супернатанты были сохранены при -70 ° C.

Чтобы установить патогенность неизвестного вируса, одного десятидневного поросенка, выращенного традиционным способом, заразили образцом фекалий, профильтрованным через фильтр 0,2 мкм и разбавленным в соотношении 1:10, в то время как одного поросенка имитировали МЕМ.Двух поросят смешали, чтобы продемонстрировать передачу патологического агента между поросятами в экспериментальных условиях. Образец проверяли на отсутствие бактериальной контаминации путем посева отфильтрованных разведений на чашки с кровяным агаром. Поросят проверяли каждые 30 минут на наличие клинических признаков диареи. Поросят забивали после начала диареи и собирали образцы кишечника.

Для NGS ранее выделенная РНК подвергалась синтезу кДНК в соответствии с протоколом случайных праймеров, который выполняли на наборе для синтеза кДНК RevertAid H Minus First Strand (Thermo Scientific).ПЦР проводили с использованием ДНК-полимеразы True-Start со смесью 10 мМ dNTP и 10 пмоль специфичных праймеров на реакцию (Thermo Scientific) в соответствии с протоколами производителя. Набор TruSeq Stranded Total RNA Library Prep Kit использовали с 1 мкг тотальной РНК для создания библиотек в соответствии с протоколом производителя. Для библиотеки, обедненной рРНК, рРНК удаляли из 2,5 мкг общей РНК с использованием набора для удаления рРНК Ribo-Zero (смесь 1:1 человеческий/мышиный/крысиный зонд и бактериальный зонд) в соответствии с протоколом производителя (с концентрацией зонда для протокола эпидемиологического набора). ).Все библиотеки кДНК секвенировали с использованием Illumina HiSeq2000 (Illumina, Сан-Диего, Калифорния, США), производя считывания парных концов размером 101 × 7 × 101 п.н. с мультиплексированием. Чтения были обрезаны с использованием параметров по умолчанию с помощью CLC Genomics Workbench 8.5.1 (Qiagen Bioinformatics, Редвуд-Сити, Калифорния, США). Обрезанные чтения были собраны de novo с использованием размера слова 64, размера пузырьков 100 и минимальной длины контигов 300. Контиги подвергались поиску BLASTN. Последовательности RVB были депонированы в GenBank под номерами доступа {"type":"entrez-нуклеотид","attrs":{"text":"KU744406","term_id":"1016111787","term_text":"KU744406"} }KU744406 (VP3), {"type":"entrez-нуклеотид","attrs":{"текст":"KU744407","term_id":"1016111789","term_text":"KU744407"}}KU744407 (VP4 ), {"type":"entrez-нуклеотид-диапазон","attrs":{"текст":"KX869730-KX869737","start_term":"KX869730","end_term":"KX869737","start_term_id": "1220105591", "end_term_id": "1220105606"}}KX869730-KX869737 (VP1, VP6, VP7, NSP1-NSP5) и {"type":"entrez-нуклеотид","attrs":{"текст":" MH093644","term_id":"1383782639","term_text":"MH093644"}}MH093644 (VP2).

Вновь сгенерированные последовательности RVB были сопоставлены с помощью MUSCLE в Geneious (версия 9.6.1, Ньюарк, штат Нью-Джерси, США) [33] с последовательностями свиного RVB, которые имели не менее 80% открытой рамки считывания, доступной в GenBank (дополнительные таблицы S1). –S11). Филогенетические деревья максимального правдоподобия были построены с помощью метода RAxML с использованием обобщенной обратимой во времени гамма-модели нуклеотидной замены и 500 повторов начальной загрузки. Штаммы свиного RVB G12 были транслированы и сопоставлены с Buryat15 для сравнения 21 предсказанного антигенного сайта RVB VP7 [24].

Благодарности

Локальный комитет по этике и благополучию животных ФГБУН «ФНЦ ВИЭВ» (Москва, Россия) одобрил эксперимент на животных. Секвенирование и обработка данных выполнены в рамках грантового проекта РНФ № 14-50-00029.

Дополнительные материалы

Следующие материалы доступны в Интернете по адресу http://www.mdpi.com/2076-0817/7/2/46/s1, Таблицы S1–S11: Номера доступа Genbank штаммов RVB свиней, использованных в филогенетическом анализе .

Взносы авторов

К.П.А. написал исходный проект, сгенерировал праймеры RVB и отправил последовательности в GenBank, A.A.P. сгенерировали необработанные данные NGS и выполнили предварительный анализ данных, A.N.M. обрабатывал исходный образец, делал подготовку к выделению РНК, инокуляции поросят и клеточных культур, проводил исследование инокуляции поросят, К.М.К. провел исследование адаптации вируса к культуре клеток, Т.В.Г. координировал молекулярно-биологическую часть исследования, A.G.Y. выполнили ПЦР-тестирование на разные патогены и провели часть анализа последовательности, А.С.М. выполнил ПЦР-тестирование RVB, M.I.M. предоставил исследование с клеточными культурами, S.A.R. тестирование оригинального образца ELISA, участвовал в исследовании адаптации клеточной культуры и внес свой вклад в план эксперимента, A.M.M. и А.П.К. связались с фермой и собрали материал, O.A.V., T.I.A. и Э.А.Н. спроектировал и задумал эксперимент, D.M.H.I. генерировал последовательности RVB, F.K.S. и Д.Г.М. существенно переработал первоначальный проект и провел анализ данных NGS, а Ф.К.С. выполнили филогенетический анализ и сравнение антигенных сайтов для рукописи.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Литература

1. Bishop R., Davidson G.P., Holmes I.H., Ruck B.J. Вирусные частицы в эпителиальных клетках слизистой оболочки двенадцатиперстной кишки у детей с острым небактериальным гастроэнтеритом. Ланцет. 1973; 302: 1281–1283. doi: 10.1016/S0140-6736(73)-5. [PubMed] [CrossRef] [Google Scholar]2. Флеветт Т.Х., Брайден А.С., Дэвис Х. Вирусные частицы при гастроэнтерите. Ланцет. 1973; 2:1497. doi: 10.1016/S0140-6736(73)-8.[PubMed] [CrossRef] [Google Scholar]3. Роджер С.М., Крейвен Дж.А., Уильямс И. Демонстрация реовирусоподобных частиц в кишечном содержимом поросят с диареей. Ауст. Вет. Дж. 1975; 51:536. doi: 10.1111/j.1751-0813.1975.tb06917.x. [PubMed] [CrossRef] [Google Scholar]4. Флеветт Т.Х., Брайден А.С., Дэвис Х., Вуд Г.Н., Бриджер Дж.К., Деррик Дж.М. Связь между вирусами острого гастроэнтерита у детей и новорожденных телят. Ланцет. 1974; 304: 61–63. doi: 10.1016/S0140-6736(74)-6. [PubMed] [CrossRef] [Google Scholar]6.Янке Б.Х., Нельсон Дж.К., Бенфилд Д.А., Нельсон Э.А. Относительная распространенность типичных и атипичных штаммов среди ротавирусов от диарейных свиней в обычных стадах свиней. Дж. Вет. Диагн. расследование 1990; 2: 308–311. doi: 10.1177/10406387

00410. [PubMed] [CrossRef] [Google Scholar]7. Эстес М.К., Гринберг Х.Б. Вирусология Филдса. 6-е изд. Wolters Kluwer Health/Lippincott Williams & Wilkins; Филадельфия, Пенсильвания, США: 2013 г. Ротавирусы; стр. 1347–1401. [Google Академия]8. Маттейнссенс Дж., Отто П.Х., Сиарлет М., Дессельбергер У., Ван Ранст М., Джон Р. Пороговые значения на основе последовательности VP6 как критерий демаркации видов ротавирусов. Арка Вирол. 2012; 157:1177–1182. doi: 10.1007/s00705-012-1273-3. [PubMed] [CrossRef] [Google Scholar]9. Баняи К., Кеменеси Г., Будинский И., Фёльдес Ф., Зана Б., Мартон С., Варга-Куглер Р., Олдал М., Куруц К., Якаб Ф. Кандидаты на новый вид ротавируса у летучих мышей Шрайбера, Сербия . Заразить. Жене. Эвол. 2016;48:19–26. doi: 10.1016/j.meegid.2016.12.002. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]10.Михалов-Ковач Э., Геллерт А., Мартон С., Фаркаш С.Л., Фехер Э., Олдал М., Якаб Ф., Мартелла В., Баньяи К. Кандидаты на новый вид ротавируса у собак из приютов, Венгрия. Эмердж. Заразить. Дис. 2015;21:660–663. doi: 10.3201/eid2104.141370. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]11. Марталер Д., Хомвонг Н., Россоу К., Калхейн М., Гоял С., Коллинз Дж., Маттейнссенс Дж., Сиарлет М. Быстрое обнаружение и высокая распространенность ротавируса свиней A, B и C с помощью RT-qPCR в диагностические образцы. Дж. Вирол.Методы. 2014;209:30–34. doi: 10.1016/j.jviromet.2014.08.018. [PubMed] [CrossRef] [Google Scholar] 12. Марталер Д., Россоу К., Калхейн М., Гоял С., Коллинз Дж., Маттейнссенс Дж., Нельсон М., Сиарлет М. Широко распространенный ротавирус H среди свиней, выращиваемых в коммерческих целях, США. Эмердж. Заразить. Дис. 2014;20:1203–1206. doi: 10.3201/eid2007.140034. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]13. Педли С., Бриджер Дж. К., Чейси Д., МакКрей М. А. Определение двух новых групп атипичных ротавирусов. Часть 1Ж.Генерал Вирол. 1986; 67: 131–137. doi: 10.1099/0022-1317-67-1-131. [PubMed] [CrossRef] [Google Scholar] 14. Саиф Л.Дж., Бол Э.Х., Тейл К.В., Кросс Р.Ф., Хаус Дж.А. Ротавирусоподобные, калицивирусоподобные и 23-нм вирусоподобные частицы, связанные с диареей у молодых свиней. Дж. Клин. микробиол. 1980; 12: 105–111. [Бесплатная статья PMC] [PubMed] [Google Scholar]15. Бриджер Дж. К., Браун Дж. Ф. Распространенность антител к типичным и атипичным ротавирусам у свиней. Вет. Рек. 1985;116:50. doi: 10.1136/vr.116.2.50. [PubMed] [CrossRef] [Google Scholar] 16.Тейл К.В., Саиф Л.Дж., Мурхед П.Д., Уитмойер Р.Э. Вирус, подобный ротавирусу свиней (ротавирус группы B): характеристика и патогенность для гнотобиотических свиней. Дж. Клин. микробиол. 1985; 21: 340–345. [Бесплатная статья PMC] [PubMed] [Google Scholar]17. Хомвонг Н., Диаз А., Россоу С., Сиарлет М., Марталер Д. Трехуровневый логистический регрессионный анализ со смешанными эффектами выявляет сложную эпидемиологию ротавирусов свиней в диагностических образцах из Северной Америки. ПЛОС ОДИН. 2016;11:e0154734. doi: 10.1371/journal.pone.0154734. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]18. Куга К., Миядзаки А., Судзуки Т., Такаги М., Хаттори Н., Кацуда К., Масе М., Сугияма М., Цунэмицу Х. Генетическое разнообразие и классификация внешнего капсидного гликопротеина VP7 свиных ротавирусов группы B . Арка Вирол. 2009; 154:1785. doi: 10.1007/s00705-009-0517-3. [PubMed] [CrossRef] [Google Scholar] 19. Отто П.Х., Розенхайн С., Эльшнер М.С., Хотцель Х., Махновска П., Тройнар Э., Хоффманн К., Джон Р. Обнаружение ротавирусов видов A, B и C у домашних млекопитающих с диареей и генотипирование крупного рогатого скота вида A ротавирусные штаммы.Вет. микробиол. 2015; 179: 168–176. doi: 10.1016/j.vetmic.2015.07.021. [PubMed] [CrossRef] [Google Scholar] 20. Лахон А., Ингл В.К., Бираде Х.С., Раут К.Г., Читамбар С.Д. Молекулярная характеристика ротавируса группы B, циркулирующего у свиней из Индии: идентификация штамма, несущего новый генотип VP7, G21. Вет. микробиол. 2014; 174:342–352. doi: 10.1016/j.vetmic.2014.10.017. [PubMed] [CrossRef] [Google Scholar] 21. Молинари Б.Л.Д., Поссатти Ф., Лоренцетти Э., Альфьери А.Ф., Альфиери А.А. Необычная вспышка диареи свиней после отъема, вызванная одиночными и смешанными инфекциями ротавирусов групп A, B, C и H.Вет. микробиол. 2016; 193:125–132. doi: 10.1016/j.vetmic.2016.08.014. [PubMed] [CrossRef] [Google Scholar] 22. Geyer A., ​​Sebata T., Peenze I., Steele A.D. Ротавирусы свиней группы B и C впервые идентифицированы в Южной Африке. Дж. С. Афр. Вет. доц. 1996; 67: 115–116. [PubMed] [Google Scholar] 24. Шеперд Ф.К., Мерто М.П., ​​Чен Ф., Калхейн М.Р., Марталер Д.Г. Продольный надзор за штаммами ротавируса В свиней из США и Канады и идентификация in silico антигенно важных сайтов.Возбудители. 2017;6:64. doi: 10.3390/pathogens6040064. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]25. Жираковская Е., Тикунов А., Клемешева В., Логиновских Н., Нетесов С., Тикунова Н. Первая генетическая характеристика ротавируса С в России. Заразить. Жене. Эвол. Дж. Мол. Эпидемиол. Эвол. Жене. Заразить. Дис. 2016; 39:1–8. doi: 10.1016/j.meegid.2016.01.001. [PubMed] [CrossRef] [Google Scholar] 26. Судзуки Т., Сома Дж., Миядзаки А., Цунэмицу Х. Филогенетический анализ последовательностей генов неструктурного белка 5 (NSP5) в штаммах ротавируса В свиней.Заразить. Жене. Эвол. 2012; 12:1661–1668. doi: 10.1016/j.meegid.2012.06.016. [PubMed] [CrossRef] [Google Scholar] 27. Судзуки Т., Сома Дж., Куга К., Миядзаки А., Цунэмицу Х. Секвенирование и филогенетический анализ генов неструктурного белка 2 свиных ротавирусов вида B, обнаруженных в Японии в 2001–2009 гг. Вирус рез. 2012; 165:46–51. doi: 10.1016/j.virusres.2012.01.003. [PubMed] [CrossRef] [Google Scholar] 28. Марталер Д., Россоу К., Грамер М., Коллинз Дж., Гоял С., Цунэмицу Х., Куга К., Судзуки Т., Ciarlet M., Matthijnssens J. Обнаружение существенного генетического разнообразия ротавируса группы B свиней в Соединенных Штатах, что привело к предложению по модифицированной классификации генотипов G. Вирусология. 2012; 433:85–96. doi: 10.1016/j.virol.2012.07.006. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]29. Бвоги Дж., Джере К.С., Карамаги С., Бьяругаба Д.К., Намувуля П., Балирайн Ф.Н., Дессельбергер У., Итурриза-Гомара М. Полногеномный анализ отдельных ротавирусов человека и животных, выявленных в Уганде с 2012 по 2014 год, выявил сложную рекомбинацию генома события между человеческими, бычьими, козьими и свиными штаммами.ПЛОС ОДИН. 2017; 12 doi: 10.1371/journal.pone.0178855. [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]30. Аунг М.С., Нахар С., Аида С., Пол С.К., Хоссейн М.А., Ахмед С., Хак Н., Гош С., Малик Ю.С., Урушибара Н. и др. Распределение двух различных штаммов ротавируса B (RVB) в северо-центральной части Бангладеш и свидетельства реассортации среди человеческого RVB, выявленные с помощью полногеномного анализа. Заразить. Жене. Эвол. 2017; 47:77–86. doi: 10.1016/j.meegid.2016.11.001. [PubMed] [CrossRef] [Google Scholar] 31.Марталер Д., Судзуки Т., Россоу К., Калхейн М., Коллинз Дж., Гоял С., Цунэмицу Х., Сиарлет М., Маттейнссенс Дж. Генетическое разнообразие VP6, реассортация, внутригенная рекомбинация и классификация ротавируса В в Америке и японских свиней. Вет. микробиол. 2014; 172: 359–366. doi: 10.1016/j.vetmic.2014.05.015. [PubMed] [CrossRef] [Google Scholar] 32. Сузуки Т., Хасебе А., Миядзаки А., Цунэмицу Х. Анализ генетической дивергенции среди штаммов свиного ротавируса С с акцентом на генотипы VP4 и VP7 в Японии.Вирус рез. 2015;197:26–34. doi: 10.1016/j.virusres.2014.12.002. [PubMed] [CrossRef] [Google Scholar] 33. Кирс М., Мойр Р., Уилсон А., Стоунз-Хавас С., Чунг М., Старрок С., Бакстон С., Купер А., Марковиц С., Дюран С. и др. Geneious Basic: интегрированная и расширяемая настольная программная платформа для организации и анализа данных о последовательности. Биоинформ. Оксф. англ.

Добавить комментарий

Ваш адрес email не будет опубликован.