Перейти к содержимому

Бешенство эпизоотология: Бешенство животных

Содержание

Бешенство (rabies) / Инфекционные болезни сельскохозяйственных животных / Московский Ветеринарный WEB-Центр

Бешенство (rabies) – водобоязнь, гидрофобия – остро протекающее инфекционное заболевание теплокровных животных и человека, характеризующееся поражением центральной нервной системы (необычное поведение, непровоцируемая агрессивность, парезы, параличи и т.д.). Болезнь, как правило, заканчивается летально.

Заболевание регистрируется во всех странах мира, в том числе в Республике Беларусь, имеет экономическую, экологическую и социальную значимость.

Этиология. Возбудителем болезни является нейротропный РНК-содержащий вирус, относящийся к рабдовирусам. Размеры вириона 180?80 нм. Вирус термолабилен (при температуре 60 °С разрушается через 5-10 мин), но устойчив к низким температурам. В патматериале сохраняется до 3 мес. Быстро инактивируется дезинфицирующими растворами щелочей и кислот, относительно устойчив к фенолу и йоду.

Эпизоотологические данные. Восприимчивы теплокровные животные всех видов. Наиболее восприимчивы к нему лисы, шакалы, волки. Признана высокая чувствительность кошек и крупного рогатого скота, средняя – собак, овец, коз, лошадей и приматов, низкая – птиц. Источник возбудителя инфекции – больные животные и вирусоносители, которые выделяют вирус во внешнюю среду преимущественно со слюной за 3-8 дней до появления клинических признаков болезни.
Заражение происходит преимущественно через укус, реже через ослюнение, алиментарным и аэрогенным путями.

Для бешенства характерна природная очаговость и периодичность, которые связаны соответственно с наличием в природе резервуара вируса бешенства – диких плотоядных, особенно лис, и с трехлетней периодичностью снижения популяции этих животных.

Заболевание протекает в виде спорадических случаев, летальность 100%.

Патогенез. Заражение происходит при попадании вируса на поврежденные кожные покровы или слизистые оболочки вследствие укусов или ослюнения.

Укус обнаруживают примерно у 91% погибших от бешенства животных. С места первичной локализации вирус проникает в ЦНС и вызывает развитие негнойного энцефалита. Из мозга по центробежным нервам вирус попадает в слюнные железы, где он репродуцируется и выделяется со слюной.

Патологические изменения в ЦНС приводят к развитию нервного синдрома, а в последующем – к параличу органов дыхания или сердца и смерти животного.

Течение и симптомы болезни. Инкубационный период от 3-8 недель, а иногда до года и более. Болезнь проявляется в различных клинических формах: буйной, тихой, абортивной, атипической.
Буйная форма начинается с угнетения животного. Оно ко всему безразлично, теряет аппетит, поедает несъедобные предметы. Через 1-2 дня повышается рефлекторная возбудимость, развивается агрессивность. Бешеные собаки молча набрасываются на животных или людей и наносят укусы. Голос хриплый развивается косоглазие, нижняя челюсть отвисает, при развитии параличей глотки – слюнотечение.

Собаки стремятся сорваться с привязи и убегают на значительные расстояния, стремясь покусать встречных животных и людей. Затем наступает стадия парезов и параличей. Животные гибнут на 8-11 день от начала заболевания.

Тихая (паралитическая) форма отличается от буйной отсутствием возбуждения и характеризуется развитием параличей нижней челюсти, мышц туловища и конечностей. Смерть наступает на 3-4 день болезни.

При абортивной форме после клинического проявления болезни наступает выздоровление.
Атипичная форма характеризуется хроническим течением, прогрессирующим истощением и поздним развитием параличей.

Волки и лисицы теряют присущую им осторожность, даже в дневное время забегают в населенные пункты, набрасываются на людей и животных.

У крупного и мелкого рогатого скота тихая форма заболевания сопровождается отказом от приема корма, атонией рубца, мышечной дрожью, пучеглазием, слюнотечением, развитием параличей. Буйная форма сопровождается сильным возбуждением и беспокойством, ложной охотой, агрессией, запрокидыванием головы. Смерть наступает у лошадей и свиней протекает в буйной форме с признаками поражения ЦНС, агрессивности, параличей и гибели животных на 2-6 день болезни.

Патологоанатомические изменения. При вскрытии трупов характерных изменений не обнаруживают. У собак обнаруживают: отсутствие кормовых масс в желудке, иногда инородные предметы в нем: цианоз слизистых оболочек; острую венозную гиперемию головного мозга, печени, легких и селезенки; сгущение крови, сухость серозных покровов, подкожной клетчатки и кожи. При гистоисследовании в нервных клетках аммоновых рогов – тельца Бабеша-Негри.

Диагностика. При постановке диагноза учитывают эпизоотологические данные, клинические признаки и результаты патологоанатомического вскрытия. Окончательная диагностика осуществляется на основании результатов иммунофлуоресцентного исследования мазков-отпечатков головного мозга или биопробы на мышатах.

Дифференциальная диагностика. У крупного рогатого скота следует исключать губкообразную энцефалопатию, болезнь Ауески, злокачественную катаральную горячку, листериоз, острое течение лептоспироза, у лошадей – энцефаломиелит.

Лечение. Больных бешенством животных не лечат, их уничтожают.

Специфическая профилактика.

Для активной, в том числе вынужденной, иммунизации используется ряд антирабических вакцин.

Профилактика и меры борьбы. С целью профилактики бешенства следует: проводить пероральную иммунизацию диких плотоядных и уменьшать их популяцию, путем их отстрела, а бродячих собак и кошек – путем стерилизации самок, создание для них приютов и т.д.; осуществлять ежегодную вакцинацию домашних собак против бешенства; соблюдать действующие правила и санитарно-гигиенические нормы содержания собак, кошек и других хищных животных.

При возникновении бешенства вводится карантин. Покусавших людей или животных собак или кошек (кроме явно больных бешенством) подвергают карантинированию в течение 10 дней. Больных бешенством животных убивают и уничтожают (сжигают), остальных – подвергают вынужденной вакцинации. Карантин снимают через 2 месяца со дня последнего случая заболевания животных бешенством.

Страница статьи : Вопросы вирусологии

Полещук Е.М., Сидоров Г.Н., Березина Е.С. Бешенство в Российской Федерации. Информационно-аналитический бюллетень. Омск; 2013.

Гулюкин А.М. Значимость современных методов лабораторной диагностики и идентификации возбудителя бешенства для иммунологического мониторинга данного зооноза. Вопросы вирусологии. 2014; 59(3): 5-10.

Кучерук В.В., Росицкий Б.К. Природная очаговость инфекций - основные термины и понятия. Медицинская паразитология и паразитарные болезни. 1984; 2: 7-16.

Макаров В.В., Гулюкин А.М., Гулюкин М.И. Бешенство: естественная история на рубеже столетий. М.: ЗооВетКнига; 2015.

Хисматуллина Н.А., Гулюкин А.М., Гулюкин М.И., Иванов А.В., Сабирова В.В., Южаков А.Г. и др. Два случая гидрофобии в Республике Татарстан: прижизненная и постмортальная лабораторная диагностика. Вопросы вирусологии. 2015; 60(2):18-24.

Хисматуллина Н.А., Гулюкин А.М., Шуралев Э.А., Хаертынов К.С., Чернов А.Н., Филимонова М.

Н. и др. Ускоренный метод диагностики бешенства в культуре клеток невриномы гассерова узла крысы (НГУК-1). Гены и клетки. 2014; 9(3): 276-80.

Шабейкин А.А., Гулюкин А.М., Цареградский П.Ю., Паршикова А.В., Южаков А.Г., Зайкова О.Н. Анализ текущей эпизоотической ситуации по бешенству на территории Российской Федерации. Российский ветеринарный журнал. Сельскохозяйственные животные. 2015; (4): 5-7.

Vedernikov V.A., Sedov V.A., Pitalev P.N., Semljanova V.E., Gulyukin A.M. Rabies in individual countries (Russia, European part only). Rabies Bulletin Europe. 1998; 22(4): 9-10.

Vedernikov V.A., Sedov V.A., Baldina I.V., Gulyukin A.M., Troizkaya E.G., Cherkassky B L., et al. Summary of Rabies in the Russian Federation. Particularities of the Present Situation. Rabies Bulletin Europe. 1999; 23(4): 13-5.

Esri: Программное обеспечение для ГИС-картографии, платформа для позиционирования и аналитики пространственных данных. Available at: http://www.esri.com

Ботвинкин А.Д. , Кузьмин И.В., Хисматуллина Н.А. Итоги изучения антигенного разнообразия вируса бешенства на территории бывшего СССР. Ветеринарная патология. 2004; (3): 117-27.

Ведерников В.А., Шабейкин А.А., Харкевич А.А., Гулюкин А.М. Обзор эпизоотической ситуации бешенства в РФ в 2000 и прогноз на 2001 год. Ветеринарная патология. 2002; (1): 52-8.

Ведерников В.А., Гулюкин А.М., Седов В.А., Землянова В.Е., Пыталев П.Н., Коломыцев С.А. Особенности современного этапа эволюции эпизоотического процесса бешенства. В кн.: Диагностика, профилактика и меры борьбы с особо опасными и экзотическими болезнями животных. Материалы Международной научно-практической конференции, посвященной 40-летию ВНИИВВиМ. Покров; 1998: 153-6.

Девяткин А.А., Лукашев А.Н., Полещук Е.М., Ткачёв С.Е., Дедков В.Г., Сидоров Г.Н. и др. Молекулярная эпидемиология вируса бешенства на территории Российской Федерации. Эпидемиология и вакцинопрофилактика. 2017; 16(1): 39-42.

Зайкова О.Н., Гребенникова Т.В., Елаков А. Л., Кочергин-Никитский К.С., Алипер Т.И., Чучалин С.Ф. и др. Молекулярно-генетическая характеристика геномов полевых изолятов вируса бешенства, циркулирующих на территории Кировской области. Вопросы вирусологии. 2016; 61(4): 186-92.

Иванов А.В., Хисматуллина Н.А., Гулюкин А.М. Эпизоотологический и иммунологический надзор за бешенством. Ветеринарный врач. 2010; (4): 3-6.

Макаров В.В., Сухарев О.И., Гулюкин А.М., Боев Б.В. Бешенство в Восточной Европе: актуальный вектор развития эпизоотического процесса. Вестник Россельхозакадемии. 2008; (4): 58-60.

Макаров В.В., Сухарев О.И., Гулюкин А.М., Соколов М.Н., Литвинов О.Б. Бешенство енотовидных собак: статистический анализ заболеваемости. Ветеринария. 2009; (6): 20-5.

Хисматуллина Н.А., Гулюкин А.М., Кулакова С.Р., Амирова И.В. Совершенствование мер борьбы с бешенством в Смоленской области. Ветеринария. 2011; (4): 24-7.

Чупин С.А., Чернышова Е.В., Метлин А.Е. Генетическая характеристика полевых изолятов вируса бешенства, выявленных на территории Российской Федерации в период 2008-2011 гг. Вопросы вирусологии. 2013; 58(4): 44-9.

Шабейкин А.А., Гулюкин А.М., Паршикова А.В. Анализ закономерностей эпизоотического процесса бешенства на территории европейской части Российской Федерации. Ветеринария и кормление. 2015; (1): 29-34.

Шабейкин А.А., Зайкова О.Н., Гулюкин А.М. Обзор эпизоотической ситуации по бешенству в Российской Федерации за период с 1991 по 2015 годы. Ветеринария Кубани. 2016; (4): 4-6.

Herwijnen R.V., Шабейкин А.А., Гулюкин А.М., Хисматуллина В.А., Цареградский П.Ю., Паршикова А.В. Обзор эпизоотической ситуации бешенства, сложившейся в Российской Федерации в 2014 году. Ветеринария и кормление. 2015; (2): 19-23.

Shabeykin A.A., Gulyukin A.M. Overview of the epizootic situation on rabies for 2015 in the Russian Federation. Russian Journal of Agricultural and Socio-Economic Sciences. 2016; 56(8): 57-66.

Svotina, M.A., Absatirov G.G., Shalmenov M.Sh., Sidorchuk A.A., Gulyukin A.M. Epizootiological characteristics of animal rabies in the West Kazakhstan region. Biology and Medicine. 2015; 7(5): 152.

Зайкова О.Н., Гребенникова Т.В., Гулюкин А.М., Шабейкин А.А., Полякова И.В., Метлин А.Е. Молекулярно-генетическая характеристика полевых изолятов вируса бешенства, выявленных на территории Владимирской, Московской, Тверской, Нижегородской и Рязанской областей. Вопросы вирусологии. 2017; 62(3): 101-8.

Шабейкин А.А., Зайкова О.Н., Паршикова А.В., Южаков А.Г. Использование ГИС-технологий при оценке рисков в эпизоотологическом исследовании. В кн.: «Научные перспективы XXI века. Достижения и перспективы нового столетия». Сборник трудов X Международной практической конференции. Новосибирск; 2015: 50-4.

Шабейкин А.А., Гулюкин А.М., Хисматуллина Н.А. Опыт использования ГИС-технологий при оценке рисков в эпизоотологическом исследовании. В кн.: Труды V Международного ветеринарного конгресса. М.; 2015: 250-2.

Gulyukin A.M., Smolyaninov Y.I., Shabeykin A.A. The economic damage caused by Rabies of agricultural animals in Russia. Russian Journal of Agricultural and Socio-Economic Sciences. 2016; 56(8): 34-8

Иванов А.В., Хисматуллина Н.А., Петрова Т.П., Гулюкин А.М., Шабейкин А.А., Каримов М.М. и др. Эпизоотическая ситуация и борьба с бешенством в Калининградской области. Ветеринария. 2015; (4): 9-13.

Макаров, В.В., Сухарев О.И., Гулюкин A.M., Литвинов А.Б. Тенденции распространения бешенства в Восточной Европе. Ветеринария. 2008; (8): 20-2.

Хисматуллина Н.А., Петрова Т.П., Гулюкин А.М., Сабирова В.В., Гафарова А.З., Насыров Ш.М. и др. Контроль эффективности вакцинопрофилактики бешенства дикой фауны на территории Калининградской области РФ. Ветеринарный врач. 2012; (6): 8-11.

Гулюкин А.М., Шабейкин А.А., Белименко В.В. Эпизоотологические геоинформационные системы. Возможности и перспективы. Ветеринария. 2016; (7): 21-4.

BelimenkoV.V., Gulyukin A.M. Prospects for the use of Geografic Information Systems for risk-based monitoring of natural focal diseases of animals and humans. Russian Journal of Agricultural and Socio-Economic Sciences. 2016; 56(8): 22-5.

Belimenko V.V., Gulyukin A.M., Novosad E.V., Shabeikin A.A. Prospects of application of geoinformational systems for veterinary geology. In: Conference Materials of 7th International Conference on Medical Geology - Medgeo. Moscow; 2017: 61-2.

БЕШЕНСТВО

Государственная ветеринарная служба Самарской области

БЕШЕНСТВО

Бешенство - острое инфекционное заболевание животных и людей, вызываемое вирусом, при котором поражается центральная нервная система и, которое всегда заканчивается смертельным исходом.    Это заболевание входит в первую пятерку наиболее опасных болезней, общих для человека и животных.

В настоящее время бешенство зарегистрировано в 113 странах мира и поражает ежегодно порядка 50 тыс. человек, имевших контакт, как с дикими, так и с домашними животными.

Возбудитель заболевания– нейротропный вирус семейства рабдовирусов (Rabdoviridae), рода лиссавирусов (Lyssavirus), содержит РНК. С места внедрения (укуса) вирус по центростремительным нервным волокнам проникает в спинной, а затем головной мозг, где размножается, вызывая диффузный энцефаломиелит (воспаление головного и спинного мозга). Вирус бешенства вызывает      дегенеративные повреждения нейронов и сопровождается образованием специфических клеточных    включений (тельца Бабеша-Негри).

Вирус бешенства поражает все виды теплокровных животных, поэтому переносчиком может быть любое животное.

Источником инфекции в природе являются плотоядные звери (волки, шакалы, лисы). Домашние животные: собаки, кошки, крупный и мелкий рогатый скот, лошади заражаются при укусах диких животных и становятся основными источниками инфекции человека. Заболевание человеку от животных передается через укусы, ссадины, царапины, при попадании слюны на кожные покровы, слизистую оболочку глаз, полости рта, носа и при соприкосновении с каким- либо предметом или одеждой, загрязненными слюной бешеного животного.            

Клинические признаки - сходны у всех видов животных. Различают тихую и буйную форму заболевания. В большинстве случаев у животного наблюдается: изменение стиля поведения и неадекватная реакция на окружающих, может наблюдаться агрессивность, настороженность, сонливость или пугливость; странные предпочтения в еде, например, поедание травы, песка или земли; яркими признаками бешенства являются: обильное слюноотделение, тошнота и рвота, неспособность проглотить еду и т.д., нарушения в работе опорно- двигательного аппарата, тремор головы или отдельных частей тела, судорожные подергивая или сокращения мышц, проявление агрессии, паралич всего тела или конечностей символизирует скорый летальный исход животного. Довольно опасным является тот факт, что первое время после заражения животное никак не проявляет наличие вируса в своем организме, но уже представляет угрозу для человека и других животных.

Диагноз ставят на основании эпизоотологических, клинических, лабораторных и патологоанатомических данных. Лабораторное подтверждение диагноза бешенство возможно только посмертно на основании следующих методов: обнаружение телец Бабеша–Негри в клетках головного мозга, выделение антигена вируса бешенства в клетках с помощью иммунофлюоресцентного анализа, постановка биологической пробы с заражением лабораторных животных вирусом из слюны больных, взвеси мозговой ткани или подчелюстных желез;                                                                      

Дифференциальную диагностику проводят, исключая чуму плотоядных, болезнь Ауэски (псевдобешенство), менингит и энцефаломиелит.        

Профилактика бешенства: Учитывая опасность данного заболевания следует уделять огромное внимание его предотвращению. Мероприятия по профилактике бешенства в первую очередь включают в себя активную борьбу с источниками инфекции. Владельцам продуктивных и непродуктивных животных необходимо: соблюдать правила содержания животных в населенных пунктах Самарской области, представлять животных специалистам ветеринарной службы для плановых и внеплановых клинических осмотров, вакцинации, в случае необычного поведения животного немедленно информировать территориальное подразделение государственной ветеринарной службы Самарской области.

                                        

По материалам сайта: admilmen.ru

Информация об эпизоотическом благополучии управления ветеринарии города Екатеринбурга


В последние годы в Свердловской области сложилась стабильная эпизоотическая обстановка по заразным и массовым незаразным болезням животных, что благоприятствует развитию общественного и индивидуального животноводства и создает условия  для дальнейшего роста производства и реализации безопасной в ветеринарно-санитарном  отношении продукции животного происхождения. 

Устойчивое благополучие области  по заразным и массовым  незаразным болезням животных достигнуто в значительной мере посредством эффективного осуществления государственными учреждениями  ветеринарии области комплекса противоэпизоотических мероприятий, направленных на  предупреждение возникновения и  распространения инфекционных болезней животных, включая болезни, общие для человека и животных.

В 2011 год на территории Свердловской области было выявлено 139 неблагополучных пунктов по различным инфекционным заболеваниям скота и птицы. Своевременное выявление и проведение соответствующих ветеринарных  мероприятий  позволило в кратчайшие сроки ликвидировать и не допустить дальнейшего распространения заболеваний.

В результате ежегодного осуществления  бюджетными учреждениями ветеринарии области диагностических исследований, вакцинаций и профилактических обработок животных против заразных болезней, а также проведения на животноводческих фермах (комплексах)  и других объектах животноводства ветеринарно-санитарных  мероприятий (дезинфекция, дезинсекция, дератизация, дезинвазия) и других мероприятий, связанных с выявлением и уничтожением  возбудителей инфекций и инвазий во внешней среде, на территории области  за последние 5 лет не регистрировались случаи заболевания животных такими  опасными  болезнями, как сибирская  язва, бруцеллез,  лептоспироз, высокопатогенный грипп птиц, классическая чума свиней, сап лошадей, оспа и брадзот овец, трихинеллез свиней, наносящими, в случае их массового возникновения, значительный экономический ущерб сельскохозяйственному производству, а также угрозу жизни и здоровья населения области.   В  соответствии с постановлением Правительства Российской Федерации от 14.07.2012 г. № 717 «О государственной программе развития сельского хозяйства и регулирования рынков сельскохозяйственной продукции, сырья и продовольствия на 2013-2020 годы»  реализация   мероприятия по предупреждению распространения африканской чумы свиней на территории Свердловской области направлена на  предупреждение возникновения и распространения вируса африканской чумы свиней на территории Свердловской области.

С момента внедрения в Свердловской области «Уральской системы оздоровительных противолейкозных мероприятий» (с 1992 года), разработанной с участием научных сотрудников ГНУ «Уральский научно-исследовательский ветеринарный институт» удалось полностью оздоровить 641 неблагополучный пункт по лейкозу. Несмотря на принимаемые меры по своевременному охвату диагностическими исследованиями на лейкоз всего поголовья крупного рогатого скота (как общественного так и индивидуального)  и повышению объемов проводимых в неблагополучных по этому  заболеванию пунктах  специальных ветеринарных мероприятий, остаются не оздоровлёнными  4 неблагополучных  пункта. Работа  будет продолжена до полного освобождения территории области от данной вирусной инфекции.

В Российской Федерации, особенно в ее южных регионах, в последние годы зарегистрирован рост заразных болезней животных, в том числе опасных и особо опасных, завезенных из зарубежных стран, что не дает  гарантий сохранения ветеринарно-санитарного  благополучия области.

Угрозу ветеринарно-санитарному благополучию представляет целый ряд причин и факторов риска.

На начало 21 века приходятся пики активизации инфекционных процессов по многим особо опасным и карантинным болезням как домашних, так и диких животных (высокопатогенный грипп птиц А/h2N1, пандемический грипп (свиней) A/h4N2, губкообразная энцефалопатия крупного рогатого скота, африканская чума свиней). Особое опасение вызывает стремительно ухудшающаяся ситуация по африканской чуме свиней. Возникновение заболевания повлечёт введение карантина (особого экономического режима),  на  значительной территории, что наряду с ущербом от гибели животных и потерей их продуктивности, приведёт к большим экономическим издержкам от ограничения деятельности хозяйствующих субъектов.

       Среди многообразия зоонозных инфекционных заболеваний, бешенство (гидрофобия) остается одной из серьезных проблем на территории Российской Федерации, в том числе Свердловской области, которая является стационарно неблагополучной по бешенству (50% случаев от зарегистрированных особо опасных заболеваний животных на территории области в 2011 году). На протяжении ряда лет в разных районах области возникают очаги этого опасного заболевания, переносчиками которого в природе являются дикие плотоядные животные (лисицы, барсуки, енотовидные собаки, волки), а в городских условиях бродячие собаки и кошки. В связи, с чем государственными учреждениями ветеринарии области предприняты меры по повсеместному охвату прививками против бешенства, помимо собак и кошек, всего поголовья крупного рогатого скота, принадлежащего юридическим и физическим лицам, а также диких хищников в зонах стационарного неблагополучия по бешенству. Это позволит, при условии регулярного осуществления данных мероприятий, значительно улучшить эпизоотическую ситуацию по данному заболеванию.

Высока вероятность новых вспышек инфекционных болезней в ранее неблагополучных пунктах по сибирской язве животных. Проблема биологической опасности сибиреязвенных скотомогильников и отдельных захоронений сибиреязвенных трупов животных существует не одну сотню лет и напрямую связана с биологической особенностью возбудителя сибирской язвы образовывать споровую форму бацилл, устойчивую к воздействию многих физических, химических и биологических факторов. Чрезвычайно высокая устойчивость сибиреязвенных спор является основной причиной формирования почвенных очагов сибирской язвы. Везде, где животные погибали от сибирской язвы и (или) производились захоронения, сжигание сибиреязвенных трупов, происходило обсеменение почвы сибиреязвенными спорами, и, как следствие, формировался почвенный очаг сибирской язвы. На территории Свердловской области зарегистрировано 72 сибиреязвенных захоронения (Алапаевский район - 5, Артемовский район - 1, Артинский район - 2, Байкаловский район - 8, г. Березовский - 1, Верхотурский уезд - 1, Ирбитский район - 7, Красноуфимский район - 1, Пышминский район - 1, Серовский район - 1, Слободо-Туринский район - 23, Сысертский район - 7, Тугулымский район - 9, Туринский район - 1, г. Екатеринбург - 4). Последнее захоронение животного, погибшего от сибирской язвы зарегистрировано на территории  Алапаевского района в 1984 году. Заболеваемость сибирской язвой среди людей на территории Свердловской области не регистрировалась с 1979 года.

Населенный пункт, в котором когда-либо возникли заболевания животного или людей сибирской язвой, считается стационарно неблагополучным. В связи с высокой вероятностью возникновения сибирской язвы необходима двукратная вакцинация восприимчивого поголовья.

Существующая угроза заноса в область из других регионов таких особо опасных болезней животных, как бруцеллез, туберкулез, африканская и классическая чума свиней, оспа овец, трихинеллез свиней,  требует принятия учреждениями ветеринарии области мер по карантинированию всех  поступающих в область животных, их профилактической вакцинации и диагностическому обследованию, обязательному ветеринарному освидетельствованию завозимых в область кормов, кормовых добавок, продукции животного происхождения, а также осуществлению постоянного и эффективного эпизоотического мониторинга в целях адекватного реагирования на возникающие риски  биолого-социального характера.

В соответствии с положением «О системе государственного контроля  радиоактивного загрязнения  объектов ветеринарного надзора в Российской Федерации», с учетом радиационной обстановки, сложившейся на территории Свердловской области,  с целью уменьшения дозовой нагрузки на животных и человека путем максимально возможного снижения уровня радиоактивного загрязнения кормов и продукции животноводства в Свердловской области создана система радиологического контроля. Государственные учреждения ветеринарии   отбирают пробы, проводят  дозиметрические, радиометрические, радиохимические исследования.

Таким образом, проблема эпизоотической и  ветеринарно-санитарной безопасности Свердловской области, которая, как правило, усугубляется при чрезвычайных ситуациях, вызванных биологическими факторами, должна решаться программно-целевым методом.

Эпизоотическое и ветеринарно-санитарное благополучие - один из факторов определяющих социально - экономическую ситуацию в области, перспективы её развития. Благополучие способствует стабильному развитию агропромышленного комплекса, повышению рентабельности животноводства и перерабатывающих отраслей. Одновременно обеспечиваются:

- защита населения от болезней, общих для человека и животных, либо возникающих при использовании (потреблении) недоброкачественной животноводческой продукции;

- повышение конкурентоспособности произведенных в области продуктов по критериям ветеринарно-санитарной безопасности;

- возможности населения по самообеспечению продуктами питания;

- снижение рисков загрязнения биологическими отходами окружающей среды и возникновения чрезвычайных ситуаций.

Ветеринарное благополучие определяет инвестиционную привлекательность животноводческих хозяйств, создает условия по развитию спорта, туризма, проведению сельскохозяйственных семинаров, выставок, ярмарок.

С новостями по эпизоотическому и ветеринарно-санитарному благополучию  Свердловской области можно ознакомиться по ссылкам:

СОВРЕМЕННАЯ ЭПИЗООТОЛОГИЯ БЕШЕНСТВА ЖИВОТНЫХ

Авторы: 

И. В. НОВИКОВА, аспирант,

О. Г. ПЕТРОВА, доктор ветеринарных наук, профессор,

Уральский государственный аграрный университет (620075, г. Екатеринбург, ул. К. Либкнехта, д. 42)

Аннотация. Реструктуризация сельскохозяйственного производства России неоднозначно отразилась на эпизоотическом состоянии животноводства и на эффективности противоэпизоотических мероприятий. В ряде субъектов федерации возросла эпизоотическая и эпидемическая значимость зоонозных болезней, участились рецидивы хронических болезней животных. Бешенство относится к числу опасных зоонозов в РФ, более того, за последние годы в ряде регионов усложнилась эпизоотическая ситуация по этому зоонозу, выявлены регионы с его территориальной приуроченностью. По данным международных ветеринарных организаций, бешенство включено в группу трансмиссибельных болезней, имеющих существенное значение в области общественной экономики и здравоохранения в пределах конкретных стран, а также в организации международной торговли животными и животноводческими продуктами. В настоящее время эти зоонозы определяют эпизоотическое и эпидемическое состояние в том числе в России, а в последние годы эпизоотическая ситуация по рабической инфекции приобрела тенденцию к усложнению. Активизируются аутохтонные и антропургические очаги этой инфекции. В странах, свободных от бешенства, существует постоянная угроза заноса бешенства из других стран. Тем не менее, во многих государствах Западной Европы бешенство успешно ликвидировано, в основном благодаря оральной вакцинации диких животных. По оценке Всемирной организации здравоохранения (ВОЗ), риск заражения человека бешенством особенно высок в Евразии, южной части Латинской Америки и на Африканском континенте. Несмотря на проводимые мероприятия по ограничению распространения рабической болезни, полностью ликвидировать бешенство животных на территории конкретных субъектов РФ до сих пор не удалось, а многие аспекты функционирования паразитарных систем бешенства до сих пор остаются недостаточно изученными.

Ключевые слова: бешенство, резервуар, антропургический цикл, домашние животные, дикие животные, рабический вирус, профилактика, вакцинация.

Скачать полный текст статьи

Профилактика бешенства

(V в. до н. э.) и Аристотель (IV в. до н. э.), бешенство человека – Цельс (I в. н. э.), который дал ему название гидрофобии (водобоязни). До XVII в. эпизоотии бешенства имели ограниченное распространение. Наиболее крупные эпизоотии этой инфекции, охватившие многие страны мира, были зарегистрированы в середине XIX и в первой четверти XX в. Заразность слюны больного животного известна с начала XIX века.

В 1885 г. Л. Пастер добился выдающихся результатов в многолетних исследованиях бешенства: пассируя уличный вирус бешенства через мозг кроликов, он получил лабораторный вирус (virus fixe ) и разработал антирабическую вакцину. Уже в 1886 г. благодаря антирабическим прививкам была спасена жизнь 2500 человек.

В настоящее время бешенство остается одной из серьезных проблем как здравоохранения, так и ветеринарии.

Случаи заболевания людей данном инфекционным заболеванием по данным Всемирной Организации Здравоохранения регистрируется более чем в 150 странах и территориях.

В Российской Федерации на протяжении последних лет эпизоотолого- эпидемиологическая обстановка по бешенству остается неблагополучной. В 2014 г. в 3 субъектах Российской Федерации было зарегистрировано 3 случая гидрофобии (в 2013 г. – 6, в 2012 г. – 4). Среди детей в возрасте до 17 лет в 2012 и 2014 гг. зарегистрировано по 1 случаю гидрофобии.

Не снижается опасность распространения бешенства среди животных и возникновения случаев заболевания людей. Почти во всех регионах страны периодически отмечается активизация природных очагов бешенства, растет число случаев заболевания среди диких плотоядных животных, в эпизоотический процесс вовлекаются домашние животные (собаки, кошки) и сельскохозяйственные животные.

Отмечается стабильно высокое число ежегодных обращений населения по поводу укусов животными. Около четверти обращений по поводу укусов животными приходится на детей в возрасте до 14 лет, количество которых в динамике также снижается. В 2014 г. от нападений животных пострадали 371 930 человек, из них дети до 17 лет – 110 145 (в 2013 г. – 380 793 и 110 603, в 2012 г. – 409 298 и 120 549 человек соответственно).

От диких животных в 2014 г. пострадали 8 364 человека, из них де- тей в возрасте до 17 лет – 2 365 человек, в 2013 г. – 8 135 и 2 249, в 2012 г. – 8 645 и 2 699 человек соответственно. Доля детей до 17 лет, пострадавших от укусов животными, остается постоянной и составляет 28—30 % ежегодно

Бешенство (Rabies, hydrophobia Lyssa, гидрофобия, водобоязнь) – острая вирусная инфекционная болезнь животных и человека с контактным механизмом передачи, характеризующаяся прогрессирующим поражением центральной нервной системы (энцефалитом), смертельным для человека.

Инкубационный период бешенства длится обычно 1-3 месяца, но может варьироваться от менее 1 недели до более одного года. Первоначальными симптомами бешенства являются высокая температура и во многих случаях боль или необычные, необъяснимые ощущения покалывания, пощипывания или жжения (парестезия) в месте раны.

По мере распространения вируса по центральной нервной системе развивается прогрессивное, смертельное воспаление головного и спинного мозга.

Возможно последующее развитие двух форм болезни. У людей с буйным бешенством появляются признаки гиперактивности, возбужденное поведение, гидрофобия и иногда аэрофобия. Через несколько дней наступает смерть в результате кардиореспираторной остановки.

На паралитическое бешенство приходится около 30% всех случаев заболевания людей. Эта форма бешенства протекает менее драматично и обычно дольше, чем буйная форма. Мышцы постепенно парализуются, начиная с места укуса или царапины. Медленно развивается кома и, в конечном итоге, наступает смерть. При паралитической форме бешенства часто ставится неверный диагноз, что способствует занижению данных о болезни.

Специфическая терапия бешенства не разработана. Прогноз при развившейся болезни безнадежный. Достоверных случаев выздоровления от бешенства нет. В литературе сообщается лишь об одном единственном случае выздоровления больного, леченного кураре.

В связи с неэффективностью терапии профилактика бешенства приобретает особенно важное значение. Она проводится в двух направлениях и включает борьбу с источниками инфекции и предупреждение болезни у людей.

Программа профилактики бешенства среди домашних животных (антропургическое бешенство) предусматривает:
соблюдение правил содержания собак и кошек;
– обязательную регистрацию собак, имеющих владельцев;
– отлов всех бездомных и незарегистрированных собак и кошек;
– обязательную ежегодную профилактическую вакцинацию собак в возрасте старше 3 х месяцев;
– профилактическую вакцинацию кошек и сельскохозяйственных животных на неблагополучных по бешенству территориях;
– наличие достаточного запаса антирабической вакцины;
–контроль за перевозками домашних животных, как на международном уровне, так и внутри страны;
–создание лабораторной службы, обеспечивающей быструю и эффективную диагностику бешенства у животных;
–организацию эпидемиологического надзора за бешенством, предусматривающего систему сбора и обмена информацией о случаях бешенства у животных и людей как внутри страны, так и между странами;
– активную санитарно просветительную работу среди населения о мерах профилактики бешенства.

Борьба с природным бешенством (бешенство среди диких животных) включает регуляцию численности диких животных (в первую очередь – популяции лисицы, так как она является основным хозяином возбудителя бешенства, поддерживающим современную эпизоотию в Европе), газацию лисьих нор и оральную иммунизацию живой антирабической вакциной, проводимую путем скармливания животным куриных голов, содержащих вакцину.

Профилактика заболеваний у лиц, покусанных бешеными или подозрительными на заболевание бешенством животными, составляет важный раздел антирабической деятельности.

Все люди, покусанные, оцарапанные, ослюненные любым животным, даже внешне здоровым, считаются подозрительными на заражение бешенством. Им проводят местную обработку раны с промыванием ее мыльным раствором и смазыванием концентрированным спиртовым раствором йода, специфическую противостолбнячную профилактику, а в случае необходимости – и антирабическую предохранительную иммунизацию.

Предупреждение бешенства у человека осуществляют с помощью антирабических вакцин и антирабического иммуноглобулина.

Назначение курса прививок против бешенства определяется на основании результатов клинических и эпидемиологических данных, к которым в дальнейшем присоединяются результаты лабораторного исследования покусавшего животного.

В зависимости от этих данных лицам, обратившимся за антирабической помощью, прививки либо совсем не назначают, либо назначают по условным и безусловным показаниям.

Условный курс – это 2–4 инъекции антирабической вакцины лицам, получившим множественные укусы или повреждения опасной локализации от внешне здоровых животных, за которыми можно установить 10 дневное наблюдение.

Безусловный курс назначается людям, получившим повреждения от бешеных, подозрительных на бешенство, диких или неизвестных животных.

Прививки не назначают при небольших укусах, если укушенный уже прививался против бешенства независимо от срока давности. Их не назначают также при одиночных неглубоких укусах (кроме головы и пальцев) в местности, благополучной по заболеваемости бешенством; при укусах привитой собаки; при ослюнении неповрежденных кожных покровов, если покусавшее животное в этот момент было здорово (справка ветеринарного работника). Однако в любом случае животное должно находиться под наблюдением в течение 10 дней. Если в течение этого срока у животного будет установлено или заподозрено заболевание бешенством, покусанному сразу же начинают проводить курс прививок против бешенства.

При укусах домашней птицы прививки назначают только в случае, если птица явно больна бешенством, а также при наличии эпизоотологических показаний. При укусах диких птиц прививки назначают всегда.

При укусах других здоровых на вид животных назначают условный курс прививок, дозировки и длительность которых определяются в зависимости от локализации и тяжести укусов. Тяжелые укусы в голову и пальцы, множественные укусы в другие части тела требуют введения вакцины в течение 3–4 дней или антирабического иммуноглобулина согласно инструкции. В тех случаях, когда у покусавшего животного клинически или лабораторно устанавливается диагноз бешенства, а также в случаях, когда диагноз не мог быть установлен (животное скрылось, труп уничтожен), покусанному назначают безусловный курс прививок.

Дозировки и длительность прививок определяют по локализации и тяжести укусов.

Антитела появляются через 3 недели после начала прививок. Поствакцинальный иммунитет становится действенным через 2 недели после окончания вакцинации. Иммунитет сохраняется примерно в течение года. Вакцинация предупреждает возникновение болезни в 96–99 % случаев. Побочные явления при антирабической вакцинации наблюдаются в 0,02 0,03 % случаев.

Современная эпизоотология бешенства животных

Аграрный вестник Урала № 10 (140) 2015

Ветеринария

Петрова О. Г. доктор ветеринарных наук, профессор Уральский государственный аграрный университет

Новикова И. В. аспирант Уральский государственный аграрный университет

 Реструктуризация сельскохозяйственного производства России неоднозначно отразилась на эпизоотическом состоянии животноводства и на эффективности противоэпизоотических мероприятий. В ряде субъектов федерации возросла эпизоотическая и эпидемическая значимость зоонозных болезней, участились рецидивы хронических болезней животных. Бешенство относится к числу опасных зоонозов в РФ, более того, за последние годы в ряде регионов усложнилась эпизоотическая ситуация по этому зоонозу, выявлены регионы с его территориальной приуроченностью. По данным международных ветеринарных организаций, бешенство включено в группу трансмиссибельных болезней, имеющих существенное значение в области общественной экономики и здравоохранения в пределах конкретных стран, а также в организации международной торговли животными и животноводческими продуктами. В настоящее время эти зоонозы определяют эпизоотическое и эпидемическое состояние в том числе в России, а в последние годы эпизоотическая ситуация по рабической инфекции приобрела тенденцию к усложнению. Активизируются аутохтонные и антропургические очаги этой инфекции. В странах, свободных от бешенства, существует постоянная угроза заноса бешенства из других стран. Тем не менее, во многих государствах Западной Европы бешенство успешно ликвидировано, в основном благодаря оральной вакцинации диких животных. По оценке Всемирной организации здравоохранения (ВОЗ), риск заражения человека бешенством особенно высок в Евразии, южной части Латинской Америки и на Африканском континенте. Несмотря на проводимые мероприятия по ограничению распространения рабической болезни, полностью ликвидировать бешенство животных на территории конкретных субъектов РФ до сих пор не удалось, а многие аспекты функционирования паразитарных систем бешенства до сих пор остаются недостаточно изученными.


Ключевые слова:

бешенство, резервуар, антропургический цикл, домашние животные, дикие животные, рабический вирус, профилактика, вакцинация.


Список литературы:

1. Аникеев М. А. Эпизоотическая ситуация по бешенству мелких домашних и диких животных в Московской области. Данные за 2004–2006 гг. // Рос. ветеринарный журн. 2006. № 4. С. 9–10.

2. Барышников П. И., Андрейцев К. М. Эпизоотический процесс при бешенстве животных в Алтайском крае. Данные за 1950–2000 гг. // Ветеринария. 2008. № 6. С. 22–25.

3. Хадарцев О. С., Котова Е. А., Ведерников В. А. Бешенство в Российской Федерации в 2000–2005 годах : информ. бюл. М., 2006.

4. Заводских А. И. и др. Бешенство енотовидных собак в Московской области (данные за 1976–2005 гг.) // Ветеринария. 2006. № 11. С. 6–7.

5. Гулюкин М. И., Ведерников В. А. Ситуация уже кризисная // Ветеринарная жизнь. 2008. № 12. С. 6–8.

6. Иванов А. В. и др. Диагностика и профилактика бешенства животных. М. : Росинформагротех, 2007. 57 с.

7. Иванов А. В., Хисматуллина Н. А., Гулюкин А. М. Эпизоотологический и иммунологический надзор за бешенством // Ветеринарный врач. 2010. № 4. С. 3–6.

8. Макаров В. В. Бешенство в Восточной Европе: актуальный вектор развития эпизоотического процесса // Вестник РАСХН. 2008. № 4. С. 58–59.

9. Ведерников В. А. и др. Обзор эпизоотической ситуации по бешенству в Российской Федерации в 2013 году и первом полугодии 2014 года. М., 2014.

10. Показий А. Г., Давыдова Т. Н. Паразитарная система бешенства в Челябинской области. Данные за 2000–2006 гг. // Актуальные вопросы ветеринарной медицины и биологии. 2007. С. 125–128.

11. Полещук Е. М., Сидоров Г. Н., Березина Е. С. Бешенство животных в России в 2007–2011 гг. // Рос. ветеринарный журн. 2012. № 6. С. 8–12.


Скачать статью в PDF: АВУ_октябрь_2015.19-24.pdf (436.8 КБ)

ЭПИЗООТИОЛОГИЧЕСКИЕ АСПЕКТЫ БЕШЕНСТВА ЕНОТОВ ВО ФЛОРИДЕ | Американский журнал эпидемиологии

Получить помощь с доступом

Институциональный доступ

Доступ к контенту с ограниченным доступом в Oxford Academic часто предоставляется посредством институциональных подписок и покупок. Если вы являетесь членом учреждения с активной учетной записью, вы можете получить доступ к контенту следующими способами:

Доступ на основе IP

Как правило, доступ предоставляется через институциональную сеть к диапазону IP-адресов.Эта аутентификация происходит автоматически, и невозможно выйти из учетной записи с проверкой подлинности IP.

Войдите через свое учреждение

Выберите этот вариант, чтобы получить удаленный доступ за пределами вашего учреждения.

Технология Shibboleth/Open Athens используется для обеспечения единого входа между веб-сайтом вашего учебного заведения и Oxford Academic.

  1. Щелкните Войти через свое учреждение.
  2. Выберите свое учреждение из предоставленного списка, после чего вы перейдете на веб-сайт вашего учреждения для входа в систему.
  3. Находясь на сайте учреждения, используйте учетные данные, предоставленные вашим учреждением. Не используйте личную учетную запись Oxford Academic.
  4. После успешного входа вы вернетесь в Oxford Academic.

Если вашего учреждения нет в списке или вы не можете войти на веб-сайт своего учреждения, обратитесь к своему библиотекарю или администратору.

Войти с помощью читательского билета

Введите номер своего читательского билета, чтобы войти в систему. Если вы не можете войти в систему, обратитесь к своему библиотекарю.

Члены общества

Многие общества предлагают своим членам доступ к своим журналам с помощью единого входа между веб-сайтом общества и Oxford Academic. Из журнала Oxford Academic:

  1. Щелкните Войти через сайт сообщества.
  2. При посещении сайта общества используйте учетные данные, предоставленные этим обществом. Не используйте личную учетную запись Oxford Academic.
  3. После успешного входа вы вернетесь в Oxford Academic.

Если у вас нет учетной записи сообщества или вы забыли свое имя пользователя или пароль, обратитесь в свое общество.

Некоторые общества используют личные аккаунты Oxford Academic для своих членов.

Личный кабинет

Личную учетную запись можно использовать для получения оповещений по электронной почте, сохранения результатов поиска, покупки контента и активации подписок.

Некоторые общества используют личные учетные записи Oxford Academic для предоставления доступа своим членам.

Институциональная администрация

Для библиотекарей и администраторов ваша личная учетная запись также предоставляет доступ к управлению институциональной учетной записью. Здесь вы найдете параметры для просмотра и активации подписок, управления институциональными настройками и параметрами доступа, доступа к статистике использования и т. д.

Просмотр ваших зарегистрированных учетных записей

Вы можете одновременно войти в свою личную учетную запись и учетную запись своего учреждения. Щелкните значок учетной записи в левом верхнем углу, чтобы просмотреть учетные записи, в которые вы вошли, и получить доступ к функциям управления учетной записью.

Выполнен вход, но нет доступа к содержимому

Oxford Academic предлагает широкий ассортимент продукции.Подписка учреждения может не распространяться на контент, к которому вы пытаетесь получить доступ. Если вы считаете, что у вас должен быть доступ к этому контенту, обратитесь к своему библиотекарю.

(PDF) Роль барсука (Meles meles) в эпизоотологии бешенства и последствия для Великобритании

22 GC Smith

© 2002 Mammal Society, Mammal Review,32, 12–25

Artois, M. & Aubert , МИД (1985) Поведение бешеных лисиц. Revue d'Ecologie (Terre Vie), 40, 171–176.

Артуа, М., Обер, М., Бланку, Дж., Барра, Дж., Пулль, М.Л. & Stahl, P. (1991) Écologie des comportements

передачи ярости. Annales Recherches Veterinaires, 22, 163–172.

Artois, M., Aubert, M.F.A., Blancou, J. & Pericard, M. (1984) Rage expérimental du chat sensibilité – symp-

tômes – excretion du virus. Revue de Médecine Vétérinaire, 135, 281–287.

Artois, M., Langlais, M. & Suppo, C. (1997) Моделирование борьбы с бешенством среди растущей популяции лисиц.

Экологическое моделирование, 97, 23–34.

Артуа, М., Массон, Э., Баррат, Дж. и Обер, М.Ф.А. (1993) Эффективность трех пероральных приманок против бешенства у красной лисицы

: сравнение. Ветеринарная микробиология, 38, 137–172.

Бэр, Г.М. (1991) Естественная история бешенства. Academic Press, Нью-Йорк, штат Нью-Йорк.

Бейкер, П. Дж. и Харрис, С. (2000) Уровень взаимодействия между членами группы городских лисиц. Обзор млекопитающих,

30, 239–242.

Баранаускас, К.(1992) Изменения в заселении барсучьих поселений в окрестностях Вильнюса за последнее

десятилетие. Сохранение мелких хищников, 6,4.

Барнард, Б.Дж.Х. (1979) Роль диких животных в эпизоотологии бешенства в Южной Африке и юго-

западной Африке. Журнал ветеринарных исследований Ондерстепорта, 46, 155–163.

Белл, Дж. Ф. и Мур, Г. Дж. (1971) Восприимчивость Carnivora к вирусу бешенства при пероральном введении. Американский журнал

эпидемиологии, 93, 176–182.

Бентил, Делавэр и Мюррей, Дж. Д. (1993) Моделирование туберкулеза крупного рогатого скота у барсуков. Журнал экологии животных, 62,

239–250.

Бланку, Дж. и Обер, М.Ф.А. (1997) Передача вируса гнева: важность барьера особого.

Бюллетень Национальной академии медицины, 181, 301–312.

Бланку, Дж., Обер, М.Ф.А. и Артуа, М. (1991) Бешенство лисы. В: Естественная история бешенства (под редакцией GM

Baer), стр. 257–290. CRC Press, Бостон, Массачусетс.

Бегель, К., Арата, А.А., Могле, Х. и Кнорпп, Ф. (1974) Восстановление сокращенных популяций лисиц при борьбе с бешенством.

Zentralblatt für Veterinaermedizin B, 21, 401–412.

Bögel, K., Moegle, H., Knorpp, F., Arata, A., Dietz, K. & Diethelm, P. (1976) Характеристики распространения

эпидемии бешенства среди диких животных в Европе. Бюллетень Всемирной организации здравоохранения, 54, 433–447.

Бегель, К., Шаал, Э. и Могле, Х. (1977) Значение куниц как переносчиков бешенства среди диких животных в

Европе.Zentralblatt Fur Bakteriologie Hygiene I Abt Originale A, 238, 184.

Brochier, B., Blancou, J., Thomas, I., Languet, B., Artois, M., Kieny, MP, Lecocq, JP, Costy, Ф., Десметтре,

П., Шаппюи, Г. и Пасторе, П.П. (1989) Использование рекомбинантного гликопротеинового вируса коровьей оспы и бешенства для пероральной вакцинации диких животных против бешенства

: безвредность для нескольких нецелевых видов, потребляющих приманку. Журнал

Болезни диких животных, 25, 540–547.

Чарльтон, К.М., Вебстер, В.А. и Кейси, Г.А. (1991) Бешенство скунса. В: Естественная история бешенства (под редакцией

GM Baer), стр. 307–324. CRC Press, Бостон, Массачусетс.

Cheeseman, C.L., Cresswell, WJ, Harris, S. & Mallinson, PJ (1988) Сравнение расселения и других перемещений в двух популяциях барсуков (Meles meles). Обзор млекопитающих, 18, 51–59.

Чизман, К.Л., Уайлсмит, Дж.В., Райан, Дж. и Маллинсон, П.Дж. (1987) Динамика популяции барсуков в районе с высокой плотностью населения.Симпозиумы Лондонского зоологического общества, 58, 279–294.

Кристиан, С.Ф. (1994) Распространение и другие межгрупповые перемещения у барсуков, Meles meles. Zeitschrift für

Säugetierkunde, 59, 218–223.

Civardi, A. (1991) Esperienze Italiene di immunizzazione delle volpi contro la rabbia: validita del metodo

e risultati ottenuti. Гистрикс, 3, 159–165.

Крессвелл, В.Дж., Харрис, С. , Чизман, К.Л. и Маллинсон, П. Дж. (1992) Разводить или не разводить: анализ

социальных и зависящих от плотности ограничений на плодовитость самок барсуков (Meles meles).Philo-

Sophical Transactions of the Royal Society of London B, 338, 393–407.

Крессвелл П., Харрис С. и Джеффрис Д.Дж. (1990) История, распространение, статус и требования к среде обитания

барсука в Великобритании. Совет по охране природы, Питерборо, Великобритания.

Дауст, П.Ю., Ванделер, А.И. и Кейси, Г.А. (1996) Кластер случаев бешенства вероятного происхождения от летучих мышей среди красных

лисиц на острове Принца Эдуарда, Канада. Журнал болезней диких животных, 32, 403–406.

Энглунд, Дж. (1980) Динамика популяции рыжей лисицы (Vulpes vulpes L., 1758) в Швеции. В: The Red Fox

(под редакцией Э. Зимена), стр. 107–121. Biogeographica № 18. Хлам, Гаага, Нидерланды.

Förster, U. (1978) Zur Frage der Adaptationsfähigkeit von zwei Mitteleuropa isolierten Tollwutvirusstämmen

an eine domestizierte und zwei wildlebende Spezies – Ein Beitrag zur Epidemiologie der Tollwut. 1.

Mitteiling: Übertragungsversuche mit Wieseln.Zentralblatt für Veterinaermedizin B, 25, 394–405.

Джордж, Дж. П., Джордж, Дж., Бланку, Дж. и Обер, М.Ф.А. (1980) Description clinique de la rage du renard: étude

expérimental. Revue de Médecine Vétérinaire, 131, 153–160.

Goszczynski, J. (1979) Проникновение млекопитающих в городские зеленые насаждения в Варшаве. Acta Theriologica, 24,

419–423.

Бешенство летучих мышей в Гватемале

Abstract

Бешенство у летучих мышей считается энзоотическим во всем Новом Свете, но для большинства стран региона имеется мало сравнительных данных.В рамках более крупной программы обнаружения патогенов в Гватемале в период с 2009 по 2011 год проводился усиленный эпиднадзор за бешенством летучих мышей. В общей сложности были взяты образцы и протестированы на бешенство 672 летучих мышей 31 вида. Распространенность обнаружения вируса бешенства (RABV) среди всех собранных летучих мышей была низкой (0,3%). Были обнаружены вирусные антигены и выделен инфекционный вирус из мозга двух обыкновенных летучих мышей-вампиров ( Desmodus rotundus ). RABV также был выделен из оральных смывов, легких и почек обеих летучих мышей, тогда как вирусная РНК была обнаружена во всех тканях, исследованных с помощью полугнездовой ОТ-ПЦР, за исключением печени одной летучей мыши.Секвенирование гена нуклеопротеина показало, что оба вируса были на 100% идентичны, тогда как секвенирование гена гликопротеина выявило одну несинонимичную замену (302 T,S ). Два изолята RABV летучих мышей-вампиров в этом исследовании были филогенетически связаны с вирусами, связанными с летучими мышами-вампирами в восточных штатах Мексики и Сальвадора. Кроме того, 7% сывороток, собранных у 398 летучих мышей, продемонстрировали нейтрализующие RABV антитела. Доля серопозитивных летучих мышей значительно различалась по трофическим гильдиям, что свидетельствует о сложной внутривидовой компартментализации сохранения RABV.

Резюме автора

В этом исследовании мы представляем результаты первого активного и масштабного наблюдения за циркуляцией вируса бешенства (RABV) среди летучих мышей в Гватемале. Исследование включало несколько географических районов и несколько видов летучих мышей, чтобы оценить более широкие риски для здоровья населения и ветеринарии, связанные с бешенством у летучих мышей в Гватемале. RABV был выделен от летучих мышей-вампиров ( Desmodus rotundus ), собранных в двух разных местах в Гватемале. Секвенирование изолятов выявило более тесную связь с изолятами летучих мышей-вампиров из Мексики и Центральной Америки, чем с изолятами из Южной Америки.Обнаружение нейтрализующих RABV антител у 11 видов, включая насекомоядных, плодоядных и кровоядных летучих мышей, демонстрирует циркуляцию вируса как у гематофагов, так и у негематофагов летучих мышей в Гватемале. Присутствие RABV летучих мышей в сельских общинах требует новых стратегий санитарного просвещения в отношении контактов с летучими мышами, улучшения лабораторного наблюдения за животными, связанными с воздействием на человека, и новых методов современной профилактики бешенства и борьбы с ним. Кроме того, медицинские работники должны уделять особое внимание сбору подробного анамнеза, включая вопросы, касающиеся контакта с летучими мышами, для пациентов с клиническими синдромами, совместимыми с бешенством или любым клинически диагностированным прогрессирующим энцефалитом.

Образец цитирования: Эллисон Дж. А., Гилберт А. Т., Рекуэнко С., Моран Д., Альварес Д. А., Кузьмина Н. и др. (2014) Бешенство летучих мышей в Гватемале. PLoS Negl Trop Dis 8(7): е3070. https://doi.org/10.1371/journal.pntd.0003070

Редактор: Maya Williams, Отдел медицинских исследований ВМС США № 2, Индонезия

Получено: 10 февраля 2014 г.; Принято: 23 июня 2014 г.; Опубликовано: 31 июля 2014 г.

Это статья с открытым доступом, свободная от каких-либо авторских прав, и может быть свободно воспроизведена, распространена, передана, изменена, дополнена или иным образом использована кем угодно в любых законных целях. Работа доступна в качестве общественного достояния Creative Commons CC0.

Финансирование: Эта работа была частично поддержана Глобальной программой обнаружения заболеваний CDC, Корпус технической поддержки. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Летучие мыши (Отряд: Chiroptera) считаются хозяевами и резервуарами многочисленных возникающих инфекционных заболеваний и считаются одной из наиболее важных групп млекопитающих в изучении экологии болезней [1].Гватемала является домом для одного из самых богатых видов летучих мышей в мире, где насчитывается более 104 существующих видов [2]–[4]. В качестве одного из репрезентативных глобальных центров обнаружения заболеваний, созданных Центрами по контролю и профилактике заболеваний США, усиленный надзор за бешенством и обнаружение патогенов за последние пять лет на летучих мышах способствовали открытию многочисленных новых вирусных и бактериальных агентов [5]–[8]. Учитывая разнообразие и зоонозный потенциал патогенов, обнаруженных на сегодняшний день, наиболее острой зоонозной угрозой от летучих мышей в Гватемале является вирус Rabies (RABV), единственный Lyssavirus , зарегистрированный в Новом Свете [9].Клинически бешенство определяется у людей с острым прогрессирующим энцефалитом, в котором преобладают гиперактивность или паралитические синдромы, которые в конечном итоге ухудшаются до комы и смерти почти в 100% случаев [10].

Эпизоотология бешенства хорошо известна в странах с развитой лабораторной сетью эпиднадзора. В сочетании с молекулярной эпидемиологией расширенный и пассивный эпиднадзор используется для определения географического распространения вариантов RABV, вывода о временном и пространственном распространении инфекций, связанных с различными резервуарами-хозяевами, выявления побочных инфекций у людей и разработки соответствующей профилактики и контроля на основе таких данных. информация [11]–[13].Как правило, RABV можно разделить на две основные клады: одна включает варианты, связанные с хищниками по всему миру, а другая содержит варианты, связанные с летучими мышами, енотами и скунсами в Новом Свете. В Латинской Америке RABV классически признается двумя широко различными эпизоотологическими формами или «циклами», один «городской», в котором собаки могут служить основным резервуаром-хозяином и переносчиком, а другой — так называемый сельский или «лесной». цикла с участием диких животных [13].

RABV, передаваемый летучими мышами-вампирами ( Desmodus rotundus ), представляет собой наиболее очевидную угрозу для экономики и здоровья населения, связанную с летучими мышами [14].Летучие мыши-вампиры существуют только в Латинской Америке и варьируются от Тропика Рака в Мексике до Тропика Козерога в Аргентине и Чили [15]. Летучие мыши-вампиры включают три монотипных рода, и все три вида получают питание, питаясь кровью других позвоночных. Следствием этой уникальной биологической адаптации является то, что летучие мыши-вампиры очень эффективно передают RABV широкому кругу млекопитающих, прежде всего домашнему скоту, но также и людям, если предпочтительная добыча недоступна [16]. В Латинской Америке смертельные случаи от бешенства среди людей были связаны с распространением RABV от плодоядных и насекомоядных летучих мышей. Однако бремя смертности кажется незначительным по сравнению с бременем бешенства у людей, связанным с обыкновенной летучей мышью-вампиром [17]–[19].

Всемирная организация здравоохранения рекомендует проведение лабораторного эпиднадзора во всех энзоотических странах с RABV. Точные текущие измерения распространенности необходимы для профилактики и контроля бешенства, для оценки бремени болезни, мониторинга тенденций для оценки эффективности вмешательства в случае и для обеспечения надлежащего ведения вспышек [20].Система эпиднадзора за бешенством в Гватемале является пассивной: образцы от людей и животных с подозрением на бешенство собираются, отправляются и тестируются с помощью прямого теста на флуоресцентные антитела (DFA) в одной из двух лабораторий: Laboratorio Nacional de Salud в Вилья-Нуэва (главная объект) или Laboratorio de Ministryio de Agricultura, Ganadería y Alimentación (MAGA) в Кесальтенанго. За последние два десятилетия число зарегистрированных случаев бешенства среди людей уменьшилось. Собаки остаются основным переносчиком RABV и связаны примерно с 73% (44 из 60) случаев заболевания человека с 1994 по 2012 год.Однако 23% (14 из 60) этих случаев были связаны с неустановленным или неизвестным воздействием [21], [22]. В США многочисленные сообщения связывают насекомоядных летучих мышей с большинством случаев бешенства у людей без истории обычного воздействия RABV [23]. За тот же период времени в Гватемале, несмотря на обнаружение более 200 случаев бешенства среди домашнего скота и подозрение на связь таких случаев с бешенством летучих мышей-вампиров, случаев у летучих мышей не зарегистрировано.

Почему RABV не был обнаружен у гватемальских летучих мышей, неясно, учитывая, что RABV был обнаружен у большинства видов летучих мышей, протестированных по всей Северной Америке [24].Очень немногие летучие мыши тестируются на основе существующей системы пассивного надзора, а моноклональные антитела или генетическая характеристика вариантов RABV, заражающих людей, домашних животных и диких животных, не проводятся. Учитывая ночной и несколько загадочный характер летучих мышей, динамику передачи трудно изучать в естественных популяциях, и остается много критических пробелов для базового понимания эпизоотологии различных вариантов RABV, сохраняющихся в определенных таксонах летучих мышей. В настоящем исследовании мы сообщаем о результатах полевых исследований, проведенных в Гватемале в 2009–2011 годах.Цель исследования состояла в том, чтобы проверить, будет ли усиленный надзор: (1) дополнять пассивный надзор, особенно в отношении присутствия RABV у летучих мышей, и (2) расширять информацию о географическом распределении циркуляции RABV среди летучих мышей для оценки общественного и ветеринарного надзора. риски для здоровья, связанные с летучими мышами в Гватемале.

Методы

Заявление об этике

Все животные были отловлены и с ними обращались в соответствии с национальными рекомендациями (Руководство по уходу и использованию лабораторных животных) [25].Протоколы отлова и использования животных были одобрены Комитетом CDC по уходу и использованию животных (США) протокол № 1843 и 2096, а также Комитетом по уходу и использованию животных Университета Валье-де-Гватемала (Гватемала).

Выборка для расширенного наблюдения

Гватемала была выбрана в качестве одного из основных сравнительных исследований Нового Света в рамках программы глобального обнаружения заболеваний (GDD) Центров по контролю и профилактике заболеваний США (CDC) среди десяти международных мест.Целью программы CDC GDD является развитие и укрепление глобального потенциала для быстрого обнаружения, точной идентификации и оперативного сдерживания возникающих инфекционных угроз. Девятнадцать полевых участков для отбора проб летучих мышей в Гватемале были выбраны на основе исторических вспышек бешенства, современных данных национального эпиднадзора, известных или подозреваемых нападений летучих мышей-вампиров на человеческие популяции или неврологических заболеваний, зарегистрированных у домашнего скота. Рисунок 1а иллюстрирует географическое распределение полевых участков, использованных в настоящем исследовании.Летучих мышей собирали с помощью противотуманных сетей, установленных возле фруктовых деревьев, загонного скота или у входа в пещеры. Сети открывали с 19:00 до 00:00 и проверяли каждые 30 минут. Летучих мышей извлекали из паутинных сетей, помещали по отдельности в тканевые мешки и транспортировали на ближайшую временную полевую станцию, где им вводили 0,05–0,1 мг внутримышечной инъекции кетамина гидрохлорида, брали оральные/фекальные мазки и собирали конечные образцы крови. путем пункции сердца под сильным наркозом.После эвтаназии летучие мыши были идентифицированы до уровня видов по ключу для летучих мышей Коста-Рики [26]. Также были собраны стандартные морфологические измерения (например, пол, возраст, масса и длина предплечья). Затем было проведено полное вскрытие всех летучих мышей, и образцы были немедленно сохранены на сухом льду в полевых условиях, а затем хранились при температуре -70 ° C в лаборатории Университета Валье-де-Гватемала до отправки в лабораторию CDC по изучению бешенства в Атланте. Г.А. Туши связывали и фиксировали в 10% забуференном формалине на несколько дней, а затем навсегда переводили в 70% этанол для архивных целей.

Рис. 1. Карта выбранных полевых участков, Гватемала, 2009–2011 гг.

(A) Желтыми кружками обозначены 19 мест, где летучие мыши были протестированы на антиген RABV, а размер круга пропорционален количеству собранных летучих мышей. (B) Красные кружки обозначают расположение десяти участков, где были доступны сыворотки для тестирования рВНК, а размер круга пропорционален уровню серопревалентности рВНК среди протестированных летучих мышей. Местоположение двух зараженных бешенством летучих мышей-вампиров ( D. rotundus ) обозначено зелеными звездочками.

https://doi.org/10.1371/journal.pntd.0003070.g001

Прямой флуоресцентный тест на антитела

Слепки мозга, полученные из замороженных тканей летучих мышей, фиксировали в ацетоне при -20°C, и антигены RABV определяли с помощью теста DFA с использованием конъюгата моноклональных антител (mAb), меченных флуоресцеинизотиоцианатом (FITC) (Fujirebio Diagnostics, Inc., Malvern). , Пенсильвания, США), как описано [27].

Серология

Наличие нейтрализующих антител к RABV (rVNA) определяли с помощью экспресс-теста ингибирования фокуса флуоресценции (RFFIT) или модифицированного микро-RFFIT-теста на сыворотках, собранных в десяти полевых условиях [28], [29].Титры рВНК отдельных летучих мышей рассчитывали по методу Рида-Мюнха и переводили в международные единицы (МЕ/мл) путем сравнения со стандартным контролем антирабического иммуноглобулина (SRIG), содержащим 2 МЕ/мл [30]. Титр SRIG, как правило, был выше в тесте micro-RFFIT по сравнению со стандартным RFFIT. Для целей данного исследования положительные титры рВНК (≥0,06 МЕ/мл) определялись по крайней мере 50% нейтрализацией дозы вируса RABV (50 доз, формирующих фокус) в разведении 1∶5 (RFFIT) или 1∶10 разведение (микро-RFFIT).Конечные титры менее 0,06 МЕ/мл считались отрицательными в связи с наличием рВНА для целей данного исследования.

Антигенная характеристика

Антигенная характеристика была выполнена методом непрямой иммунофлуоресценции с использованием восьми mAb, направленных против антигенов нуклеопротеина (N) RABV (C1, C4, C9, C10, C12, C15, C18, C19), поставляемых EMD Millipore Corporation (Биллерика, Массачусетс, США). , как описано ранее [31]. Результаты картины положительной реактивности были проанализированы с использованием описанных ранее картин антигенных вариантов [32], [33].

Выделение вируса

Была предпринята попытка выделения вируса из оральных и фекальных мазков, хранившихся в питательной среде (MEM-10), и органов, полученных от DFA-положительных летучих мышей. Гомогенаты (10% масс./об.) готовили в пробирках для гомогенизатора ткани MagnaNA lyser, содержащих керамические шарики диаметром 1,4 мм (Roche Applied Science, Пенцберг, Германия), с использованием 1,0 мл MEM-10 в качестве разбавителя. Весь раствор из орального мазка и 0,5 мл из фекального мазка использовали для инокуляции клеток для выделения. Для выделения вируса 100 мкл тестируемого инокулята добавляли к 1 мл MEM-10, содержащей 5×10 6 клеток нейробластомы мыши (MNA) в колбе для тканевых культур Т-25 (Corning, NY).Колбы с тканевой культурой инкубировали при 0,5% CO 2 при 37°C в течение 72 часов. Все культуры подвергали субпассированию не менее четырех раз. Для оценки инфекционности на покрытые тефлоном предметные стекла с четырьмя лунками засевают 30 мкл MEM-10, содержащего 0,5×10 6 клеток на мл, и инкубируют во влажной камере при 0,5% CO 2 при 37°C в течение 24 часов. . Затем предметные стекла промывали фосфатно-солевым буфером (PBS 4550) и фиксировали в холодном ацетоне при -20°C в течение одного часа. Антигены RABV визуализировали с помощью теста DFA с использованием оптимальных рабочих разведений конъюгата mAb против RABV, меченного FITC (Fujirebio Diagnostics, Inc., Малверн, Пенсильвания, США) после каждого прохода.

Экстракция РНК, обратная транскрипция и ПЦР

Тотальную РНК экстрагировали из фекальных мазков и тканей органов инфицированных RABV летучих мышей с использованием реагента TRIZol (Invitrogen, Карлсбад, Калифорния, США). Фекальные мазки хранили в 1 мл МЕМ-10 в полевых условиях, а 200 мкл взвеси мазков смешивали с 1 мл ТРИзола для выделения РНК. Подбирали праймеры внутри кодирующей области гена N и проводили начальную реакцию со смысловым праймером 1066F, GARAGAAGATTCTTCAGRGA (положения 1157–1173), который также использовали для обратной транскрипции, и антисмысловым праймером 304B, TTGACGAAGATCTTGCTCAT (положения 1514–1533).Полувложенную реакцию проводили со смысловым праймером 1087F, GAGAARGAACTTCARGA (позиции 1157–1173). Ген гликопротеина (G) амплифицировали в виде двух перекрывающихся фрагментов с использованием комбинаций праймеров umf2/994b и 760f/308b, как описано ранее [34]. Все позиции даны в соответствии с последовательностью генома штамма Street Alabama Dufferin RABV (инвентарный номер GenBank M31046). ОТ-ПЦР проводили, как описано в другом месте [35]. Положительные результаты были подтверждены секвенированием нуклеотидов. Продукты ОТ-ПЦР очищали с помощью системы очистки ДНК Wizard PCR Preps (Promega, Мэдисон, Висконсин, США) в соответствии с рекомендациями производителя и секвенировали в прямом и обратном направлениях, как описано в [35], с использованием готового к секвенированию цикла Big Dye Terminator Cycle Sequencing Ready. Реактивный комплект, версия 1.1 на секвенаторе ABI3770 (Applied Biosystems, Карлсбад, Калифорния, США).

Филогенетический анализ

Полные последовательности N и G были собраны и транслированы в аминокислотные последовательности с использованием программы Bio Edit [36]. Набор данных был дополнен полными и частичными последовательностями генов, доступными из GenBank и выровненными в ClustalX [37]. В таблице S1 описаны подробности обо всех последовательностях, использованных в этом исследовании, включая инвентарные номера, страну происхождения, год и источник образца. Модель GTR+I+G была выбрана на основе байесовского фактора и критерия Акаике, оцененных в MEGA, версия 5.1. Оценка молекулярных часов не проводилась. Анализ был выполнен с использованием байесовской популяции горизонтов ранее, и были выполнены два независимых прогона цепи Маркова Монте-Карло (MCMC) с 1 000 000 итераций каждый. Результаты были объединены в Log Combiner, и результирующее дерево максимального доверия к кладам (MCC) было создано с помощью Tree Annotator с использованием 20% для записи и визуализировано в Fig Tree, версия 1. 4.0 [38].

Статистический анализ

Все статистические анализы были выполнены с использованием JMP версии 9.0.2 или SAS версии 9.2 (SAS Institute Inc., Кэри, Северная Каролина). Были рассчитаны 95% доверительные интервалы (ДИ) для долей серопозитивных летучих мышей по видам и местам отлова. Вложенная смешанная логистическая модель использовалась для проверки влияния трофической гильдии на серопревалентность. Виды, вложенные в трофическую гильдию, рассматривались как случайный эффект, а трофическая гильдия рассматривалась как фиксированный эффект. Поскольку тестировался только один кровоядный вид, мы также сравнили результаты модели с набором данных, исключая летучих мышей-вампиров.Распространенность антител между полами также сравнивалась с использованием тестов χ 2 , и уровень значимости оценивался как α = 0,05.

Результаты

Географическое распределение выборки летучих мышей

В течение 2009–2011 гг. в Гватемале было собрано в общей сложности 672 летучих мыши 31 вида. Летучих мышей собирали в течение 2009 г. (n = 220; таблица S1), 2010 г. (n = 135; таблица S2) и 2011 г. (n = 317; таблица S3). В Таблице 1 представлена ​​подробная информация о совокупной частоте поимки по видам.Среди всех пойманных 56,3% были мужчинами. Наиболее часто отлавливаемым видом был D. rotundus (n = 200; 30%), за ним следует ямайская летучая мышь Artibeus jamaicensis (n = 128; 19%) (табл. 1).

Серологические признаки циркуляции RABV у летучих мышей

В сыворотке, доступной для тестирования (n = 398), у 28 летучих мышей обнаружена обнаруживаемая рВНА при распространенности антител 7% (95% ДИ 5–10%). Серопревалентность была самой высокой для насекомоядных видов (21%), за ними следуют всеядные (8%) и кровоядные (9%) таксоны.Доля серопозитивных по rVNA летучих мышей значительно различалась по трофическим гильдиям в полном наборе данных (F 3,20  = 4,65, p = 0,04; летучие мыши-вампиры (F 2,20  = 6,97, p = 0,005; видов (диета) = 4,4×10 −19 ). В обеих моделях парные контрасты выявили достоверную разницу между плодоядными и насекомоядными летучими мышами. Вероятность серопозитивности насекомоядных летучих мышей в 8,5 раз выше, чем у плодоядных летучих мышей.Никакие другие парные контрасты в серопревалентности rVNA между уровнями трофической гильдии не были значительными. Среди мест отлова доля серопозитивных летучих мышей была самой высокой в ​​Наранхо (21%), за ним следуют Эль Джобо (19%) и Эль Пенате (11%). В Таблице 2 представлены данные по отдельным видам летучих мышей, отобранных по местонахождению и трофической гильдии. Распространенность антител между полами была одинаковой (3,8% мужчин, 3,3% женщин; P  = 0,77). Видовой состав отловленных летучих мышей различался по участкам (табл. 2).

Выявление RABV и антигенное типирование

антигенов RABV были обнаружены в головном мозге двух обыкновенных летучих мышей-вампиров. Летучие мыши были собраны в Эль-Пумпо, недалеко от побережья Тихого океана в департаменте Санта-Роза, и Пало-Секо, недалеко от границы с Мексикой в ​​департаменте Сан-Маркос (рис. 1b). Картина антигенной реакции, полученная из образцов головного мозга, соответствовала антигенному варианту V3 RABV, связанному с Desmodus rotundus (таблица 3). При поимке у одной из двух бешеных летучих мышей проявились клинические признаки, соответствующие заражению бешенством.Кроме того, эта летучая мышь была обезвожена, находилась в плохом физическом состоянии и имела следы нескольких укусов на теле.

Выделение RABV и обнаружение вирусной РНК методом полувложенной обратной транскрипции-ПЦР

RABV было выделено в клетках МНА через 24 ч после инокуляции из почек одной летучей мыши и из оральных смывов обеих бешеных летучих мышей. Дополнительные субпассажи выявили присутствие RABV в селезенке одной летучей мыши, а также в почках и легких у обеих летучих мышей. RABV не был выделен из сердца, печени, кишечника и фекальных мазков.Вирусная РНК была обнаружена методом полугнездовой ОТ-ПЦР во всех исследованных образцах, кроме печени летучей мыши 321. Результаты выделения RABV и обнаружения нуклеиновых кислот из тканей бешеных летучих мышей представлены в табл. 4.

Регистрационные номера GenBank

В общей сложности две последовательности RABV G и две последовательности N RABV были созданы из тканей мозга инфицированных летучих мышей в этом исследовании и депонированы в GenBank (номера доступа: KF656696-99).

Молекулярные взаимоотношения между RABV, связанными с летучими мышами-вампирами в Латинской Америке

Последовательности гена N обоих вирусов были на 100% идентичны, тогда как последовательности G отличались одной несинонимичной заменой (302 T,S ).Вирусы были наиболее похожи на одну из линий вирусов бешенства летучих мышей-вампиров, циркулирующих в Мексике, и были относительно далеки от линий, циркулирующих в Южной Америке, за исключением колумбийских линий. Наиболее филогенетически родственные вирусы были описаны ранее из штатов Чьяпас, Табаско и Веракрус в восточной Мексике [39]. Единственная доступная последовательность гена RABV летучей мыши-вампира из Сальвадора (FJ228492) также сгруппирована в этой линии (рис. 2, реконструкция гена G не показана).

Рис. 2. Дерево максимальной достоверности ветвей вирусов бешенства на основе полных последовательностей генов нуклеопротеинов (N).

Для ключевых узлов показаны апостериорные вероятности. Мексиканская собака RABV использовалась в качестве аутгруппы. Новые последовательности, полученные из материала ЦНС двух бешеных летучих мышей-вампиров в этом исследовании, показаны красным цветом.

https://doi.org/10.1371/journal.pntd.0003070.g002

Обсуждение

Учитывая критическую экологическую важность летучих мышей, особенно в тропических регионах, необходимы новые стратегии для предотвращения и контроля зоонозов, связанных с летучими мышами.Насколько нам известно, это первое сообщение и выделение RABV от летучих мышей в Гватемале. В этом исследовании распространенность бешенства среди всех собранных летучих мышей была низкой (0,3%), даже среди летучих мышей-вампиров (1%). Два выделенных RABV летучих мышей-вампиров были филогенетически связаны с вирусами, связанными с летучими мышами-вампирами в восточных штатах Мексики и Сальвадора, что не является неожиданным, учитывая их географическую близость. Эпизоотии бешенства и филогенетические кластеры RABV, циркулирующие в популяциях летучих мышей-вампиров, относительно ограничены в пространстве [40], [41].Предыдущие филогеографические исследования показали, что бешенство летучих мышей-вампиров, вероятно, возникло на территории Мексики [39]. Если это правда, эти вирусы могли быть занесены в Гватемалу и Сальвадор через восточную Мексику. Обнаружение rVNA у летучих мышей в этом исследовании продемонстрировало воздействие RABV на несколько видов летучих мышей в Гватемале. Общая распространенность рВНА, составляющая 7%, была аналогична другим исследованиям по наблюдению RABV у летучих мышей, проведенным в Перу (10,3%), Гренаде (7,6%) и Тринидаде (12,8%), но меньше, чем обнаружение 37% в Колиме, Мексика [42]. [44].Серопревалентность среди мест сбора колебалась от 0 до 21% среди всех летучих мышей и от 0 до 25% для D. rotundus соответственно. Наши результаты согласуются с предыдущими исследованиями, демонстрируя, что значительная часть внешне здоровых летучих мышей имеет обнаруживаемый рВНА, что указывает на предыдущее воздействие RABV и предполагает устранение периферической инфекции без клинического заболевания [42]–[44]. Наличие рВНА свидетельствует только о предшествующем воздействии антигенов RABV и не дает информации о сроках, интенсивности или частоте инфекции [45].Кроме того, отрицательные результаты теста на рВНА не гарантируют отсутствия воздействия и могут варьироваться в зависимости от выбранного порогового значения, используемого для серологического теста, согласно обзору Gilbert et al. [46]. На уровне популяции описанные здесь данные о распространенности рВНА предоставляют информацию о кумулятивной истории воздействия среди всех летучих мышей, собранных для каждого полевого участка.

У экспериментально инфицированных летучих мышей рВНА обычно вырабатывается только среди выживших, а летучие мыши, погибшие от инфекции, могут сероконверсировать только на поздних стадиях клинического заболевания [45].Аналогичные наблюдения были сделаны в отношении сероконверсии рВНА у людей, больных бешенством [47]. В сочетании с результатами обнаружения антигена данные о распространенности рВНА могут быть использованы для выяснения динамики инфекции в популяциях летучих мышей. Обнаружение экскреции RABV может дать важную информацию для выявления потенциальных путей передачи, которые могут дать информацию о структуре динамических моделей болезни. В этом исследовании самые высокие уровни вируса постоянно обнаруживались в мазках из полости рта, ткани почек и легких.Эти результаты подтверждают первичную секрецию пероральным путем, а также предполагают возможный путь с мочой (через почки), что требует дальнейшего изучения.

Стратегии борьбы с вирусом RABV, передаваемым летучими мышами-вампирами в Латинской Америке, исторически основывались на методах сокращения популяции, либо путем неспецифического уничтожения насестов, либо с помощью антикоагулянтов, применяемых к крупному рогатому скоту или отдельным особям летучих мышей. Предполагается, что когда антикоагулянтную пасту наносят на летучих мышей-вампиров, обработанные летучие мыши затем возвращаются в насест, где распространяются на других сородичей посредством аллогруминга.Считается, что выбраковка летучих мышей-вампиров приносит пользу сельскому хозяйству и общественному здравоохранению в краткосрочной перспективе, облегчая укусы летучих мышей домашнего скота и людей соответственно. Однако существует мало доказательств того, что этот метод действительно нацелен на бешеных летучих мышей, и очевидное положительное влияние выбраковки на серопревалентность в сочетании с демографическими и поведенческими реакциями может фактически увеличить долю восприимчивых летучих мышей [41], [48]. Недавний отчет также предполагает, что может быть экономически более выгодно поддерживать доконтактную вакцинацию крупного рогатого скота, чем полагаться на выбраковку летучих мышей-вампиров [49].

Надзор за бешенством на национальном уровне в Гватемале находится в ведении Министерства здравоохранения и социального обеспечения [50]. Усилия по борьбе с бешенством в Гватемале сосредоточены в первую очередь на массовой вакцинации домашних собак, что привело к значительному снижению случаев заболевания бешенством среди людей, хотя остается неясным, могут ли текущие усилия достичь окончательной ликвидации собачьего бешенства [21], [51]. Непрямая вакцинация летучих мышей-вампиров рекомбинантными вакцинами RABV доказала свою иммуногенность и эффективность на экспериментальных моделях заражения D. rotundus , хотя эта стратегия не была проверена в полевых условиях [52]. Несмотря на возможное снижение заражения крупного рогатого скота RABV, эта стратегия не устранит поведенческие или медицинские и экономические последствия (например, вторичные бактериальные инфекции) нападения летучих мышей-вампиров на крупный рогатый скот. Вмешательства в области взаимодействия человека и летучих мышей должны быть направлены на снижение риска контакта человека с летучими мышами за счет улучшения просветительских кампаний о риске бешенства, связанного с летучими мышами, и важности лабораторных испытаний и профилактического лечения после контакта, а также жилищ, защищенных от летучих мышей. там, где это возможно [53].Для надлежащей оценки любой стратегии вмешательства необходим рутинный лабораторный эпиднадзор за RABV, который должен включать регистрацию и тестирование всех случаев укусов людей и животных, связанных с контактом с летучими мышами и другими резервуарными хозяевами. Для Гватемалы преодоление холодовой цепи и транспортных барьеров должно быть приоритетом для увеличения доли тестируемых случаев контакта. Для дальнейшего выяснения относительного воздействия городского или лесного циклов на здоровье населения и сельское хозяйство следует проводить рутинное типирование всех положительных случаев бешенства.Быстрый обмен информацией между секторами, участвующими в эпиднадзоре и борьбе с бешенством среди людей и животных, имеет важное значение.

К сожалению, несмотря на значительный прогресс в профилактике и борьбе с бешенством, при появлении клинических признаков у людей уровень летальности приближается к 100% даже при интенсивной поддерживающей терапии [47]. Однако надлежащая постконтактная профилактика, включающая немедленное промывание/промывание и дезинфекцию раны и быстрое введение АИГ, а также современные вакцины на основе клеточных культур в соответствии с рекомендуемыми схемами вакцинации, обеспечивает предотвращение бешенства в случае укуса бешеной летучей мышью [54].К счастью, современные вакцины на основе клеточных культур легко доступны как для людей, так и для животных в Гватемале, и национальным властям следует предоставить рекомендации по доконтактной профилактике для людей или животных, регулярно контактирующих с летучими мышами или другими потенциальными резервуарами диких животных (например, плотоядными).

Поскольку это первое целенаправленное исследование бешенства в Гватемале, в нашем исследовании были очевидны пробелы. Ограничения текущего исследования включали отсутствие более целенаправленной сезонной выборки, более широкий пространственный масштаб и необходимость более активного участия министерств здравоохранения и сельского хозяйства в контексте «Единого здоровья» для улучшения рутинного лабораторного эпиднадзора.Присутствие RABV летучих мышей в сельских общинах, вероятно, требует новых стратегий совместного санитарно-ветеринарного просвещения и информационно-разъяснительной работы, повышения доступности диагностических лабораторных испытаний в отдаленных районах и постоянного усиленного эпиднадзора для профилактики и борьбы с бешенством, как это предлагается для других развивающихся стран [55]. ], [56]. Дополнительные исследования взаимодействия человека и летучих мышей были бы полезны для получения информации о демографических характеристиках (например, возраст, пол, образование) лиц, подвергшихся воздействию летучих мышей, обстоятельствах контакта с летучими мышами (например,грамм. укусы, царапины, контакт с кожей), действия, предпринятые после воздействия, и знание зоонозов, переносимых летучими мышами. Ранее, по незнанию или бездействию, в результате контакта с летучими мышами происходили предотвратимые случаи бешенства человека [57]–[59]. Принимая во внимание последствия, когда такие рекомендации не работают, места с высоким риском заражения летучими мышами и зоонозов, переносимых летучими мышами, должны быть нацелены на лабораторные мероприятия по эпиднадзору для оценки надежных долгосрочных стратегий профилактики и контроля.

Благодарности

Авторы благодарят М. Моралеса-Бетуля, Р. Сираиса, Дж. Р. Мартинеса, Р. Медрано, Ф. Вильяторо, Л. Эскобара, М. Л. Мюллера, М. Р. Лопеса, Н. Росалес и А. Эстевеса за прекрасную помощь в полевых условиях и техническую помощь. .

Отказ от ответственности. Использование торговых наименований и коммерческих источников предназначено только для идентификации и не подразумевает одобрение со стороны Министерства здравоохранения и социальных служб США. Выводы и выводы, содержащиеся в этом отчете, принадлежат авторам и не обязательно отражают точку зрения их учреждений.

Вклад авторов

Задумал и разработал эксперименты: JAE ATG SR DM DAA KAL CER. Выполнены эксперименты: JAE ATG SR DM DAA NK DLG CER. Проанализированы данные: JAE ATG SR NK MTM CER. Предоставленные реагенты/материалы/инструменты анализа: JAE ATG SR DM DAA NK DLG LFP MTM KAL CER. Написал статью: JAE ATG SR DM DAA NK DLG LFP MTM KAL CER.

Каталожные номера

  1. 1. Луис А.Д., Хейман Д.Т., О'Ши Т.Дж., Крайан П.М., Гилберт А.Т. и другие. (2013) Сравнение летучих мышей и грызунов как резервуаров зоонозных вирусов: особенные ли летучие мыши? Труды Королевского общества B: Biological Sciences 280: 20122753.
  2. 2. Миклбург С.П., Хатсон А.М., Рэйси П.А. (2002) Обзор глобального статуса сохранения летучих мышей. Орикс 36: 18–34.
  3. 3. Маккарти Т.Дж., Дэвис В.Б., Хилл Дж.Е., Джонс Дж.К., Круз Г. А. (1993) Летучие мыши Mammalia: (Chiroptera) записи, ранние сборщики и списки фауны Северной Центральной Америки. Анналы музея Карнеги 62: 191–228.
  4. 4. Перес С.Г., Лопес Х.Е. (2012) Пять новых рекордов летучих мышей для Гватемалы. Chiroptera Neotropical 18: 1106–1110.
  5. 5.Тонг С., Ли И., Ривайлер П., Конрарди С., Кастильо Д.А. и др. (2012)Отличная линия вируса гриппа А от летучих мышей. Proc Natl Acad Sci USA 109: 4269–4274.
  6. 6. Бай Ю., Косой М., Рекуэнко С., Альварес Д., Моран Д. и др. (2011) Bartonella spp. в Батс, Гватемала. Emerg Infect Dis 17: 1269–1272.
  7. 7. Quan PL, Firth C, Conte JM, Williams SH, Zambrana-Torrelio CM, et al. (2013) Летучие мыши являются основным естественным резервуаром гепацивирусов и пегивирусов.Proc Natl Acad Sci U S A 110: 8194–8199.
  8. 8. Tao Y, Shi M, Conrardy C, Kuzmin IV, Recuenco S, et al. (2013) Открытие разнообразных полиомавирусов у летучих мышей и эволюционная история полиомавирусов. Дж. Ген Вирол 94: 738–748.
  9. 9. Rupprecht CE, Hanlon CA, Hemachudha T (2002) Повторное исследование бешенства. Ланцет Infect Dis 2: 327–343.
  10. 10. Панамериканская организация здравоохранения (2000 г.) Нормы и стандарты в эпидемиологии: определения случаев сибирской язвы, бруцеллеза и бешенства Epidemiol Bull.стр. 13–14.
  11. 11. Дайер Дж.Л., Уоллес Р., Орсиари Л., Хайтауэр Д., Ягер П. и др. (2013) Надзор за бешенством в США в 2012 г. J Am Vet Med Assoc 243: 805–815.
  12. 12. Rosatte RC (1987) Бешенство летучих мышей в Канаде: история, эпидемиология и профилактика. Can Vet J 28: 754–756.
  13. 13. Де Маттос К.С., Де Маттос К.А., Лоза-Рубио Э., Агилар-Сетиен А., Орсиари Л.А. и др. (1999) Молекулярная характеристика изолятов вируса бешенства из Мексики: последствия для динамики передачи и риска для человека.Am J Trop Med Hyg 61: 587–597.
  14. 14. Schneider MC, Romijn PC, Uieda W, Tamayo H, da Silva DF, et al. (2009) Бешенство, передаваемое человеку летучими мышами-вампирами: новое зоонозное заболевание в Латинской Америке? Преподобный Панам Салуд Публика 25: 260–269.
  15. 15. Гринхолл А.М., Йорманн Г., Шмидт У., Зайдель М.Р. (1983) Desmodus rotundus. Виды млекопитающих 202: 1–6.
  16. 16. Mayen F (2003)Летучие мыши-гематофаги в Бразилии, их роль в передаче бешенства, влияние на общественное здравоохранение, животноводство и альтернативы неизбирательному сокращению популяции летучих мышей.Журнал ветеринарной медицины, серия B 50: 469–472.
  17. 17. Favoretto SR, Carrieri ML, Cunha EM, Aguiar EA, Silva LH, et al. (2002) Антигенное типирование образцов бразильского вируса бешенства, выделенных от животных и людей, 1989–2000 гг. Rev Inst Med Trop Sao Paulo 44: 91–95.
  18. 18. Гонсалвес М.А., Са-Нето Р.Дж., Бразилия Т.К. (2002)Вспышка агрессии и передача бешенства людям летучими мышами-вампирами на северо-востоке Бразилии. Rev Soc Bras Med Trop 35: 461–464.
  19. 19. де Маттос К.А., Фави М., Юнг В., Павлетик С., де Маттос К.С. (2000)Бешенство летучих мышей в городских центрах в Чили. Дж. Уайлдл Дис 36: 231–240.
  20. 20. Всемирная организация здравоохранения (2010 г.) Консультация экспертов ВОЗ по бешенству: первый отчет: Всемирная организация здравоохранения.
  21. 21. Панамериканская организация здравоохранения (2013 г.) Эпидемиологическая информационная система SIEPI. Вашингтон, округ Колумбия.
  22. 22. Schneider MC, Belotto A, Ade MP, Leanes LF, Correa E, et al.(2005) Эпидемиологическая ситуация по бешенству среди людей в Латинской Америке в 2004 г. Epidemiol Bull 26: 2–4.
  23. 23. Messenger SL, Smith JS, Rupprecht CE (2002)Новая эпидемиология загадочных случаев бешенства, связанных с летучими мышами, у людей в Соединенных Штатах. Clin Infect Dis 35: 738–747.
  24. 24. Константин Д. (2009) Бешенство летучих мышей и другие лиссавирусные инфекции. Бешенство летучих мышей и другие лиссавирусные инфекции. Циркуляр USGS 1329, Рестон, Вирджиния, США.
  25. 25. Джанет С., Барби Р., Белицки Дж., Клейтон Л., Донован Дж. и др.. (2011) Руководство по уходу и использованию лабораторных животных. Вашингтон, округ Колумбия: Издательство национальных академий.
  26. 26. Тимм Р.М., Лаваль Р.К. (1998) Полевой ключ к летучим мышам Коста-Рики. Серия периодических публикаций, Центр латиноамериканских исследований Канзасского университета 22: 1–30.
  27. 27. Дин Д.Дж., Абельсет М.К., Атанасиу П. (1996) Тест на флуоресцентные антитела В: FX Meslin, MM. Каплан и Х. Копровски, редакторы. Лабораторные методы бешенства: Всемирная организация здравоохранения, Женева, Швейцария.стр. 88–95.
  28. 28. Smith J, Yager P, Baer G (1996) Быстрый тест ингибирования флуоресцентного фокуса (RFFIT) для определения антител, нейтрализующих вирус бешенства. Лабораторные методы лечения бешенства 4: 181–192.
  29. 29. Кузьмин И.В., Низгода М., Франка Р., Агванда Б., Маркоттер В. и соавт. (2008) Вирус летучих мышей Лагоса в Кении. J Clin Microbiol 46: 1451–1461.
  30. 30. Reed LJ, Muench H (1938) Простой метод оценки пятидесятипроцентных конечных точек. Американский журнал эпидемиологии 27: 493.
  31. 31. Smith JS, Reid-Sanden F, Roumillat L, Trimarchi C, Clark K, et al. (1986) Демонстрация антигенной изменчивости среди изолятов вируса бешенства с использованием моноклональных антител к нуклеокапсидным белкам. Журнал клинической микробиологии 24: 573–580.
  32. 32. Дайер Дж.Л., Низгода М., Орсиари Л.А., Ягер П.А., Эллисон Дж.А. и соавт. (2013)Оценка непрямого экспресс-теста иммуногистохимии для дифференциации вариантов вируса бешенства. J Virol Methods 190: 29–33.
  33. 33. Smith JS (1989) Эпитопная изменчивость вируса бешенства: использование в экологических исследованиях. Adv Virus Res 36: 215–253.
  34. 34. Эллисон Дж.А., Джонсон С.Р., Кузьмина Н., Гилберт А., Карсон В.К. и др. (2013) Мультидисциплинарный подход к эпизоотологии и патогенезу вирусов бешенства летучих мышей в США. Зоонозы Общественное здравоохранение 60: 46–57.
  35. 35. Кузьмин И.В., Орчиари Л.А., Араи Ю.Т., Смит Дж.С., Хэнлон К.А. и др. (2003) Лиссавирусы летучих мышей (Араван и Худжанд) из Центральной Азии: филогенетические взаимоотношения по последовательностям генов N, P и G.Вирус Рез 97: 65–79.
  36. 36. Hall TA (1999) BioEdit: удобный редактор выравнивания биологических последовательностей и программа анализа для Windows 95/98/NT. стр. 95–98.
  37. 37. Ларкин М.А., Блэкшилдс Г., Браун Н.П., Ченна Р., Макгеттиган П.А. и соавт. (2007) Clustal W и Clustal X версии 2.0. Биоинформатика 23: 2947–2948.
  38. 38. Драммонд А.Дж., Рамбо А. (2007) ЗВЕРЬ: байесовский эволюционный анализ путем выборки деревьев. БМС Эвол Биол 7: 214.
  39. 39.Надин-Дэвис С. А., Лоза-Рубио Э. (2006)Молекулярная эпидемиология бешенства, связанного с хозяевами рукокрылых в Мексике. Вирус Рез. 117: 215–226.
  40. 40. Condori-Condori RE, Streicker DG, Cabezas-Sanchez C, Velasco-Villa A (2013)Энзоотическое и эпизоотическое бешенство, связанное с летучими мышами-вампирами, Перу. Emerg Infect Dis 19
  41. 41. Штрейкер Д.Г., Рекуэнко С., Вальдеррама В., Гомес Бенавидес Дж., Варгас И. и др. (2012) Экологические и антропогенные факторы воздействия бешенства на летучих мышей-вампиров: последствия для передачи и контроля.Proc Biol Sci 279: 3384–3392.
  42. 42. Боуэн Р.А., О'Ши Т.Дж., Шанкар В., Нойбаум М.А., Нойбаум Д.Дж. и др. (2013) Распространенность нейтрализующих антител к вирусу бешенства в сыворотке семи видов насекомоядных летучих мышей из Колорадо и Нью-Мексико, США. Дж. Уайлдл Дис 49: 367–374.
  43. 43. Коста Л.Дж., Андраде Ф.А., Уиеда В., Марторелли Л.Ф., Катаока А.П. и др. (2013)Серологическое исследование антител, нейтрализующих вирус бешенства, у летучих мышей, отловленных в восточной части бразильской Амазонки. Trans R Soc Trop Med Hyg 107: 684–689.
  44. 44. Штрейкер Д.Г., Франка Р., Джексон Ф.Р., Рупрехт К.Э. (2013)Антропогенная смена насеста и динамика вируса бешенства у больших коричневых летучих мышей, живущих в доме. Vector Born Zoonotic Dis 13: 498–504.
  45. 45. Turmelle AS, Jackson FR, Green D, McCracken GF, Rupprecht CE (2010) Иммунитет хозяина к повторной инфекции вируса бешенства у больших коричневых летучих мышей. Дж. Ген Вирол 91: 2360–2366.
  46. 46. Гилберт А.Т., Фукс А.Р., Хейман Д.Т., Хортон Д.Л., Мюллер Т. и соавт.(2013) Расшифровка серологии для понимания экологии инфекционных заболеваний в дикой природе. ЭкоЗдоровье 10: 298–313.
  47. 47. Petersen BW, Rupprecht CE (2011) Эпидемиология и диагностика бешенства у человека. В: Ткачев С, редактор. Нефлавивирусный энцефалит. Риека, Хорватия: InTech. стр. 247–278.
  48. 48. Rupprecht CE, Willoughby R, Slate D (2006) Текущие и будущие тенденции в профилактике, лечении и борьбе с бешенством. Expert Rev Anti Infect Ther 4: 1021–1038.
  49. 49.Андерсон А., Швифф С., Гебхардт К., Рамирес А.Дж., Швифф С. и др. (2012) Экономическая оценка профилактики бешенства летучей мыши-вампира (Desmodus rotundus) в Мексике. Transbound Emerg Dis 61: 140–146.
  50. 50. Панамериканская организация здравоохранения (2004 г.) Профили стран. Гватемала. Epidemiol Bull: Панамериканская организация здравоохранения. стр. 8–11.
  51. 51. Форде Т. (2009) Наблюдение за бешенством и борьба с ним в Гватемале: Университет Монреаля.
  52. 52. Almeida MF, Martorelli LF, Aires CC, Barros RF, Massad E (2008) Вакцинация летучей мыши-вампира Desmodus rotundus против бешенства.Вирус Рез. 137: 275–277.
  53. 53. Лопес А., Миранда П., Техада Э., Фишбейн Д.Б. (1992)Вспышка человеческого бешенства в перуанских джунглях. Ланцет 339: 408–411.
  54. 54. Rupprecht CE, Briggs D, Brown CM, Franka R, Katz SL, et al. (2010) Использование сокращенного (4 дозы) графика вакцинации для постконтактной профилактики бешенства у людей. MMWR Recomm Rep 59: 1–9.
  55. 55. Лембо Т., Ниезгода М., Веласко-Вилла А., Кливленд С., Эрнест Э. и др. (2006)Оценка прямого экспресс-иммуногистохимического теста для диагностики бешенства.Emerg Infect Dis 12: 310–313.
  56. 56. Durr S, Naissengar S, Mindekem R, Diguimbye C, Niezgoda M, et al. (2008)Диагностика бешенства в развивающихся странах. PLoS Negl Trop Dis 2: e206.
  57. 57. van Thiel P-PA, de Bie RM, Eftimov F, Tepaske R, Zaaijer HL, et al. (2009) Бешенство человека со смертельным исходом из-за вируса Дювенхажа от летучей мыши в Кении: неэффективность лечения индукцией комы, кетамином и противовирусными препаратами. PLoS игнорирует тропические болезни 3: e428.
  58. 58.Джонсон Н., Фукс А., Макколл К. (2008) Пересмотр дела о бешенстве человека с длительной инкубацией, Австралия. Новые инфекционные заболевания 14: 1950–1951.
  59. 59. Лю И, Чжан С, Чжао Дж, Чжан Ф, Ху Р (2013) Выделение вируса Иркут от летучей мыши Murina leucogaster в Китае. PLoS Negl Trop Dis 7: e2097.

%PDF-1.4 % 177 0 объект > эндообъект внешняя ссылка 177 88 0000000016 00000 н 0000003157 00000 н 0000003242 00000 н 0000003440 00000 н 0000004328 00000 н 0000005029 00000 н 0000005258 00000 н 0000005295 00000 н 0000005343 00000 н 0000005390 00000 н 0000005437 00000 н 0000005484 00000 н 0000005531 00000 н 0000005578 00000 н 0000005626 00000 н 0000005674 00000 н 0000005722 00000 н 0000005769 00000 н 0000005816 00000 н 0000005894 00000 н 0000006627 00000 н 0000007030 00000 н 0000007692 00000 н 0000007913 00000 н 0000008796 00000 н 0000009623 00000 н 0000010285 00000 н 0000011183 00000 н 0000012095 00000 н 0000012307 00000 н 0000012588 00000 н 0000012803 00000 н 0000013054 00000 н 0000013269 00000 н 0000013527 00000 н 0000013761 00000 н 0000013979 00000 н 0000014197 00000 н 0000014423 00000 н 0000014647 00000 н 0000014875 00000 н 0000015327 00000 н 0000015531 00000 н 0000015746 00000 н 0000015962 00000 н 0000016165 00000 н 0000016571 00000 н 0000016906 00000 н 0000017112 00000 н 0000017592 00000 н 0000018235 00000 н 0000018752 00000 н 0000022080 00000 н 0000022434 00000 н 0000023817 00000 н 0000024235 00000 н 0000024612 00000 н 0000025225 00000 н 0000025633 00000 н 0000026008 00000 н 0000026373 00000 н 0000027061 00000 н 0000027486 00000 н 0000027880 00000 н 0000028169 00000 н 0000028355 00000 н 0000028542 00000 н 0000028723 00000 н 0000028953 00000 н 0000029451 00000 н 0000029724 00000 н 0000030390 00000 н 0000033084 00000 н 0000033393 00000 н 0000033706 00000 н 0000033921 ​​00000 н 0000034151 00000 н 0000034396 00000 н 0000034490 00000 н 0000034581 00000 н 0000035061 00000 н 0000035313 00000 н 0000035575 00000 н 0000035672 00000 н 0000035766 00000 н 0000037045 00000 н 0000042109 00000 н 0000002056 00000 н трейлер ]>> startxref 0 %%EOF 264 0 объект >поток xb```f`e`g`[email protected]

Мониторинг бешенства людей и животных

Мониторинг эпизоотологической обстановки и предупреждение возникновения бешенства среди людей и животных

Технический участок/область

  • МЭР -DIS/Надзор за болезнями/Медицина
  • AGR-DIS/Наблюдение за болезнями/Сельское хозяйство

Статус
8 Проект завершен

Дата регистрации

2. 5338 811.2007

Дата завершения
04.09.2013 04.09.2013

УПРАВЛЕНИЕ ПРОЕКТОВ
Weaver LM


Weaver LM

Ведущий институт
Кыргызский научно-исследовательский институт животноводства, ветеринарных и пастбищ, Кыргызстан, Бишкек

  • Ошская областная ветеринарная лаборатория, Кыргызстан, г. Ош\nМинистерство сельского хозяйства / ЗАО «Алтын-Тамыр», Кыргызстан, г. Бишкек\nРеспубликанский центр карантинных и особо опасных инфекций, Кыргызстан, г. Бишкек

Сотрудники

  • Центр of Expertise for Rabies CFIA/ACIA, Canada, ON, Ottawa
  • Резюме проекта

    Бешенство — смертельное заболевание, вызываемое нейротропным вирусом.К бешенству восприимчивы все виды млекопитающих, в том числе дикие, домашние животные и люди. Вирус бешенства обнаруживается в слюне больных бешенством животных и может передаваться при укусах (чаще всего) или при заражении царапин или слизистых оболочек. По оценкам Всемирной организации здравоохранения, ежегодно во всем мире от бешенства умирает 55 000 человек, преимущественно в развивающихся странах, где собаки являются основными переносчиками.

    Дикие животные, в том числе лисы, скунсы и летучие мыши, также могут служить резервуаром бешенства.Существуют варианты вируса бешенства, которые связаны с определенными видами диких животных и циркулируют среди них, однако эти варианты не являются видоспецифичными. Таким образом, дикие животные могут заражать как домашних животных, так и людей. Бешенство среди домашнего скота может привести к значительным экономическим потерям, как и расходы, связанные с постконтактным лечением людей, подвергшихся воздействию вируса бешенства.

    Вакцинация была важным средством борьбы с бешенством у собак и наземных диких животных.Обширные кампании по вакцинации собак в различных частях мира, прежде всего в Северной Америке и Западной Европе, привели к ликвидации собачьего варианта бешенства в этих регионах. Кроме того, кампании пероральной вакцинации с использованием приманок с вакциной оказались очень эффективными в борьбе с бешенством лисиц в Западной Европе и Онтарио, Канада, а также с бешенством койотов и серых лисиц в Техасе. Чтобы стратегии вакцинации диких животных были эффективными, необходимо знать основные переносчики бешенства и много информации о биологии животных (среда обитания, периоды спаривания и т.)

    В настоящее время имеется мало информации об эпизоотологии и эпидемиологии бешенства в Кыргызстане. Беглое ретроспективное изучение случаев заболевания людей и животных за последние десять лет показывает, что заболеваемость бешенством растет. Однако мало известно, если вообще известно, об основных резервуарах дикой природы в Кыргызстане (да и во всем регионе Центральной Азии), о том, какие варианты вируса бешенства циркулируют в этой стране, какие факторы способствуют или препятствуют распространению бешенства в Кыргызстан, и каково влияние бешенства диких животных на заболеваемость скота, домашних животных и людей.

    Кыргызстан богат горными пастбищами, лесами и ущельями, что создает проблемы при сборе проб и их транспортировке в лаборатории для диагностики. Кроме того, перед местной ветеринарной сетью и учреждениями стоит особенно сложная задача по борьбе с инфекциями от безнадзорных и диких животных, как правило, не вакцинированных. Пастбищное животноводство распространено в регионах Кыргызстана. Массовая миграция скота и его потенциальные контакты с дикими животными представляют собой реальную угрозу заражения.Весной и осенью сотни тысяч животных перегоняют и перегоняют на сезонные пастбища и обратно. Также на летних пастбищах пасутся скот из Узбекистана, Казахстана и Таджикистана. Эти обстоятельства необходимо будет учитывать при анализе роли диких животных в распространении бешенства. Перемещение большого количества животных в короткие сроки на значительные расстояния, а также большая загруженность транспортных путей требуют большой организационной подготовки как хозяйств, так и ветеринарных служб.

    Целью данного проекта является проведение эпизоотического мониторинга и эпидемиологического надзора за бешенством в Кыргызстане, что будет способствовать разработке стратегии борьбы с бешенством; конечной целью является профилактика бешенства среди людей и домашних животных. В южной части страны совместно с ветеринарной службой будут проведены обследования по выявлению причин широкого распространения бешенства. Медицинский и ветеринарный персонал будет обучен современной диагностике и будет работать в тесном контакте с населением, поскольку большинство людей не обращаются за медицинской помощью из-за низкой осведомленности о необходимости профилактики бешенства.

    В связи с этим потребуются комплексные меры по борьбе с бешенством. К ним относятся:

    • Приобретение современного оборудования для диагностических лабораторий и внедрение методов, одобренных ВОЗ и Всемирной организацией по охране здоровья животных (МЭБ) для диагностики бешенства. Это позволит проводить точную и своевременную диагностику бешенства, облегчит сбор изолятов вируса для дальнейших анализов и на основе результатов даст информацию для принятия решений о соответствующих мерах борьбы;
    • Мониторинг эпизоотии бешенства по географическим районам, особенно в горно-лесных районах, откуда исходит постоянная угроза заражения;
    • Изучение сезонных свойств бешенства с учетом климатических условий регионов и особенностей пастбищных производственных систем;
    • Исследования иммунного ответа животных, вакцинированных против бешенства;
    • Разработка инструментов молекулярной биологии для выявления вариантов вируса бешенства и проведения исследований распространения вируса (молекулярная эпидемиология) и эволюции на молекулярном уровне.

    Полученные результаты помогут выявить распространение бешенства в Кыргызстане и особенности эпизоотического процесса при этом заболевании. Также будет разработана научно обоснованная система борьбы с бешенством животных, учитывающая климатические условия и пастбищное животноводство в стране.

    Для достижения вышеуказанных целей необходимо в первую очередь обеспечить существующие ветеринарные лаборатории современным диагностическим оборудованием в соответствии с требованиями ВОЗ и МЭБ.Кроме того, вирусологи и сотрудники медицинских лабораторий должны быть обучены экспресс-методам диагностики бешенства, применяемым в западных странах (США, Канада и др.).

    Результаты этих исследований будут полезны не только для ветеринарии, но и для эпидемиологии здравоохранения, а также для международных организаций, занимающихся охраной здоровья животных, мониторингом эпизоотического статуса болезней и обеспечением безопасности на международном уровне. Кроме того, существует недостаток знаний о вариантах вируса бешенства, циркулирующих в регионе Центральной Азии. Предлагаемый проект предоставит информацию, важную не только для Кыргызстана, но и для соседних стран, и может служить моделью для этого региона в подходах к эпиднадзору и борьбе с бешенством.

    90 000 человек заразились бешенством от контакта с летучей мышью-вампиром в Мексике — Луизиана, 2010 г. | Глобальное здоровье | ДЖАМА

    ММВР. 2011;60:1050-1052

    В августе 2010 г. CDC подтвердил случай заболевания бешенством у сельскохозяйственного рабочего-мигранта в возрасте 19 лет, госпитализированного в Луизиане с энцефалитом.У мужчины развились острые неврологические симптомы в конце июля, вскоре после прибытия в Соединенные Штаты из Мичоакана, Мексика. Несмотря на поддерживающую терапию, его состояние ухудшилось, и 21 августа он умер. Предсмертное диагностическое исследование подтвердило диагноз бешенства, а образцы, собранные при вскрытии, дали положительный результат на вариант вируса бешенства летучих мышей-вампиров. Мать пациента сообщила, что в июле в Мексике его укусила летучая мышь, но он не обращался за медицинской помощью. Постконтактная профилактика (ПКП) была предложена 27 контактам пациента в Луизиане и 68 медицинским работникам, участвовавшим в уходе за ним.Хотя летучие мыши стали основным источником бешенства человека в Соединенных Штатах, это первая зарегистрированная смерть от варианта вируса бешенства летучих мышей-вампиров в Соединенных Штатах. Клиницисты, ухаживающие за пациентами с острым прогрессирующим энцефалитом, должны учитывать бешенство при дифференциальной диагностике и проводить ранние меры инфекционного контроля.

    29 июля 2010 года ранее здоровый мужчина в возрасте 19 лет из Мичоакана, Мексика, прибыл на плантацию сахарного тростника в Луизиане.После 1 дня работы в поле пациент обратился за медицинской помощью 30 июля по поводу общей усталости, боли в левом плече и онемения левой руки, связанных с перенапряжением. Симптомы у пациента сохранялись, и 3 августа он был обследован в местной клинике и переведен в специализированную больницу в Новом Орлеане для дальнейшего обследования и лечения.

    Физикальное обследование в специализированной больнице выявило гиперестезию левого плеча, слабость левой руки, генерализованную арефлексию и опущение левого верхнего века.При люмбальной пункции была получена спинномозговая жидкость (ЦСЖ) с умеренно повышенным количеством лейкоцитов 8 клеток/мм 3 (норма: 0-5 клеток/мм 3 ) с 67% лимфоцитов и 12% нейтрофилов, нормальный уровень глюкозы , и отсутствие организмов при окрашивании. Пациент был госпитализирован в отделение интенсивной терапии с подозрением на вариант Миллера-Фишера острой воспалительной демиелинизирующей полинейропатии (также называемой синдромом Гийена-Барре), с вирусным энцефалитом и ранним менингитом среди рассмотренных альтернативных диагнозов.

    На следующий день у пациента развилась лихорадка 101,1°F (38,4°C) и признаки дыхательной недостаточности, которые потребовали плановой интубации. Компьютерная томография и магнитно-резонансная томография головы выявили только развивающийся синусит. В течение следующих нескольких дней у больного постепенно снижается реакция на внешние раздражители, появляются фиксированные и расширенные зрачки, появляются эпизоды брадикардии и гипотермии. Дальнейшая оценка включала повторную люмбальную пункцию, показывающую повышение количества лейкоцитов до 87 клеток/мм 3 с 97% лимфоцитов и повышенным содержанием белка 233 мг/дл (норма: 15-45 мг/дл).Электроэнцефалограмма соответствовала энцефалиту. Бактериальные, вирусные и грибковые культуры крови и спинномозговой жидкости были отрицательными. Кроме того, лабораторные тесты на вирус иммунодефицита человека, сифилис, вирус простого герпеса, арбовирусы, болезнь Лайма и аутоиммунные нейропатии были отрицательными.

    Хотя в то время не было известно истории контактов с животными, диагноз бешенства был заподозрен на основании истории болезни и имеющихся данных. Управление общественного здравоохранения штата Луизиана было проинформировано о потенциальном случае заболевания бешенством, и 13 августа, в 11  90 288 больничных дней, были приняты меры инфекционного контроля. 20 августа в ликворе и сыворотке больного были выявлены вирус-специфические иммуноглобулин G и иммуноглобулин M, что подтвердило диагноз бешенства. После обсуждения с семьей прогноза пациента и последующей электроэнцефалограммы, показывающей тяжелые корковые нарушения, 21 августа пациент был экстубирован в соответствии с пожеланиями семьи и вскоре после этого скончался. Антиген вируса бешенства был обнаружен в посмертных тканях головного мозга, собранных 22 августа, и антигенное типирование определило вариант как вариант вируса бешенства летучих мышей-вампиров, что впоследствии было подтверждено амплификации и секвенирования нуклеиновых кислот.

    Исследование общественного здравоохранения

    Органы общественного здравоохранения в Луизиане и Мексике опросили членов семьи, друзей и коллег пациента, чтобы выявить потенциальные контакты с вирусом бешенства. Мать пациента заявила, что пациент был укушен летучей мышью-вампиром за пятку левой ноги, когда он спал.Укус произошел 15 июля в его родном штате Мичоакан, Мексика, за 10 дней до его отъезда в США. Он не обращался за медицинской помощью в связи с этим укусом и не имел истории вакцинации против бешенства. Никаких других контактов с летучими мышами, собаками или другими млекопитающими выявлено не было.

    Органы здравоохранения Мексики выявили пять близких контактов пациента в его родном штате Мичоакан, но установили, что ни один из этих контактов не подвергался воздействию, требующему ПКП. Однако в этом районе часто наблюдались укусы животных летучими мышами-вампирами, и официальные лица провели кампанию по вакцинации кошек и собак в местном сообществе.Кроме того, официальные лица попытались сократить местную популяцию летучих мышей-вампиров, отловив 120 летучих мышей-вампиров и нанеся им на спину желе, содержащее варфарин. После выпуска летучие мыши и их товарищи по насесту проглатывают антикоагулянт посредством общего ухода. Диагностический тест на бешенство, проведенный на одной из отловленных летучих мышей, дал отрицательный результат.

    Управление общественного здравоохранения штата Луизиана с помощью сотрудников больничного инфекционного контроля провело опрос медицинских работников клиник, больниц и догоспитальных медицинских учреждений, чтобы определить риски заражения и дать рекомендации по ПКП.Кроме того, были опрошены рабочие-мигранты, которые либо сопровождали пациента из Мексики, либо жили и работали с ним в Луизиане, и контактным лицам предлагалась ПКП. Всего 95 из 204 (46,5%) контактировавших с пациентами получили ПКП. Из них 27 были коллегами, которые делились с пациентом сосудом для питья, а 68 были медицинскими работниками, подвергшимися различным воздействиям. На сегодняшний день ни у кого из известных людей, контактировавших с этим пациентом, не развилось бешенство.

    Гэри Бальзамо, DVM, Рауль С.Ratard, MD, Департамент здравоохранения и больниц штата Луизиана; Дипу Р. Топпил, доктор медицины, Моника Топпил, доктор медицины, Университетская больница штата Луизиана. Fernando V. Pino, DVM, Национальная программа по зоонозам, Секретариат здравоохранения Мексики. Charles E. Rupprecht, VMD, PhD, отдел патогенов и патологии с серьезными последствиями, Национальный центр новых и зоонозных инфекционных заболеваний; Арманд Г. Спречер, доктор медицины, Бретт В. Петерсен, доктор медицины, сотрудники EIS, CDC. Корреспондент: Бретт Петерсен, [email protected], 404-639-5464.

    Этот случай представляет собой первое сообщение о бешенстве человека в Соединенных Штатах, связанном с вариантом вируса бешенства летучих мышей-вампиров, и подчеркивает растущую важность летучих мышей для общественного здравоохранения.Варианты вируса бешенства летучих мышей были связаны с большинством местных случаев бешенства среди людей в Соединенных Штатах в течение примерно 2 десятилетий. Точно так же летучие мыши-вампиры стали основной причиной бешенства среди людей в Латинской Америке за последнее десятилетие. 1 Это еще раз подчеркивает важность глобальной перспективы для профилактики бешенства среди людей и изменения эпизоотологии бешенства. С 2000 г. восемь (25%) из 32 случаев бешенства среди людей, зарегистрированных в Соединенных Штатах (включая случай, описанный в этом отчете), были связаны с контактами за границей.Из них два случая произошли в Мексике и были единственными завезенными случаями, не связанными с вариантом собачьего вируса бешенства; это открытие может отражать улучшение контроля над собачьим бешенством в Мексике. Международная координация между должностными лицами общественного здравоохранения остается важнейшим компонентом расследования случаев инфекционных заболеваний и улучшения мер по профилактике и борьбе с ними.

    Инкубационный период в 15 дней, описанный в этом отчете, короче, чем медиана в 85 дней, наблюдаемая в других случаях бешенства у людей, зарегистрированных в Соединенных Штатах. 2 Инкубационный период бешенства, связанного с летучими мышами-вампирами, может быть короче, чем у других вариантов вируса бешенства, о чем свидетельствует одна серия случаев со средним инкубационным периодом 22 дня. 3 В качестве альтернативы пациент мог подвергнуться более раннему воздействию, которое не было распознано или о котором не сообщалось. Второе неопознанное воздействие, приведшее к инфекции, также может объяснить наблюдаемые симптомы со стороны верхних конечностей, учитывая, что симптомы часто возникают в месте проникновения вируса.

    Медицинские работники должны учитывать историю поездок или иммиграции из страны с энзоотическим бешенством в качестве фактора риска и учитывать бешенство при дифференциальной диагностике любого случая острого прогрессирующего энцефалита. Международные путешественники в районы с энзоотической формой собачьего бешенства должны быть проинформированы о риске заражения вирусом бешенства, обучены методам предотвращения укусов животных, в том числе не прикасаться к животным и не кормить их, а также должны быть проинструктированы о проведении медицинского обследования в случае контакта с животным с подозрением на бешенство. . 4 Вакцинация перед контактом может быть рекомендована при поездках в районы с ограниченным доступом к соответствующей медицинской помощи. 4 ,5 Надлежащие методы инфекционного контроля могут снизить риск передачи вируса в подозреваемых или подтвержденных случаях бешенства у людей. В таких случаях лица, осуществляющие уход, должны носить халаты, защитные очки, маски и перчатки, особенно во время интубации и аспирации. 5 В случае подтверждения бешенства стандартизированная оценка риска при контакте с пациентом со строгим применением определений воздействия, указанных Консультативным комитетом по практике иммунизации (ACIP), в сочетании с информационно-просветительской работой может свести к минимуму ненужную ПКП у тех, кто не соответствует критериям. 5 В ходе этого процесса рекомендуется активное участие должностных лиц органов здравоохранения и тщательный надзор за персоналом больничного инфекционного контроля.

    Хотя летучие мыши-вампиры в настоящее время встречаются только в Латинской Америке, исследования показывают, что ареал этих летучих мышей может расширяться в результате изменений климата. 6 Экспансия летучих мышей-вампиров в Соединенные Штаты, вероятно, приведет к увеличению воздействия летучих мышей на людей и животных (включая домашний скот и диких животных) и существенно изменит динамику вируса бешенства и экологию на юге Соединенных Штатов.В дополнение к бешенству и другим лиссавирусам накапливаются доказательства того, что летучие мыши являются резервуарами и потенциальными переносчиками ряда возникающих инфекционных заболеваний. 7 Эти открытия поднимают дополнительные вопросы о рисках для здоровья населения при прямом или косвенном контакте с летучими мышами, особенно учитывая высокую тяжесть заболевания и уровень смертности, связанный с этими зоонозами. Дальнейшие исследования должны быть направлены на более точное определение характера и масштабов рисков для здоровья человека, создаваемых летучими мышами.

    Чтобы снизить известный риск заражения бешенством, общественное просвещение должно повышать осведомленность о риске передачи бешенства от летучих мышей и поощрять избежание контактов с летучими мышами и дикими животными в целом. Хотя это широко практикуется, уничтожение летучих мышей-вампиров для предотвращения бешенства людей или животных остается спорным. Любое потенциальное воздействие на человека летучих мышей должно быть тщательно исследовано, чтобы определить, показана ли ПКП, а летучие мыши, подвергшиеся воздействию, должны быть безопасно собраны и по возможности отправлены на тестирование на бешенство. 5

    Сотрудники Управления общественного здравоохранения штата Луизиана. Сотрудники Центров здравоохранения Мехико и Мичоакана, Мексика. Джесси Д. Блэнтон, магистр здравоохранения, Ричард Франка, DVM, доктор философии, Майкл Низгода, магистр медицины, Лиллиан А. Орчиари, магистр медицины, Серхио Рекуэнко, доктор медицины, Андрес Веласко-Вилла, доктор философии, и Памела А. Ягер, отдел патогенов с серьезными последствиями и патологии, Национальный центр новых и зоонозных инфекционных заболеваний, CDC.

    Что уже известно по этой теме?

    Вирус бешенства вызывает острый прогрессирующий вирусный энцефалит, который почти всегда приводит к летальному исходу, если до появления признаков или симптомов не проводится постконтактная профилактика.

    Что добавляет этот отчет?

    В августе 2010 года 19-летний мужчина умер от бешенства в Луизиане после укуса летучей мыши-вампира в своем доме в Мичоакане, Мексика; этот случай представляет собой первую зарегистрированную смерть человека от варианта вируса бешенства летучих мышей-вампиров в Соединенных Штатах.

    Каковы последствия для практики общественного здравоохранения?

    Должностные лица общественного здравоохранения должны повышать осведомленность о риске заражения бешенством после контакта с летучими мышами и другими дикими животными.Кроме того, клиницисты, ухаживающие за пациентами с острым прогрессирующим энцефалитом, должны учитывать бешенство при дифференциальной диагностике и осуществлять ранние меры инфекционного контроля.

    1. Шнайдер М.С., Ромейн П.С., Уйеда В., и другие. Бешенство, передающееся человеку летучими мышами-вампирами: новая зоонозная болезнь в Латинской Америке?  Рев Панам Салуд Публика . 2009;25(3):260-26919454154PubMedGoogle ScholarCrossref 2.Noah DL, Drenzek CL, Smith JS, и другие.Эпидемиология бешенства человека в Соединенных Штатах с 1980 по 1996 год. Ann Intern Med . 1998;128(11):922-9309634432PubMedGoogle ScholarCrossref 3. Лопес А., Миранда П., Техада Э., Фишбейн Д.Б. Вспышка человеческого бешенства в перуанских джунглях.  Ланцет . 1992;339(8790):408-4111346669PubMedGoogle ScholarCrossref 5.CDC. Профилактика бешенства среди людей – США, 2008 г.: рекомендации Консультативного комитета по практике иммунизации.  MMWR . 2008;57(RR-3):Google Scholar6.

    Мистри С., Морено А. Моделирование изменений в распределении летучих мышей-вампиров в ответ на изменение климата: последствия для бешенства в Северной Америке. Представлено на 19-й Международной конференции по бешенству в Америке, Атланта, Джорджия, 28 сентября — 3 октября 2008 г.

    .  Clin Microbiol, версия . 2006;19(3):531-54516847084PubMedGoogle ScholarCrossref

    бешенства в Колорадо | Департамент общественного здравоохранения и окружающей среды

    Бешенство распространяется главным образом через укусы бешеных животных.Обычно это приводит к летальному исходу у людей при появлении симптомов. Лечение доступно при быстром назначении.

    Какие животные чаще всего болеют бешенством?
    • Только млекопитающие могут быть переносчиками бешенства. Летучие мыши и скунсы являются основными источниками бешенства в Колорадо. Другие млекопитающие могут заразиться бешенством от летучих мышей и скунсов. Домашние животные, такие как собаки, кошки, крупный рогатый скот и лошади, могут заразиться при укусе бешеным диким животным.
    Как животное или человек заражаются бешенством?
    • Люди, домашние животные и домашний скот могут заразиться бешенством от укусов животных или, в редких случаях, от попадания зараженной слюны в глаза, нос, рот или открытую рану. Мозговая ткань также может быть инфекционной и не должна обрабатываться.
    Как узнать, заражено ли животное бешенством?
    • Первым признаком бешенства обычно является изменение поведения животного. Животные могут вести себя более агрессивно или более ручно, чем обычно. Ночные животные, такие как скунсы, лисы и летучие мыши, могут быть на улице в течение дня. Бешеные животные могут шататься, дрожать или казаться слабыми. Летучих мышей можно найти на земле, они не могут летать. Бешеные животные могут казаться взволнованными и возбужденными или парализованными и напуганными.Иногда бешеные животные не проявляют никаких признаков болезни перед смертью от бешенства. Если дикое животное не убегает, когда вы приближаетесь к нему, оно может быть больным или раненым. Не пытайтесь ему помочь. Если животное ведет себя странно, держитесь подальше от животного и обратитесь в местный отдел здравоохранения. Единственный способ узнать, есть ли у дикого животного бешенство, — это проверить его мозг. Если собака, кошка или хорек живы через 10 дней после укуса человека, значит, у собаки, кошки или хорька на момент укуса не было бешенства.
    Почему существуют опасения по поводу скунсов и бешенства?
    • Бешенство скунсов быстро распространяется и поражает большое количество скунсов. Болезнь часто распространяется на других диких животных и домашних животных, что делает воздействие на человека серьезной проблемой. Поскольку скунсы живут на земле, люди и животные гораздо чаще вступают с ними в контакт. Скунсы могут искать убежище и пищу там, где живут домашние животные и домашний скот, что делает контакт с ними более вероятным.
    Как я узнаю, что одно из моих животных укусил скунс или летучая мышь?
    • Крайне трудно увидеть укус летучей мыши, даже на человеке, который знает, где его укусили.Укусы летучих мышей почти не оставляют следов, но могут распространять слюну и бешенство. Зубы скунса также достаточно малы, поэтому может быть трудно определить, было ли укушено домашнее животное. Предполагается, что любое животное, обнаруженное без присмотра или в тесном контакте со скунсом или летучей мышью, подвержено риску заражения бешенством , если тест на бешенство дикого животного не показывает отрицательный результат.
    Как лучше всего избежать заражения бешенством?
    • Своевременно информируйте своих питомцев о прививках от бешенства и избегайте контактов с дикими животными.Лицензированный ветеринар позаботится о том, чтобы ваши животные были правильно вакцинированы, храня вакцину при надлежащей температуре, следя за тем, чтобы ваше животное было достаточно взрослым и здоровым для вакцинации, и ведя надлежащий учет.
    Восемь способов защитить себя и свою семью
    • Не кормите, не трогайте и не усыновляйте диких животных, будьте осторожны с бездомными собаками и кошками. Бешеные животные не всегда кажутся злыми!
    • Научите детей оставлять дикую природу в покое. Убедитесь, что ваш ребенок знает, как сказать вам, если животное кусает или царапает его.
    • Обратитесь к ветеринару (или в местный приют для животных) для вакцинации домашних животных и домашних животных от бешенства. Держите их прививки в актуальном состоянии.
    • Плотно закрывайте мусорные баки и кормушки. Открытые мешки для мусора и корма привлекают диких или бродячих животных в ваш дом или во двор.
    • Кормите своих питомцев в помещении, никогда не оставляйте корм для животных на улице, так как это привлекает диких животных.
    • Держите домашних животных в огороженном дворе.
    • Избегайте любого контакта с летучими мышами, особенно летучими мышами, обитающими на земле.Если вы найдете летучую мышь на земле, не трогайте ее. Сообщите о летучей мыши и ее местонахождении местному сотруднику по контролю за животными или в отдел здравоохранения.
    • Если вас укусило животное, немедленно обратитесь к врачу. Свяжитесь с местным отделом здравоохранения, чтобы сообщить об инциденте.
    Каких животных следует вакцинировать против бешенства?
    • Вакцинируйте всех собак, кошек, домашних хорьков и домашний скот. Рептилии и птицы не могут быть заражены бешенством, а мелкие грызуны вряд ли вступают в контакт с дикими летучими мышами или скунсами и не нуждаются в вакцинации.
    Что произойдет, если моего питомца укусит бешеное животное?
    • Животным, которым своевременно делают прививку от бешенства, делают «бустерную» прививку от бешенства и наблюдают дома в течение 45 дней (наблюдают за симптомами заболевания). Домашние животные, которым не делали прививки и которые имели контакт с известным или подозреваемым в бешенстве животным, должны быть либо подвергнуты эвтаназии , либо помещены в строгую изоляцию от людей и других животных на период в четыре месяца за счет владельца.Эти требования предназначены для защиты как семьи владельца домашнего животного/скота, так и общества.
    Должен ли я ловить скунсов на своей территории и перемещать их?
    • Никогда не ловите и не перемещайте диких животных! Отлов и перемещение скунсов, лис и многих других видов диких животных в Колорадо является незаконным без разрешения или другого одобрения.

    Добавить комментарий

    Ваш адрес email не будет опубликован.