Перейти к содержимому

Понос у поросят лечение народными средствами: Рекомендации, чем лечить понос у поросят

Содержание

Рекомендации, чем лечить понос у поросят

      
      
      

Чтобы понять, как лечить поросят при появлении поноса, следует разобраться в причинах его возникновения.

 Понос (диарея) у поросят – это ненормальный частый неоформленный стул. Во многих случаях отмечается усиленная перистальтика кишечника. Понос у поросят чаще всего является признаком заболевания кишечника.

 Чтобы понять, как лечить поросят при появлении поноса, следует разобраться в причинах его возникновения. Основными причинами поноса у поросят могут быть:

·          Погрешности в питании. Так как свиньи являются всеядными и поглощают все, что им попадается на пути, говорить о диете, как методе лечения поноса у поросят, не приходится. Диарея может быть спровоцирована любым изменением в питании животного. Легкое послабляющее действие может вызвать любая вода, взятая из неизвестного источника.

·          Раздражение слизистой оболочки кишки пищевыми продуктами или инфекционными факторами.

·          Появление инфекции.

·          Поедание веществ, которые не перевариваются (остатки со стола, недоброкачественная пища, падаль, инородные предметы).

·          Токсические вещества.

Чем лечить понос у поросят? Наилучших результатов при лечении поросят можно добиться, если вовремя отреагировать на возникшую проблему. Очень важно понаблюдать за поросенком в первые две недели после отлучения его от свиноматки.

Лечить понос у поросят можно так. В первую очередь необходимо сделать объемную подстилку, которую периодически подогревают. В первый день лечения поноса у поросят следует полностью исключить еду. В редких случаях разрешается дать десятую часть корма от привычной нормы. На второй день лечения поросят можно понемногу давать еду, но не больше 50% нормального рациона. Кормить животных следует не реже 6-7 раз в сутки. Если отсутствуют полноценные комбикорма, тогда в питание следует включить жидкие каши на кукурузе или пшеничных отрубях, морковь, травяную муку, болтушки.

Рекомендуется поить животных обволакивающими отварами из семени риса, льна, овсяной или ячменной муки. По одной столовой ложке каждому поросенку нужно давать растительное масло (кукурузное или подсолнечное). До кормления следует поить животных отварами корня дуба, ромашки, цикория, двудомной крапивы. С этой же целью можно использовать водно-спиртовую вытяжку из хвои.

Вылечить понос у поросят получиться намного быстрее, если соблюдать постоянный регидратационный режим, то есть восстановить и поддержать оптимальный баланс микроэлементов и соли в организме поросенка. С этой целью можно использовать раствор хлористого калия (10%) по 10 мг трижды в день. Аналогичный эффект имеет раствор хлористого натрия. Неплохим регидратационным свойством обладает подкисленная вода соком лимона и с 1 мг

Чиктоника.

Важно отметить, что при лечении поноса у поросят все вяжущие средства должны приниматься натощак. Если у животного возник токсикоз, тогда обязательно его нужно пропоить энтеросорбентами, что связывают токсины и выводят их из организма.

Если лечение поросят на протяжении трех дней не дает положительного результата, тогда следует прибегнуть к пробиотикам и сульфаниламидам, которые помогут организму активнее сопротивляться болезни. Лечить понос у поросят важно начать на ранних стадиях, когда в организме еще нет большого количества токсинов, которые могут забрать жизнь маленького животного.

Если понос у поросят имеет инфекционное происхождение, то следует применять соответствующие препараты для поросят от желудочно-кишечных заболеваний, например,

Аколан, и антибактериальные препараты, например, Амоксицилин.

Купить препараты от поноса у поросят

чем поможет. Лечебные и полезные свойства крапивы

Содержание

Крапива издавна считалась универсальным лекарством и применялась при разных заболеваниях. Ее листья имеют богатый состав, являются отличным источником витаминов, микроэлементов и прочих полезных веществ. Они применяются при различных болезненных состояниях. Например, крапива при поносе полезна даже в случаях, когда диарея носит хронический характер.

Состав крапивы: чем полезно растение

Состав крапивы включает в себя следующие вещества:

  • белки и углеводы;
  • аскорбиновую кислоту;
  • муравьиную и пантотеновую кислоты;
  • гликозиды;
  • витамины К и В2;
  • каротиноиды;
  • хлорофилл;
  • железо;
  • минеральные соли;
  • протопорфирин;
  • фитонциды;
  • эфирные масла;
  • ситостерин и т. д.

В листьях крапивы полезных веществ не меньше, чем в овощах и фруктах. Поэтому ее применяют не только как лечебное средство, но и используют в пищу как источник витаминов. Если рассматривать растение с точки зрения питательной ценности, то крапива наиболее близка к бобовым.

Благодаря своему составу крапива обладает ценными свойствами:

  • противовоспалительным;
  • кровоостанавливающим;
  • ранозаживляющим;
  • мочегонным;
  • отхаркивающим и т. д.

Почему крапива показана при поносе

Причины поноса могу быть разными, но его проявления всегда неприятны и несвоевременны. Если диарею спровоцировала бактериальная инфекция, она часто сопровождается высокой температурой, требует немедленного обращения к врачу и приема антибиотиков. В остальных случаях, особенно если понос возник из-за переедания, неправильного питания, брожения в кишечнике, вируса, стресса, можно обойтись без медикаментов. Помогут натуральные средства.

Крапива при поносе особенно полезна при синдроме раздраженного кишечника и других состояниях, когда диарея становится хронической. Она закрепляет, помогает наладить деятельность желудка и кишечника. Неоспоримая польза крапивы в том, что она активно насыщает организм полезными веществами: а при поносе он теряет много витаминов, микроэлементов, минеральных солей. Это свойство крапивы особенно актуально при соблюдении диеты для восстановления пищеварительной системы. Также растение помогает скорее восстановиться после болезни, поскольку дает силы и энергию.

Как правильно употреблять крапиву при поносе

Для симптоматического лечения можно использовать крепкий чай из крапивы. Для его приготовления потребуется 2 ст. ложки высушенных листьев: их заливают 2 л кипятка и настаивают в термосе. Для вкуса и еще большей пользы можно добавить шиповник. Крапива при поносе отменно сочетается с листьями ежевики. Их смешивают в равных частях, и готовят отвар из 15 г такой смеси и 200 мл кипятка.

Если понос сопровождается болями, к крапиве и ежевике можно добавить корень алтея.

Также подойдет отвар из трех частей листьев крушины и по одной части листьев крапивы и цветков тысячелистника. Столовую ложку смеси заливают стаканом кипятка и варят 10 минут.

При частых поносах как простое и эффективное средство можно принимать измельченную в порошок крапиву в сухом виде.

Отказаться от использования натурального средства стоит при сердечной и почечной недостаточности, склонности к образованию тромбов, варикозном расширении вен. Крапива не должна использоваться при беременности, особенно на поздних сроках, а вот кормящим мамам ее можно, растение, к тому же, увеличивает секрецию молока.

Текущий рейтинг: 3.98 из 5.    Количество голосов: 480

колит лечение народными средствами отзывы кто вылечился

Тэги: препараты применяемые при диареи, заказать колит лечение народными средствами отзывы кто вылечился, лечение при панкреатите поджелудочной железы меню.


противовоспалительные препараты при панкреатите, эффективное лечение стоматита, лечение хронического колита отзывы, протокол лечения гастрита, диарея у поросят лечение народными средствами

Описание

Доктор сказал, что вар пихты понижает концентрацию холестерина. Теперь пью лекарство для поддержки сосудов. Профилактика – лучшее лечение. Цена нормальная, так что не накладно совсем. Вытяжку из пихты использовали с давних времен. Первые упоминания встречаются в славянских летописях Древней руси. Пихта, которую часто называют лесным доктором, дает людям здоровье и молодость. Пихтовый вар вырабатывается из молодой весенней хвои сибирской пихты. Самое эффективное средство для восстановления здоровья, заживления ран и очищения организма.


Официальный сайт колит лечение народными средствами отзывы кто вылечился

Состав

Колит — это раздражение или воспаление толстой кишки, которое вызывают вирусные инфекции, паразиты или отравления. Колит: Симптомы и натуральные средства лечения. Когда человек страдает от колита любой степени тяжести, это обычно сопровождается следующими симптомами. Кто-нибудь вылечился народными средствами?. Приму больных колитом за символическую плату и отзыв. тел.: +79164652058 почта. Пожалуйста помогите вылечить колит У меня слизь и кровь врачей поменяла но лечения только на две недели хватает сижу на диети люди помогите пожалуйста. Нравится0. Отчеты: Посетители Поисковые фразы. Как я вылечила язвенный колит. А вылечилась я простым подорожником. http. Консервативное лечение сейчас предполагает борьбу с колитом лишь как с аутоимунным заболеванием — т.е. назначают сульфасалазин/месалазин/подобные, а когда те перестают. Лечение колита народными средствами достаточно популярно. Среди них существуют очень эффективные рецепты. Лечение народными средствами. При выборе в качестве терапии народные методы крайне важно перед ее началом посоветоваться с доктором. Некоторые ингредиенты целебных. Вылечил язвенный колит невыясненной этиологии.

После лечения в клинике,. Вылечилась от неспецифического язвенного колита у умного врача более 20 лет назад. Мир целебных трав, лечение народными средствами, Добрый день! Поскажите, облепиховое масло использовали холодного отжима или. Колит – воспалительное заболевание, поражающее слизистую оболочку толстой кишки. Среди различных заболеваний кишечника колит занимает одну из лидирующих позиций. Лечение колита народными средствами в домашних условиях. Колит – это серьезное заболевание, связанное с воспалением оболочки слизистой толстого кишечника. Лечение этого недуга, как правило, – сложный процесс. Не вылечила, но ремиссии добивалась без лекарств (мне ни одно лекарство так не помогало как календула) А если добавляю диету из одного. Как-то выдержала 5 дней на одном киселе и травах на полгода забыла что такое колит и иже с ним. Язвенный колит вылечила травами. Среда, Октябрь 16, 2013. Подорожник повышает ее. Если у кого кислотность высокая, такое средство применять нельзя. Напишу вам еще про средство от храпа. Дед раньше сильно храпел, да и я немного похрапывала. Нам посоветовали закапывать в нос перед сном. При лечении колита первостепенное значение имеет правильная диета. Дал ему народный рецепт еще по осени. Колит – это процесс воспаления внутренней слизистой оболочки толстого кишечника, которое имеет несколько разновидностей и форм проявления. Совсем вылечить, наверное, нет, но держать в стадии ремиссии - вполне. Найдите хорошего гастроэнтеролога. Колиты это следствие неправильного питания, у вас в кишечнике воспаление. Кто вам сказал, что у вас колит? Колит лечится консервативной терапией, а течение болезни доброкачественное. Опыт лечения хронического колита. Дал ему народный рецепт еще по осени. Сейчас списались — говорит кардинальное улучшение обозначилось — ноющие боли перестали досаждать, желудочный сок тоже пришел в норму.

Результаты испытаний

Осталась очень довольная от Пихтового отвара Сила тайги. Начала принимать вместе со всей семьей. Во-первых, очень нравится запах этого отвара, приятно пить. Во-вторых, сироп действительно повышает устойчивость к простуде, после того, как начала его принимать, я уже и не вспомню, когда болела последний раз. В-третьих, повысилась активность организма.Улучшение самочувствия были заметны уже через несколько дней.В общем, всем советую этот продукт, ведь самое главное, что он натуральный! Давно слышала хорошие отзывы про Силу Тайги от знакомых, увидела в рекламе и не смогла удержаться! Заказ приехал быстро, оплатила при получении. Теперь и сама убедилась в пользе пихтового вара. Избавилась от хронической усталости, могу каждый день до часа ночи сидеть, читать, заниматься саморазвитием! Кстати, спасибо тем людям, которые делают это средство, они несут здоровье в этот мир!

Мнение специалиста

Покупатели положительно говорят о пихтовом средстве. У больных улучшилось состояние, силы восстановились, кровь – очистилась. После курса почувствовалась лёгкость, прошло истощение, организм зарядился силами, что положительно отразилось на трудоспособности. Работа желчевыводящих органов и печени стимулировалась, ферментные системы – активизировались. Обмен веществ улучшился на минеральном, водно-солевом и углеводном уровне.

Andru. Новичок. Пользователи. 23 сообщений. Отправлено 08:44, 14.01.2015. Мне посоветовали пройти лечение НЯК в Китае, в клинике на острове Хайнань. Было много примеров долгой ремиссии. Пока прохожу курсы иглоукалывания. История девушки с язвенным колитом, прошедшей лечение китайскими травами. Также, в процессе лечения выяснилось, что эту траву переводчица Леля может прислать из Китая по почте (посылка весит около 8 кг). Лечение язвенного колита в Китае предотвращает и такие грозные осложнения, как стриктура кишечника и рак толстой кишки. Клиника HMG против НЯК использует методы традиционной медицины Китая. У приверженцев восточных практик врачевания существует представление, что болезнетворный агент. ЛЕЧЕНИЕ НЯК. Хронический колит ( язвеный неспецифический колит) Симптомы : это боли слева в животе, вздутие, понос или, напротив, запор, кал с примесью слизи, а иногда и крови. Общее состояние ухудшается, температура повышается. Продолжительность болезни во обострении от нескольких дней до. Лечение неспецифического язвенного колита профессорами Китая. Если у Вас есть возможность приехать на лечение НЯК в Китай, профессор КТМ нашего госпиталя г. Далянь, назначит правильное направление к Вашему излечению. Язвенный колит, также известный как хронический неспецифический язвенный колит или НЯК, является воспалительным. Результатом лечения НЯК в Китае таки методом была эффективность в 94,6% случаев. 2. Лечебные клизмы из трав. Лекарственные препараты доставляли непосредственно в очаги. Лечение неспецифического язвенного колита в Китае 8 клиник Адреса $ Цены на лечение O отзывы Запись на консультацию 107 пациентов отправлено на лечение. Неспецифический язвенный колит диагностируется всего у. Язвенный колит представляет собой хроническую болезнь, которая поражает слизистую оболочку толстой кишки, что сопровождается ее воспалением, отеком и появлением язвенных дефектов. Лечение в Китае. Жизнь с язвенным колитом. Понимание диагноза. Вам только что поставили диагноз – язвенный колит. Что будет дальше? Вполне вероятно, что вы раньше даже и не слышали об этом заболевании. Как лечат язвенный колит в западной медицине – назначают гормональные препараты, антибиотики и диету. Лечение язвенного колита в китайской медицине проходит без назначения гормональных и химических веществ. Благодаря такому подходу больные получают уникальный шанс излечиться. Лечение НЯК в Китае в госпитале ТКМ. Мы с успехом проводим консервативное лечение неспецифического язвенного колита, панкреатита, язвенной болезни и других. Лечение язвенного колита в Китае проводится в условиях проктологических отделений. Медикаментозная терапия включает в себя антибиотики для снятия воспалительного процесса, метронидазол, сульфаниламидные препараты, иммунодепрессанты. В тяжелых случаях назначается лечение. Лечение няк в Китае отзывы. 10.04.2019 by admin. Ирония в том, что в инструкциях к Азатиоприну и Сандиммуну вы не найдете никакого упоминания о НЯК. И пусть вас не пугают показания к применению, которые вы найдете в этих бумажонках ?? Основываясь на собственном опыте использования всех упомянутых.

Способ применения

Доктор сказал, что вар пихты понижает концентрацию холестерина. Теперь пью лекарство для поддержки сосудов. Профилактика – лучшее лечение. Цена нормальная, так что не накладно совсем.

Правила применения Смекты во время диареи. Показания и противопоказания. Смекта уже несколько десятилетий применяется для лечения диареи многими людьми – она безопасна, эффективна и действует очень быстро. Смекта при поносе используется часто: этот медикамент подходит и для взрослых, и для детей. Он принадлежит к группе противодиарейных средств с адсорбирующим эффектом. Действующее вещество Смекты является природным. Смекта от диареи путешественников. Чаще всего такое неприятное явление, как диарея, случается у людей, которые отправляются в путешествия, в командировки, всевозможные на курорты. Особенно в летнее время в связи с тем. Гастроэнтерологами часто назначается Смекта от поноса, она абсорбирует токсические вещества и выводит их из организма. Кишечное расстройство испытал на себе, наверное, любой человек - от мала до велика.

Как заказать?

Заполните форму для консультации и заказа колит лечение народными средствами отзывы кто вылечился. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении.

колит лечение народными средствами отзывы кто вылечился. лечение колита кишечника у собак. Отзывы, инструкция по применению, состав и свойства.

Геморрагический гастрит — причины, симптомы, разновидности. Гастрит с геморрагическим компонентом имеет. Лечение народными средствами бывает очень эффективным. Болезнь — не новая и на протяжении многих веков люди придумывали разные средства для снятия болевых симптомов. Геморрагический гастрит: лечение народными средствами. Помимо диеты и основного медикаментозного лечения, можно. Геморрагический гастрит - это заболевание, совместимое с жизнью, так как есть немало способов его лечения. Но оно занимает достаточно много времени, и даже в случае. Лечение эрозивного гастрита народными средствами — это эффективный способ оздоровления желудка, оно входит в комплекс. Эрозивная форма гастрита также имеет несколько подвидов: острая форма, геморрагическая, антральный тип и гастрит — рефлюкс. Все они достаточно опасны для здоровья и жизни. Причины, лечение и диета при геморрагическом гастрите желудка. Гастрит – это болезнь желудка, при которой нарушается его слизистая оболочка. Народные средства от гастрита. Неофициальная медицина рекомендована даже врачами. Предлагается несколько действительно эффективных способов, как. Содержание: Понятие геморрагического гастрита. Выявление и лечение эрозийного гастрита. Лечение народными средствами. Геморрагический гастрит является заболеванием органов пищеварения. Лечение геморрагического гастрита препаратами и народными средствами. Важно знать!. Геморрагический гастрит представляет собой серьезное заболевание пищеварительного тракта. Лечение геморрагического антрального гастрита. Лечение заболевания должно быть комплексным и включать. Лечение народными средствами бывает очень эффективным. Болезнь — не новая и на протяжении многих веков люди придумывали разные средства для снятия болевых симптомов. Геморрагический гастрит: лечение народными средствами. Помимо диеты и основного медикаментозного лечения, можно дополнительно использовать народные способы лечения. Они заключаются в применении растительных масел (шиповника, каротинового и облепихового), а также настоев трав.


Официальный сайт колит лечение народными средствами отзывы кто вылечился

✔ Купить-колит лечение народными средствами отзывы кто вылечился можно в таких странах как:


Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина Армения


Доктор сказал, что вар пихты понижает концентрацию холестерина. Теперь пью лекарство для поддержки сосудов. Профилактика – лучшее лечение. Цена нормальная, так что не накладно совсем.

Уникальный лечебный сбор имеет богатейшую формулу. Его основу составляет хвоя пихты сибирской. Добытая в чистейшей местности, в определенное время, собранная вручную, высушенная по особой технологии – она самый ценный компонент вара. Ее непревзойденный эффект на слизистую и работу ЖКТ в целом, использовали еще в Древней Руси. Вар помогал проводить чистку кишечника, справляться с болевым синдромом, устранять воспаления, заживлять раны, оздоравливать организм. Для более эффективного действия в состав средства входят лекарственные травы.

Пихтовый вар Сила тайги применяется для общего оздоровления организма, укрепления иммунитета, а также для лечения хронического бронхита, сахарного диабета, экзем, артрита, стоматита и других заболеваний опорно-двигательной, дыхательной, пищеварительной и сердечно-сосудистой систем. В результате лабораторных исследований было доказано, что продукция торговой марки Рецепты Знахаря эффективно очищает кровь, улучшает обмен веществ, нормализует артериальное давление, снижает токсическое воздействие негативных внешних и внутренних факторов на сердце и другие внутренние органы. Можно применять для профилактики и детям и взрослым один раз в день. При добавлении в кружку с горячей водой вы получаете ценный хвойный напиток, который наполняет всю комнату природным запахом тайги.

Глисты у свиней: лечение народными средствами

Содержание статьи

На сегодняшний день, разведение свиней является одним из самых прибыльных дел в сельском хозяйстве. Однако свиньи, как и любые живые существа способны болеть. Они могут стать жертвой инфекции, вируса или паразита (особенно глистов).

Гельминтозы, являются широкой проблемой среди фермерских хозяйств. У свиней они могут встречаться очень часто, и вызывать различные заболевания, которые зависят от вида внедрившегося паразита. Самые известные глисты, которые способны поражать свиней: нематоды, аскариды, цестоды, трематоды и акантоцефалы.

Аскаридоз

Данное заболевание появляется как следствие заражения аскаридами (круглыми червями). Они отличаются крупными размерами тела (самцы могут вырастать до 25 сантиметров в длину, самки намного больше до 35 сантиметров). В зоне риска по возникновению, находится молодняк, которому 3-6 месяцев от рождения и декоративные виды свинок, по типу вьетнамских. У взрослых особей, аскаридоз регистрируется относительно редко.

Местом паразитирования данного гельминта считается тонкий отдел кишечника, где оплодотворенная самка производит кладку яиц (по 100-200 тысяч за 1 день). Больной поросенок постепенно выделяет во внешнюю среду вместе с каловыми массами, и таким образом они попадают в почву, поилки, кормушки. Вне носителя, яйцо аскариды зреет около 20-30 суток, из них появляются личинки.

Этиология

Заражение происходит путем поедания зараженного яйцами корма, либо во время прогулок около свинарников, где зараженная особь выделила возбудителей из организма. После проглатывания яиц с едой или питьем, из созревшего яйца выходит личинка, которая внедряется тонкий кишечник, попадает в кровоток, потом в легкие, трахею, гортань, и наконец-то  оказывается в полости рта. Находясь во рту жертвы, она ждет, когда новая порция воды или корма сможет перенести ее обратно в кишечник, где она сможет вырасти и начать откладывать яйца. Во время паразитирования, аскарида имеет свойство выделять опасные токсины, которые постепенно приводят к хроническому отравлению свиньи.

Симптомы

Токсин глистов вызывает расстройства в работе ЖКТ (понос, рвота, расстройства аппетита). По общему состоянию можно отметить упадок сил животного, заметная потеря веса, анемия, хорошо слышный скрежет зубов. Больные поросята начинают кашлять, у них развивается тахипноэ и гипертермия. Если большая масса личинок мигрирует в ротовую полость, и задержалась в легких, может присоединиться пневмония, а при прохождении желчных проток печени и гепатит. В запущенных случаях, когда скопилось большое количество аскарид, может произойти закупорка или в худшем случае разрыв кишечника. Отдельные поросята могут иметь аллергические реакции, судороги, высыпания и нервные припадки.

.Диагноз

Для постановки диагноза, необходимо вызвать ветеринара, так как он сможет произвести микроскопическое исследование кала, на наличие яиц гельминтов. По установленному возбудителю, он сможет назначить лучшее лечение .

Лечение и профилактика

Для лечения поросят от аскарид, широко используется препарат альбендазол 10%. Его гранулят и досыпают к утреннему корму всего поголовья. Препарат нужно использовать в дозе 100 миллиграмм  препарата,  на 1 килограмм массы свиньи.

Метастронгилез

Легочно-глистная болезнь – гельминтозное поражение свиней, которое протекает в виде пневмонии.

Вызывает заболевание круглый нитевидный червь, который вырастает до 5 сантиметров в длину, и активно действует в бронхах. Перед поражением свиньи, червь проходит развитие у промежуточного носителя, которым является дождевой червь.

Этиология

Заражение свиньи случается во время съедания дождевого червя, если он был носителем личинок данного виды гельминтов. Попадая в желудок и тонкий кишечник, тело червя переваривается, личинки освобождаются от него и начинают развиваться и паразитировать в теле нового хозяина, их окончательный пункт миграции заканчивается в бронхах.

От заражения, до полноценного развития личинки во взрослую особь проходит 20-30 дней.

Симптомы

С большими усложнениями данной болезнью страдают полугодовалые поросята, они начинают кашлять, хрипеть, со временем развивается одышка. На 7-9 сутки у них происходит значительное повышение температуры тела вплоть до 42 градусов.

При слабом заражении, симптомы выражены слабо или вовсе отсутствуют.

Диагностика

Определить наличие метастронгилеза можно только методом лабораторного исследования кала.  

Лечение

Неблагополучные на счет гельминтоза хозяйства проводят дегельминтизацию своего поголовья непосредственно перед выпуском на дворы и пастбища. Для этого используют препарат против глистов — тетрамизол (тимтетразол), дозировка для поросят до 20 килограмм составляет 0.1 грамм на особь, животное до 50 килограмм – 0.005 грамм на килограмм вперемешку с кормом, для свиньи больше 50 килограмм – 0. 25 грамм препарата на одну особь.

Первую дегельминтизацию поросят, назначают в 1,5-2-месячном возрасте. Эффективны также универм, ривертин 1%, фенбендазол, альбендазол, ивермектины, препараты йода и др.

Профилактика

Профилактические мероприятия по предотвращению заболевания должны состоять из дезинфекции внешней среды, проведения профилактических дегельминтизаций, изолированного содержания выращиваемых поросят. Тщательно подходить у выбору пастбищ.

Финноз

Болезнь, которая так же называют — крупка. Оно провоцируется цистицерками (финнами ленточного червя-солитера). Помимо свиней, довольно часто обнаруживаются у домашних питомцев. Солитеры имеют необычное строение тела, состоящее из отдельных члеников. Он может достигать размеров 1-1.5 сантиметров, и содержит внутри массу яиц. Действует в ЖКТ людей.

Этиология

Когда человек заражен паразитами, внутри его кишечника созревшие членики начинают постепенно отделяться от паразита, и вместе с калом попадают наружу. Когда свинья съедает зараженные фекалии человека, она так же заражается финнозом.

Попав в ЖКТ свиньи, личинки проникают чарез кровеносные сосуды в мышцы и там паразитируют. В связи с их жизнедеятельностью, в мышцах образовываются пузыри-финны, которые сравнивают с крупой (от этого и пошло неофициальное название крупка). В мясе забитых свиней, могут быть обнаружены различные количества финнов, от единичных до тысячных экземпляров. По локализации нет определенного места, любая ткань может быть поражена (сердце, язык, мозг и т.д.). Если человек употребил в пищу плохо обработанное свиное мясо, в его кишечнике из этих финн могут развиваться взрослые особи червя солитера. Заболевание финнозом опасно как для животных, так и для человека, в особенности, если финны попали в головной мозг.

Симптомы и диагностика

Симптоматически разглядеть болезнь сложно, так как не проявляется ярких признаков. Обнаружить возбудителя можно только при анализе кала.

Лечение

Не проводится.

Профилактика

Состоит в предупреждении заражения, и профилактическим приемом противогельминтных препаратов.

Трихинеллез

Заболевание домашних животных, а иногда людей, которое возникает после заражения трихинеллами.

 Возбудитель

Трихинелла — червь очень маленьких размеров, максимально вырастает до 4 миллиметров.

Этиология

Свиньи поражаются глистом в основном при съедании дохлых крыс, а человек — употребляя трихинеллезную свинину. Зрелые трихинеллы обитают в тонком кишечнике, там происходит рождение личинок и их начинается распространение по организму с кровотоком. Попав в мышцы, они способны образовывать капсулу, внутри которой сохраняются до 25 лет.

Мясо с капсулой трихинеллы, попав в желудок, вызывает ее растворение, из которой выходит личинка. Они обитают в отделах тонкой кишки, и уже спустя несколько дней, становятся полностью зрелыми кишечными гельминтами. После акта спаривания, самец умирает, а самка, спустя 5-7 дней рождает личинок (вплоть до 10 000 штук).

Симптомы

Для этой болезни характерна высокая температура тела, понос или рвота. Пораженная свинья быстро теряет массу, у нее отмечаются боли в мышцах.

Лечение

Не возможно. Рекомендовано забить и утилизировать таких свиней.

Профилактика

Основные меры профилактики состоят в санитарно просветительной роботе хозяев животных, и плановые дегельминтизации.

Народные средства

Свиноводство, не новая отрасль сельского хозяйства, и лечением гельминтозов занимались и раньше (во время, когда препараты еще не были в широком обороте как сейчас). Наши предки пользовались некоторыми народными средствами, для борьбы и предотвращения образований паразитов, даже сейчас старые и опытные хозяева изредка возвращаются к тем временам.

Одним из самых популярных является простой чеснок. Суть его применения состоит в добавлении измельченного чеснока в корм свиней. Рассчитывается он  приблизительно в соотношении 1 грамм — на 1 килограмм животного.

Еще одним не менее эффективным средством, является цветок пижмы. Поросятам, которые весят менее 30 килограмм, его давали по 1 чайной ложке вперемешку с кормом.

Небольшое свиноводство: могут ли натуральные средства сравниться с лицензированными лекарствами?

Мелкие свиноводы часто используют натуральные средства в качестве первой линии «лечения». Если у вашей свиноматки небольшой запор, кормление спелым бананом или сочными фруктами (не с кухни) может восстановить ее кишечник. Если у ваших отъемышей диарея, несколько зеленых бананов (опять же, не кухонные отходы) могут помочь им немного связать. Если у кого-то из вашего стада есть то, что может быть вирусной инфекцией, может помочь хороший свежий ананас, содержащий фермент бромелайн, который, как известно, разрушает инфекционные вирусные эпитопы и, как сообщается, обладает противовоспалительными свойствами. Мед местного производства для нанесения на рану, обеспечивающий естественную антисептическую защиту, также часто упоминается для использования человеком для предотвращения инфекций.

Эти домашние средства эффективно лечат этих свиней? Кто знает? И в этом заключается проблема с природными средствами для лечения болезней. За исключением использования меда, нет никаких клинических научных доказательств того, что какой-либо из моих методов работает, а научные доказательства использования меда имеют «низкое качество». Мы чувствуем себя лучше после того, как заметили недомогание и ввели что-то для его «лечения», но на самом деле мы не делаем ничего, кроме того, что снимаем шляпу перед проблемой, и есть вероятность, что, если свинья выздоровеет, она, вероятно, все равно собиралась .

Вышеуказанные обработки - домотканые, а как быть с теми, что продаются в сельхозмагазинах? В соответствии с Положением о ветеринарных лекарственных средствах Великобритании, любой продукт, заявленный как ветеринарный, должен быть лицензирован Управлением ветеринарных лекарственных средств. В США лицензирование продукции контролируют Служба надзора за здоровьем животных и растений (APHIS) и Управление по санитарному надзору за качеством пищевых продуктов и медикаментов (FDA). Лицензированный продукт должен клинически доказать свою эффективность и безопасность для всех видов животных, для использования которых он лицензирован, с использованием надежных клинических испытаний в соответствии с заранее установленными стандартами качества.Аналогичные системы действуют в большинстве развитых стран.

Натуральные лекарственные средства, содержащие заявления о «пищевой добавке или лекарственном средстве», которые не лицензированы, не требуют от производителя каких-либо доказательств или свидетельств эффективности. Они продаются в готовом виде, потому что они не подлежат контролю, и для совершения покупки не требуется ветеринарный врач или лицо с соответствующей квалификацией (SQP). Это не значит, что они опасны для отдельного животного. Если побочные реакции действительно имели место и о них сообщалось, вступают в силу другие законы, чтобы предотвратить продажу. Опасность заключается в том, что люди покупают такие продукты, предполагая, что они выполняют определенную функцию, например, дегельминтизацию, а на самом деле продукт ничего не делает, и уровень паразитов со временем накапливается внутри животного, часто незаметно.

Животноводы могут подумать, что продукт выполняет определенную функцию, используя такие термины, как «научно приготовленный», «улучшает здоровье кишечника» или «эффективная альтернатива», но редко указывается, что это за альтернатива для того, как здоровье улучшилось, или какие научные методы были использованы.Другие утверждения, такие как «органическая система одобрена», не означают, что продукт работает так, как вам кажется. Это просто означает, что он не содержит ингредиентов, противоречащих органическому статусу — очень, очень разные.

Существует множество натуральных продуктов для свиней: диатомовая земля, лечебные травы для кишечника, тыквенные семечки, яблочный уксус, розмарин, активированный уголь, сахар, чесночные хлопья; и есть множество анекдотических свидетельств от животноводов по всему Интернету, которые утверждают, что эти продукты успешно работают. Однако всем им не хватает результатов клинических испытаний, доказывающих эффективность.

В одном опубликованном клиническом исследовании сравнивалась эффективность лицензированного лекарства (группа A), легко покупаемого препарата на основе трав (группа B) и группы, не получавшей лечения (группа C). Зараженных животных случайным образом делили на группы, и каждой группе назначали лечение или отсутствие лечения. Каждый продукт в группах A и B дозировали в соответствии с рекомендациями, указанными в информации о продукте, а затем образцы фекалий от каждого животного исследовали на наличие яиц глистов в течение двухнедельного периода.Результаты, представленные в Таблице 1, ясно показывают эффективность лицензированного лекарства с очень низким количеством обнаруженных яиц глистов. В этом испытании полное отсутствие лечения привело к меньшему количеству яиц фекальных паразитов, чем лечение травяным продуктом.

В настоящее время проводятся научные исследования использования немедицинских продуктов, особенно в свиноводстве и птицеводстве. Использование пробиотиков и пребиотиков, а также подкисление воды — две концепции, изучаемые в качестве инструмента профилактики патогенов, в частности Salmonella у свиней. Salmonella представляет собой серьезную отраслевую проблему, и из-за нарастания устойчивости к противомикробным препаратам и директивы о сокращении использования антибиотиков в настоящее время необходимы многосторонние методологии.

Наилучшим подходом к здоровью свиней остается кормление высококачественным сбалансированным рационом; дегельминтизация; и регулярно вакцинируйте лицензированными препаратами. Также очень важно поддерживать высокие стандарты животноводства и биобезопасности. Если вы хотите использовать меньше продуктов на химической основе для борьбы с паразитами, регулярно проводите подсчет гельминтов в фекалиях ваших свиней и стратегически используйте целевое средство от глистов.

Борьба с диареей поросят с помощью целостного подхода

Диарею поросят можно рассматривать как вызванную одной конкретной причиной, и, следовательно, можно найти лекарство, устранив эту причину. Возможно, имеет смысл взглянуть на проблему диареи у поросят сверху: почему бы не убедиться, что все вокруг свиньи находится в отличном состоянии? В этой статье обсуждаются взгляды со стороны кормов/питания.

Во всем мире растет признание необходимости сокращения потребления антибиотиков в животноводстве.В то же время растет озабоченность по поводу использования терапевтических доз оксида цинка, что разрешено в некоторых странах ЕС. Это требует нового подхода к кормлению поросят с повышенным вниманием как к питательным, так и к непищевым аспектам кормления молодняка, включая усиление иммунологического статуса свиней. Вот почему исследование Датского сельскохозяйственного кооперативного общества (DLG Group) направлено на прекращение профилактического использования антибиотиков, а также на ограничение потребности в лечебных препаратах.

Ограничение диареи при отъеме

Антибиотики могут использоваться для решения проблем пищеварения при отъеме. Применение иногда делается не только в лечебных целях, но и профилактически, подмешивая в воду или корм. Однако существует тенденция и желание еще больше сократить или даже полностью отказаться от использования профилактических антибиотиков. Это касается не только Европейского союза, но и тенденции, которую можно наблюдать во всей Европе.

Оксид цинка (ZnO) в некоторых случаях очень полезен для контроля здоровья кишечника поросят, но он также имеет негативные побочные эффекты.Могут быть взаимодействия с другими питательными веществами, такими как фитазы, другие минералы или изменение вкусовых качеств других веществ.

Традиционно применялись различные стратегии для предотвращения или ограничения диареи при отъеме. К ним относятся использование низкого уровня сырого протеина (и высокое содержание кристаллических аминокислот), органических кислот, пре- и/или пробиотиков и эфирных масел. Поскольку не все незаменимые аминокислоты доступны в кристаллической форме, существует ограничение на то, насколько низко можно снизить уровень белка без ухудшения продуктивности поросят, и оптимизация между уровнем белка и продуктивностью должна выполняться на уровне стада.

Хотя можно сказать, что органические и неорганические кислоты* обычно включаются во все корма для поросят для решения проблем со здоровьем и повышения производительности, существуют некоторые различия между континентами, когда речь идет об остальных типах продуктов. В отраслевом обзоре потребности отрасли из Азии, Европы и Американского континента были единодушно описаны как «контроль диареи поросят» и «способность создавать диеты без антибиотиков».

Понимание механизмов

Помимо сосредоточения внимания на технологическом эффекте добавок, также жизненно важно понимать механизмы, которые определяют пищевое поведение и непитательные эффекты, создаваемые кормами и кормовыми добавками.Эти непитательные эффекты обозначаются разными терминами. Слово «эубиотики» используется для любого соединения или продукта, который работает путем модификации микрофлоры; термин «эпигенетика» относится к тому факту, что некоторые вещества, как было показано, способны повышать или понижать экспрессию определенных генов, поддерживая пищеварительные и иммунологические способности поросят.

Недавняя работа, проведенная в Инновационном центре свиноводства в Стеркселе, Нидерланды, показала, что, несмотря на то, что перед отъемом предлагается вкусный корм для малопородных животных, большая часть поросят еще не начала есть корм, когда наступает время отъема.Время от отъема до первого приема корма было значительно выше у этих «не едоков», что повлияло на продуктивность после отъема.

Из этого следует, что при использовании подходящего высококачественного корма в начальных/престартерных и стартовых кормах опыт показывает, что поросята становятся более крепкими, и их можно кормить более экономичным способом, используя в рационах большое количество соевой муки. для поросят от 15-20 кг.

Предложение кормов после отъема по-прежнему требует высокой точности и качества.

Важна стадия развития кишечника

Использование корма, не адаптированного к стадии развития кишечника свиньи, часто приводит к неинфекционному воспалению и диарее. Исследования показывают, что такой вид физиологического стресса может не только снижать производительность во время воспаления, но также может привести к повышенной восприимчивости свиньи к стрессовым факторам на протяжении всей оставшейся жизни, снижая порог диареи и снижая потенциал продуктивности в течение жизни.

Чтобы лучше понять связь между качеством корма и продуктивностью, метаанализ подтвержденных данных продуктивности более чем 200 датских стад пришел к выводу, что использование кормов премиум-класса приводит к повышению производительности. Кажется, что рынки меняются; общепризнано, что инвестиции в высококачественные корма для молодняка окупаются, чтобы достичь и оптимизировать общую производительность в течение всей жизни. Вероятно, это связано с тем, что предотвращение кишечных заболеваний на ранних этапах жизни может быть связано с более высокими показателями продолжительности жизни.

Оптимизация снабжения белком

Поскольку кишечник маленького поросенка и недавно отнятого от груди поросенка предназначен для переваривания и всасывания белков из молока, источники белка могут быть классифицированы как «изомолочные» белки в зависимости от усвояемости и воздействия желудочно-кишечного тракта. кишечный тракт (ЖКТ). Концентраты соевого белка, полученные в результате ферментации процессов экстракции, концентраты картофельного белка, концентрат плазмы крови и горохового белка являются компонентами, которые можно считать изомолочными белками.

Аминокислоты обладают и другими свойствами, помимо того, что они являются строительными блоками для синтеза белка.Конкретные аминокислоты играют очень важную роль в иммунной функции (метионин), кишечном эпителии и слизистой оболочке, функционировании и обновлении (треонин) и нейротрансмиттерах (триптофан). Когда разрабатываются корма, предназначенные для свиней с инвалидностью, они должны быть составлены с аминокислотным профилем, учитывающим эти свойства.

Свойства минералов

В течение нескольких лет группа Vilofoss накапливала опыт и документацию о преимуществах включения специфических хелатов микроэлементов в корма для поросят.Включение хелатов микроэлементов в количествах, соответствующих максимально разрешенному уровню в ЕС, может быть частью стратегии контроля здоровья кишечника в период после отъема. Полевые испытания показали, что в определенной степени при включении концепции PigOmic производительность может быть увеличена, а воздействие на инфекции E. coli может быть уменьшено. В странах, где терапевтическое использование оксида цинка является законным, PigOmic можно использовать наиболее экономичным способом, заменив введение ZnO.Было показано, что только добавление PigOmic к рациону, без использования профилактического лечения или стимуляторов роста антибиотиков (AGP) или ZnO, снижает воздействие как обычных кишечных палочек, так и типа O149, что приводит к отечной болезни.

Цинк – важный микроэлемент

В конце 1980-х годов несколько исследователей (например, Anders Holm, 1988; Hanne Damgaard Poulsen, 1989) предложили дополнять корм для поросят высоким содержанием цинка из оксида, чтобы уменьшить тяжесть и частоту диареи. возникновение сразу после отъема.С тех пор многие исследования подтвердили положительное влияние на диарею и показатели роста. Добавление ZnO должно осуществляться сразу после отъема и в течение двух недель, чтобы оптимизировать его эффективность с учетом клинических и экологических параметров. Обобщение научных исследований показало улучшение показателей роста на 10–30 % при добавлении в корм для поросят от 1500 до 3000 мг/кг цинка из ZnO.

Для ограничения выбросов цинка в окружающую среду в ряде европейских стран принято ограниченное использование по рецепту.Однако в некоторых случаях это может быть временное разрешение, которое в какой-то момент, вероятно, будет прекращено.

Цинк, превышающий 1000 мг/кг, может вызвать дефицит железа и меди и привести к анемии, если корм не сбалансирован по этим двум микроэлементам. Кроме того, есть данные, что после окончания лечения ZnO баланс микрофлоры резко меняется в последующие недели. Было показано, что использование аминокислотных хелатов цинка улучшает целостность кишечника и повышает производительность всего лишь с 10% терапевтических уровней ZnO.

В связи с уменьшением возможностей использования традиционных противомикробных препаратов для поддержания максимальной продуктивности необходимы более совершенные знания в области управления здоровьем не только вокруг, но и внутри кишечника поросят.

Новые многообещающие результаты исследований

Некоторое время считалось, что рационы поросят должны быть достаточно питательными, чтобы удовлетворять суточные потребности животных в питательных веществах, так как предполагалось, что поросята из-за небольшого объема ЖКТ , имеют низкую кормоемкость. Недавние исследования показали интересные результаты использования определенных фракций клетчатки в качестве альтернативы антибиотикам в кормах. Точная взаимосвязь между клетчаткой, здоровьем и ростом до сих пор полностью не изучена, но некоторые авторы продемонстрировали снижение тяжести диареи после отъема при использовании рационов с высоким содержанием клетчатки, в то время как в других исследованиях клетчатка может повышать восприимчивость свиней к диарее.

Это можно объяснить тем фактом, что существует большое разнообразие клетчатки с очень разными характеристиками (перевариваемыми или неусвояемыми) и отсутствием реальных рекомендаций относительно использования клетчатки в рационах поросят.Ферментируемая клетчатка улучшает здоровье кишечника у поросят: увеличивает содержание короткоцепочечных жирных кислот (КЦЖК), снижает количество патогенов, несмотря на влияние на показатели роста. Тем не менее, с практической точки зрения, включение ферментируемой клетчатки может быть дополнительным фактором риска после отъема, особенно в плохих санитарных условиях. С другой стороны, инертная клетчатка может помочь уменьшить расстройства пищеварения и улучшить показатели роста при отъеме, но необходимо провести дальнейшие исследования, чтобы лучше описать тип клетчатки для лучшего использования в корме для поросят.

Плазма

С технической точки зрения плазма крови является одной из лучших альтернатив антибиотикам. Использование плазмы крови в кормлении поросят увеличивает потребление корма, что является основным моментом сразу после отъема. Плазма крови также является лучшим источником белка, потому что это не только белок для роста, но и функциональный белок (иммуноглобулины), который улучшает иммунитет и, следовательно, состояние здоровья поросят. Исследования показали улучшение показателей роста в среднем на 25% по сравнению с другими источниками белка с высокой усвояемостью, такими как источники белка молока и сои.По мнению некоторых ветеринарных экспертов, плазма крови обладает важным потенциалом для сокращения использования антибиотиков при расстройствах пищеварения поросят за счет снижения диареи и смертности. Они признают, что плазма крови улучшает вкусовые качества корма, скорость роста и здоровье поросят.

Использование плазмы не представляет риска с санитарной точки зрения, если соблюдаются передовые методы (надлежащая производственная практика). Эксперты рекомендуют минимальные требования для производства плазмы.Термическая обработка должна контролироваться с точки зрения температуры и продолжительности, необходимо хранить обработанный продукт не менее семи дней и соблюдать меры гигиены, чтобы избежать повторного загрязнения. Кроме того, происхождение свиной крови регулируется в Европе.

Несмотря на то, что источники белка животного происхождения традиционно использовались для кормления молодняка, в некоторых случаях производители кормов могут быть вынуждены искать альтернативы неживотного происхождения, так как опасения по поводу проблем со здоровьем, связанных с загрязнением, растут.

Программа кормления поросят

Программа Vilofoss для поросят Primefeed использует новейшие знания в области питания до и после отъема, предлагая кормовые решения для поросят с рождения и до момента, когда они переходят на рацион, основанный на соевом шроте (SBM). Самая ранняя диета, которая может быть предложена гигиеничным способом, — это молочный продукт, который включает в себя преимущества дополнительного молока, учит поросят есть сухой корм, тем самым облегчая адаптацию к большему количеству растительных кормов в диапазоне ползучих/престартерных/стартовых кормов. .

Программа предлагает решения для здоровых, высокопродуктивных поросят, которые получают выгоду от высокоусвояемых и богатых питательными веществами рационов, от рационов, разработанных для оптимального роста поросят с более тяжелыми заболеваниями, до рационов для более крепких поросят, где более конкурентоспособная цена требуется. Это означает, что программа предлагает решение по кормлению для всех производителей поросят на любом требуемом уровне, и можно будет найти наиболее рентабельное решение для каждого стада.

* Смеси, используемые при отъеме, должны представлять собой оптимизированную смесь органических и неорганических кислот и содержать не менее 1% включений.

Авторы:
Пьер-Стефан Реви, руководитель исследований, Calcialiment-Vilofoss, и Джейкоб Далл, главный специалист по питанию свиней, Vitfoss-Vilofoss

Рецепты традиционной китайской медицины снижают частоту диареи за счет снятия воспаления толстой кишки и улучшения микробиоты слепой кишки у поросят является основной причиной гибели поросят. XiaoJianZhong (XJZ) и Jingsananli-sepsis (JSS) были двумя рецептами традиционной китайской медицины (TCM) для профилактики и лечения кишечных заболеваний, включая диарею и воспалительные заболевания.Здесь мы исследовали влияние XJZ и JSS на частоту диареи, показатели роста, воспаление толстой кишки и микробиоту слепой кишки у поросят. Всего было отобрано 18 поросят, которые случайным образом были разделены на три группы. Контрольной группе давали основной рацион, а группам TCM1 и TCM2 соответственно давали XJZ и JSS в основном рационе. В обеих группах ТКМ наблюдались снижение частоты диареи, рН толстой или слепой кишки и повышенная кажущаяся усвояемость питательных веществ.

Между тем, оба препарата облегчали воспаление толстой кишки за счет снижения экспрессии мРНК провоспалительных цитокинов и подавления сигнального пути TLR4/MyD88/NF- κ B.Кроме того, предписания TCM1 и TCM2 улучшили состав микробиоты слепой кишки и увеличили количество полезных бактерий, а также отрегулировали несколько генов, которые отвечают за сигнальные пути, участвующие в развитии рака и метаболических заболеваний. Важно отметить, что как TCM1, так и TCM2 значительно повышали среднесуточный привес (ADG) и снижали соотношение корм : привес (F : G). В заключение, оба рецепта ТКМ эффективно снижают частоту диареи и улучшают показатели роста за счет повышения очевидной усвояемости питательных веществ и здоровья кишечника за счет снятия воспаления толстой кишки и улучшения состава микробиоты кишечника поросят.

1. Введение

Общеизвестно, что доращивание поросят является наиболее важным периодом в процессе разведения свиней. Однако у поросят иммунная система кишечника легко нарушается из-за незрелого иммунитета, дефицита пищеварительной способности и кишечных антигенов [1]. При колебаниях внешней среды кишечный иммунитет поросят склонен к нарушениям, приводящим к диарее, которая является одной из основных причин потери массы тела или даже гибели поросят на доращивании [2].В последние годы антибиотики в качестве кормовой добавки использовались для повышения суточного привеса, а также для предотвращения или лечения бактериальной диареи [3]. Однако неправильное использование и злоупотребление антибиотиками привело к образованию остатков антибиотиков и мультиантибиотикорезистентности [4]. Таким образом, необходимо разработать альтернативные методы стимулирования роста или борьбы с диареей поросят.

Традиционная китайская медицина (ТКМ) состоит из производных натуральных растений. Фармацевтическая активность и клинические преимущества этих натуральных ингредиентов были продемонстрированы и подтверждены длительным клиническим применением [5].Несколько активных соединений в ТКМ могут поражать различные мишени и оказывать синергетическое терапевтическое действие [6]. В соответствии с принципами ТКМ, как правило, формулы состоят из нескольких видов лекарственных трав или минералов, в которых один представляет собой основной компонент, а другие служат в качестве вспомогательных средств, усиливающих действие или облегчающих доставку основного компонента [7, 8]. ]. Из-за сложного патогенеза и прогрессирования диареи терапевтический эффект одной травы в клинике может быть скромным [9].Как и классические рецепты ТКМ, рецепт XiaoJianZhong (XJZ) и рецепт Jingsananli-sepsis (JSS) используются для предотвращения и лечения заболеваний пищеварительной системы в течение сотен лет, включая диарею и энтерит, путем улучшения физиологической функции селезенки и желудка [8]. . Однако механизм ранее определенных предписаний ТКМ по улучшению здоровья кишечника и физиологии у поросят не выяснен.

Недавнее исследование показало, что воспалительные повреждения кишечного барьера были основной причиной диареи у поросят [1].Кишечный воспалительный ответ в основном опосредуется сигнальным путем TLR4/MyD88/NF- κ B, который усиливает выработку различных провоспалительных цитокинов (например, IL-1 β , IL-6 и TNF- α ). [10]. С другой стороны, все больше данных подчеркивает кардинальную роль кишечной микробиоты в воспалительном ответе и иммунотерапии [11, 12] из-за их внутренней способности метаболизма лекарств и влияния на метаболический гомеостаз хозяина [13]. Как сообщалось, пищевые аминокислоты (АК) в качестве ингредиента ТКМ рассматриваются как среда для взаимодействия между хозяином и микроорганизмом [14].Между тем микробиота кишечника считалась забытым органом для утилизации растительных ингредиентов. Лю и др. [11] продемонстрировали, что традиционная китайская травяная формула Shen Ling Bai Zhu (некоторые компоненты такие же, как в этом эксперименте, например, Poria , Glycyrrhiza, и Atractylodes ) увеличивает количество полезных бактерий, таких как Bifidobacterium . и Lactobacillus , которые могут прямо или косвенно воздействовать на течение диареи в кишечнике [11].Таким образом, мы предположили, что регулирование состава кишечной микробиоты и облегчение воспаления кишечника с помощью рецептов ТКМ могут быть новой стратегией борьбы с диареей у поросят. Однако влияние всех ранее определенных предписаний ТКМ на воспаление кишечника и кишечную микробиоту у поросят не выяснено.

Таким образом, целью этого исследования было оценить влияние обоих назначений ТКМ в качестве кормовых добавок на показатели роста и диарею у поросят, а также определить, могут ли назначения ТКМ улучшить состояние здоровья толстой кишки за счет ослабления реакции воспаления толстой кишки и регулирования слепой микробиоты.

2. Материалы и методы
2.1. Животные, план эксперимента и соотношения

Это испытание проводилось на Научно-учебной базе Сельскохозяйственного университета Цзянси в течение 60 дней, а план эксперимента был полностью рандомизированным. В соответствии с Шу и соавт. [15], индекс диареи оценивали по фекалиям: 0 — норма; 1 — несформированные окатыши; 2, мягкий кал; 3 – полутвердые, содержащие более половины водообразных фекалий; и 4, водянистые фекалии. Частота диареи рассчитывалась каждый день на основе индекса диареи (индекс диареи ≥3). В общей сложности 18 поросят (17,37 ± 1,32 кг, крупная белая × ландрас × Дюрок) в возрасте 40 дней (отлучение от груди в возрасте 5 недель и 5 дней для адаптации) были случайным образом распределены на три группы в зависимости от массы тела и пола (90–106). n  = 6). Экспериментальная группа включала (а) основной рацион (контроль), (б) основной рацион с добавлением 10 г/кг XJZ (TCM1) или (с) основной рацион с добавлением 3 г/кг JSS (TCM2) соответственно. Доза TCM1 (10 г/кг) и TCM2 (3 г/кг) была оценена на основе наших предварительных тестов и традиционной китайской фармакопеи (2005).Базовые рационы были составлены таким образом, чтобы удовлетворить потребности поросят в питательных веществах (NRC, 2012). Все сырье для TCM1 и TCM2 было предоставлено The Spirit Jinyu Biological Pharmaceutical Co., Ltd (Хух-Хото, Внутренняя Монголия, Китай). Все высушенные китайские травы просеивали через сито с размером ячеек 2,5 мм. Композиция и основные активные составляющие TCM1 и TCM2 представлены в таблице 1.

Имбирь олеосмолу 9015 1
Латинское название Основные активные составляющие Part Содержание (%)

TCM1
кассии прут коричный альдегид сушеные прутик 13
Glycyrrhiza URALENSIS глицирризин сушеный корень 4
Ziziphus Zizyphus ююбы полисахарида сушеные плодоношения 4
Cynanchum otophyllum Paeoniflorin сушеный корень 13
Zingiber лекарственный Роско сушеный корень 6
Rhizoma Atractylodes Высушенный корня 14
Atractylodes Macrocephala Биатрактилолид Высушенный корня 10. 5
Poria cocos Пахимаран Сушеный склероций 10,5
Coptis. Берберин Сушеный корень 4
Мальтоза Мальтоза - 21
Итого 100

TCM2
Непета кошачья L. Nepeta cataria Масло Сушеные стволовых 16,5
Radix Saposhnikoviae хромон гликозид Сушеный корень 16,5
Notopterygium incisum Notopterol Сушеный корень 16,5
корень дудника pubescentis Heraclenin сушеный корень 16,5
Radix Bupleuri сайкосапонина сушеный корень 10
Radix Peucedani Peucedanin Высушенный корня 10
9
Poria Cocos Pachymaran 10 10 9
глицирризин Высушенные корня 4 4
Всего 100

Примечание. Основные активные компоненты традиционной китайской медицины взяты из китайской фармакопеи (2005 г.).

2.2. Сбор образцов и определение значения pH кишечника

Свежие образцы фекалий (200–300   г на образец) собирали на земле в течение последних 3 дней экспериментального периода. В последний день эксперимента все поросята были умерщвлены путем эвтаназии с внутривенной инъекцией пентобарбитала натрия (40 мг/кг·мт). Затем вскрывали брюшную полость для забора проб.Сегменты ткани средней кишки и содержимого средней кишки собирали сразу после эвтаназии, быстро замораживали в жидком азоте и хранили при температуре -80°C для различных анализов. Тем временем используйте мобильный детектор pH (pH-STAR) для измерения значений pH содержимого средней ободочной и средней кишки. Все экспериментальные протоколы были одобрены Комитетом по уходу и использованию экспериментальных животных, Сельскохозяйственный университет Цзянси, Цзянси, Китай.

2.3. Измерение кажущейся усвояемости питательных веществ

Образцы корма и фекалий сушили до постоянного веса при 65°C в течение 72 часов в сушильном шкафу с принудительной подачей воздуха.Обработка образцов фекалий и кормов и измерение сырого протеина (CP), сырого жира (CF), нейтрально-детергентной клетчатки (NDF), кисло-детергентной клетчатки (ADF) и кажущейся усвояемости Ca и P соответствовали описанию в Guo. и другие. [16].

2.4. Определение показателей роста

Регистрировали ежедневное потребление корма и измеряли массу тела поросят натощак в 1-й и 60-й дни экспериментального периода. На основе этих данных рассчитывали среднесуточный привес (СДУ), среднесуточное потребление корма (СДО) и соотношение корм : привес (Ж : Ж).

2.5. Количественная ПЦР в реальном времени

Экспрессия мРНК генов, связанных с воспалением (TLR4, MyD88, NF- κ B, IL-6, IL-8, IL-10 и TNF- α ) в TLR/ Сигнальный путь MyD88/NF- κ B в толстой кишке определяли с помощью количественной ПЦР в реальном времени (qRT-PCR). Тотальную РНК выделяли с использованием реагента TransZol Up Reagent (TransGen Biotech, Пекин, Китай). Вкратце, кДНК синтезировали с использованием набора реагентов TransScript ® One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech, Пекин, Китай) в соответствии с инструкциями к набору.Затем его хранили при -20°C для SYBR Green qRT-PCR. Геноспецифические праймеры всех генов были разработаны с использованием программного обеспечения Primer Premier (PREMIER Biosoft International, CA, USA). В качестве внутреннего эталона использовали ген домашнего хозяйства GAPDH, а последовательности праймеров показаны в таблице 2. Профили RT-qPCR были следующими: 95°C в течение 10 минут, 40 циклов при 95°C в течение 15 секунд, 60°C в течение 60 секунд и удлинение при 95°С в течение 15 секунд.


Задача GenBank, номер Праймеры последовательность (5'-3 ')

GAPDH NM_001206359 F: ACTCACTCTTCCACTTTTGATGCT
R: TGTTGCTGTAGCCAAATTCA
TLR4 NM_001113039. 1 F: GCCATCGCTGCTAACATCATC
Р: CTCATACTCAAAGATACACCATCGG
MyD88 NM_001099923.1 F: TGGTAGTGGTTGTCTCTGATGA
Р: TGGAGAGAGGCTGAGTGCAA
κ NF- B NM_001048232.1 F: CTCGCACAAGGAGACATGAA
Р: ACTCAGCCGGAAGGCATTAT
ИЛ-6 NM_001252429.1 F: TGGCTACTGCCTTCCCTACC
Р: CAGAGATTTTGCCGAGGATG
ИЛ-8 NM_213867.1 F: TTCGATGCCAGTGCATAAATA
Р: CTGTACAACCTTCTGCACCCA
ИЛ-10 HQ026020.1 F: GCTGAAGACCCTCAGGCTGA
Р: GCTGAAGACCCTCAGGCTGA
ФНО- α NM_214022. 1 F: CCAatgggcagahtgggtatg
R: TGAagaggacctgggagtag

Примечание. GAPDH, глицеральдегид-3-фосфатдегидрогеназа; TLR4, толл-подобные рецепторы 4; MyD88, миелоидный фактор дифференцировки 88; NF- κ B, ядерный фактор- κ B; ИЛ-6, интерлейкин-6; ИЛ-8, интерлейкин-8; ИЛ-10, интерлейкин-10; TNF-α, фактор некроза опухоли-α.

2.6. Вестерн-блоттинг

Общий белок экстрагировали буфером для лизиса RIPA (Applygen, Пекин, Китай). Белковый супернатант отделяли с помощью 10% SDS-PAGE и переносили на мембраны PVDF. После блокировки 5%-ным сухим обезжиренным молоком мембрану инкубировали с соответствующими первичными антителами в течение ночи при 4°C, после чего инкубировали с соответствующими вторичными антителами в течение 1 часа при комнатной температуре. Мембраны промывали три раза по 10 минут каждый, инкубировали с хемилюминесцентным субстратом SuperSignal (Pierce) и визуализировали с помощью системы ChemiDoc XRS + Imaging System (Bio-Rad).Блоты были полуколичественно определены с использованием программного обеспечения BandScan. Первичные антитела к NF- κ B p65 (Cell Signaling, 6956, 1 : 1000), фосфо-NF- κ B p65 (Cell Signaling, 3033, 1 : 1000), I κ 7 α B-90 (Cell Signaling, 4814, 1 : 1000) и фосфо-I κ B- α (Cell Signaling, 9246, 1 : 1000) использовали в этом исследовании.

2.7. 16S рРНК MiSeq Секвенирование кишечной микробиоты

Услуги по секвенированию были предоставлены компанией Personal Biotechnology Co., Ltd., Шанхай, Китай. Тотальную ДНК выделяли из образцов содержимого слепой кишки, как сообщалось ранее, с некоторыми модификациями [17]. Участок V3-V4 бактериального гена 16S рРНК амплифицировали с помощью ПЦР, продукты разделяли с помощью гель-электрофореза и очищали с использованием набора для экстракции ДНК из геля AP-GX-500 (Axygen, Corning, USA). Библиотеку создавали из полученных продуктов, а затем секвенировали на платформе для секвенирования MiSeq (Illumina, США), как описано Zhao et al. [18].

2.8. Биоинформатический анализ

Обрезанные и собранные последовательности из каждого образца были сопоставлены с базой данных Greengene 16S rRNA с использованием опции классификации наилучшего совпадения для классификации изобилия таксономии в QIIME [19]. Бактериальные операционные таксономические единицы (OTU) были созданы с использованием функции uclust в QIIME. Диаграмма Венна была создана для сравнения OTU между группами. Следующая статистика была выполнена программным обеспечением R. Для оценки α -разнообразия рассчитывали индексы АСЕ, Чао, Симпсона и Шеннона. Численность и разнообразие OTU ( β -разнообразие) были исследованы с использованием частичного дискриминантного анализа методом наименьших квадратов (PLS-DA) и неметрического многомерного шкалирования (NMDS) в программном обеспечении R.Статистическую значимость разделения между группами оценивали методом линейного дискриминантного анализа (LEfSe), основанным на показателях линейного дискриминантного анализа (LDA), использованных Кертисом Хаттенхауэром (http://huttenhower.sph.harvard.edu/galaxy/). , в котором использовался непараметрический факторный критерий суммы рангов Крускала-Уоллиса и Уилкоксона для определения ключевых OTU для разделения различных групп лечения на уровне значимости 0,05. Микробные функции были предсказаны с помощью PICRUSt, как описано Jiyan et al.[20].

2.9. Статистический анализ

Статистический анализ проводили с использованием программного обеспечения SPSS 17.0 (SPSS Inc., Чикаго, Иллинойс, США). Все результаты выражены в формате среднего ± стандартного отклонения (SD). Сравнения между двумя или несколькими группами были сделаны с помощью теста Стьюдента t или ANOVA. считалось значительным и считалось весьма значительным.

3. Результаты
3.1. Индекс диареи

Диарея является основной причиной снижения выживаемости поросят доращивания.Чтобы определить, может ли ТКМ эффективно предотвращать диарею у поросят, мы рассчитали уровень диареи (рис. 1). После 60 дней лечения обе группы ТКМ значительно снизили частоту диареи у поросят. TCM1 и TCM2 показали значительное снижение частоты диареи по сравнению с контролем (1). Тем не менее, не было существенной разницы между лечением TCM1 и TCM2 ().


3.
2. Значение рН кишечника

Более кислая среда кишечника может препятствовать размножению различных патогенов.Чтобы определить, может ли ТКМ улучшить среду толстой кишки, мы измерили значение рН толстой и слепой кишки. По сравнению с контролем pH толстой и слепой кишки снизился на разных уровнях после вмешательства ТКМ (таблица 3). Кроме того, TCM1 снижал pH толстой кишки и слепой кишки на 7,85% () и 11,54% (), но не было замечено различий в pH толстой кишки в группе TCM2 () по сравнению с контролем. Точно так же pH слепой кишки также чрезвычайно значительно снизился в группе TCM2 ().

144

Группы
Контроль TCM1 TCM2

Clon PH 6.62 ± 0.09 A A
6.10 ± 0.14 B 6. 50 ± 0.21 AB Caecur pH 6.76 ± 0,07 A 5.98 ± 0.10 B 6.17 ± 0,06 B

Примечание . Результаты выражены как среднее ± SD, однофакторный дисперсионный анализ, n  = 6. a,b В пределах строки средние значения без общего верхнего индекса в нижнем регистре различаются при . A,B В пределах строки средние значения без общего верхнего индекса в верхнем регистре различны в .
3.3. Кажущаяся усвояемость питательных веществ

Чтобы оценить, могут ли обе обработки ТКМ улучшить кажущуюся усвояемость у поросят, мы оценили усвояемость CP, CF, NDF, ADF, Ca и P (таблица 4). По сравнению с контролем, TCM1 заметно улучшил видимую усвояемость питательных веществ CP, CF, NDF, ADF, Ca и P на 5,04%, 6,63%, 12,04%, 17,12%, 6,56% () и 6.31% (), соответственно. Точно так же результаты CP, NDF и ADF были повышены на 2,56%, 7,10% () и 13,64% () в группе TCM2, но не наблюдалось существенной разницы в уровнях CF, ADF, Ca и P () .

ABB

товары Группы
Control TCM1 TCM2

CP (%) 74,55 ± 0,34 Aa 78.51 ± 0,61 Бк 76,51 ± 0,30 Ab
CF (%) 73,50 ± 0,67 78,72 ± 0,58 B 74,57 ± 0,66
NDF (%) 53.39 ± 1.03 AA AA 60.70 ± 1.22 BB 5747 ± 0,9 abb
ADF (%) 25,90 ± 0,67 A 31.25 ± 0.62 В 29. 99 ± 0,97 B B B
CA (%) 58.42 ± 0,73 58.42 ± 0,73 A 62,52 ± 0,73 62,52 ± 0,73 B 60.50 ± 0,89 AB
P (%) 48.83 ± 1.00 A 9 52.12 ± 0,75 B 49.26 ± 1,01 A

Примечание . CP, сырой протеин; CF, сырая клетчатка; NDF, нейтральное детергентное волокно; ADF, кислотно-детергентное волокно.Результаты выражены как среднее ± SD, однофакторный дисперсионный анализ, n  = 6. a,b В пределах строки средние значения без общего верхнего индекса в нижнем регистре различаются при . A,B В пределах строки средние значения без общего верхнего индекса в верхнем регистре различны в .
3.4. Показатели роста

Чтобы оценить влияние TCM1 и TCM2 на показатели роста поросят, мы измерили соотношение ADG, ADFI и F : G (таблица 5). По сравнению с контролем ADG был значительно повышен в обеих группах лечения (), тогда как между всеми группами не наблюдалось различий ADFI.Между тем, как TCM1, так и TCM2 значительно снижали соотношение F : G ().


товаров Групп
Control TCM1 TCM2

ADG (кг) 0,52 ± 0,01 0,56 ± 0,03 б 0,56 ± 0,02 б
ADFI (кг) 0,95 ± 0.03 098 ± 0,07 0,98 ± 0,07 1,00 ± 0,05
F: G (кг / кг) 1,85 ± 0,06 A 1,75 ± 0,05 B 1.79 ± 0,03 AB

Примечание . ADG, среднесуточный прирост; ADFI, среднесуточное потребление корма; F : G: подача: усиление. Результаты выражены как среднее ± SD, однофакторный дисперсионный анализ, n  = 6. a,b В пределах строки средние значения без общего верхнего индекса в нижнем регистре различаются при . A,B В пределах строки средние значения без общего верхнего индекса в верхнем регистре различны в .
3.5. Экспрессия мРНК TLR4/MyD88/NF-
κ B Сигнальный путь

Чтобы определить, уменьшилась ли воспалительная реакция толстой кишки после вмешательства ТКМ, мы проанализировали уровни мРНК генов, связанных с воспалением, в TLR4/MyD88/NF-. κ B сигнальный путь. Как показано на рисунке 2, по сравнению с контролем уровень мРНК TLR4 был значительно снижен только в группе TCM1 (), но не было существенной разницы в группе TCM2 ().Примечательно, что экспрессия мРНК MyD88 была значительно снижена в группе TCM1 () и группе TCM2 (). Кроме того, уровни NF- κ B в обеих группах ТКМ были снижены, но только группа ТКМ2 показала статистическую значимость по сравнению с контрольной группой (1).

3.6. экспрессия мРНК генов воспалительных цитокинов

α измеряли (рис. 3).По сравнению с контролем экспрессия IL-6, IL-8 и TNF- α была снижена, тогда как уровни IL-10 были значительно повышены при обоих назначениях ТКМ (или ). Более того, уровни IL-8 и TNF- α были снижены, а уровни IL-10 значительно увеличились (1) в группе TCM1 по сравнению с группой TCM2.

3.7. Уровни белка сигнального пути NF-
κ B в толстой кишке

Для дальнейшего определения ингибирования сигнального пути NF- κ B в толстой кишке после лечения добавками ТКМ, уровни белка NF- κ B p65 , p-NF- κ B p65, I κ B- α и pI κ B- α .По сравнению с контролем, как TCM1, так и TCM2, которые значительно снижали уровни белка NF- κ B p65, p-NF- κ B p65 и pI κ B- α (или ), соответственно (рис. 4), в то время как уровень белка I κ B- α был заметно повышен в группах TCM1 () и TCM2 (). Важно отметить, что как TCM1, так и TCM2 значительно снижали соотношение фосфорилированного белка (p-NF- κ B и p-I κ B- α ) к общему белку ().При этом соотношение p-NF- κ B/NF- κ B и pI κ B- α /I κ B- α в группе TCM2 было значительно выше, чем в группе TCM1. группа.

3.8. Данные о последовательности ДНК микробиоты слепой кишки

Чтобы оценить влияние назначений TCM1 и TCM2 на микрофлору слепой кишки, мы провели секвенирование 16s РНК содержимого слепой кишки поросят. После контроля качества исходной последовательности было получено всего 763938 действительных последовательностей (в среднем 42441 последовательность на образец).Результаты анализа разрежения показали, что такой глубины секвенирования было достаточно для изучения микробного разнообразия каждого образца (рис. 5(а)). Общий анализ OTU, представленный диаграммой Венна, показал, что в контроле было 404 уникальных OTU, 285 в группе TCM1 и 420 в группе TCM2, в то время как во всех выборках было идентифицировано 2130 общих OTU (рис. 5(b)).

3.9.
α - Разнообразие и β - Разнообразие микробиоты слепой кишки

Как показано на рисунке 5(c), индексы Шеннона и Симпсона TCM1 показали более высокое видовое разнообразие, чем контроль, но разница не была значимой ().Индексы ACE и Chao1 как TCM1, так и TCM2 были значительно выше, чем в контрольной группе (1). Между тем, TCM2 значительно повышал () индекс Симпсона по сравнению с контролем.

β -Анализ использовался для сравнения сходства общей структуры сообщества, в котором использовались несколько неконтролируемых многомерных статистических оценок, включая UniFrac NMDS и PLS-DA. Карты разнообразия β показали, что сходство в видовом разнообразии заметно отличалось между обеими группами ТКМ и контрольной группой.Как показано на рисунках 5(d) и 5(e), между TCM1, TCM2 и контрольной группой наблюдалось явное расстояние от флоры слепой кишки поросят. Кроме того, интервал между группами в группах лечения ТКМ был меньше, чем между группами лечения и контрольной группой.

3.10. Ключевое сообщество микробиоты слепой кишки

Показатель LDA (рис. 6(а)) выше 2 указывает на более высокую относительную численность в соответствующей группе, чем в двух других группах (). Относительное обилие значительно отличающихся видов () было показано с помощью таксономической кладограммы LEfSe (рис. 6(b)).Значительно отличающиеся сообщества () принадлежали Cyanobacteria и Actinobacteria при добавлении TCM1. На уровне рода TCM1 показал значительное () селективное обогащение Eubacterium , Bulleidia, и Catenibacterium с показателями LAD 3,31, 3,16 и 2,88 соответственно, а TCM2 продемонстрировал значительное () влияние на Streptococcus и Bifidobacterium с оценкой LAD 4.69 и 3,71 соответственно.

3.11. Регулирование функции микробиома с помощью лечения ТКМ

При сравнении данных секвенирования с базой данных путей KEGG от PICRUSt (рис. 7) было обнаружено, что обе группы ТКМ значительно повышали () количество генов, ответственных за транскрипцию (обработка генетической информации), но подавляли ( или ) гены, участвующие в путях «рака» и «метаболических заболеваний». Между тем, TCM2 также значительно активировал (+) многочисленные гены, ответственные за метаболизм липидов.


4. Обсуждение

Результаты этого исследования показали, что пищевые добавки с обоими рецептами ТКМ могут снижать частоту диареи, способствовать росту, подавлять сигнальные пути TLR4/MyD88/NF- κ B и снижать уровни экспрессия провоспалительных цитокинов в толстой кишке поросят. Соответственно, анализ 16S рРНК показал, что состав и относительная численность полезных бактерий были изменены в обеих группах ТКМ по сравнению с контролем.

В период кормления поросята склонны к дисфункции толстой кишки, что приводит к диарее и отекам, что приводит к нарушению показателей роста или даже к гибели [21, 22]. В предыдущем исследовании сообщалось, что добавление лекарственных растений или их экстрактов увеличивает показатели роста у свиней, главным образом потому, что активный ингредиент может обладать антимикробными свойствами, способствовать снижению рН кишечника и борьбе с диареей, а также улучшать усвояемость питательных веществ [22, 23]. Между тем, снижение значения pH содержимого кишечника может ингибировать или устранять некоторую патогенную флору, чтобы предотвратить диарею за счет улучшения состояния здоровья кишечника у поросят.В этом исследовании оба назначения ТКМ значительно снижали частоту диареи и значение рН толстой или слепой кишки у поросят, что свидетельствует о том, что назначения ТКМ эффективны для контроля диареи, и это может быть связано с тем, что ТКМ способна прямо или косвенно улучшать кишечную среду.

Отлучение от груди или другие стрессы могут отрицательно сказаться на показателях роста поросят из-за снижения ADG и ADFI. В этом исследовании разница в ADFI между всеми группами была незначительной, что может быть связано с тем, что добавки TCM немного изменили вкус корма.Примечательно, что наши результаты показали, что как TCM1, так и TCM2 стимулировали ADG и заметно снижали соотношение F : G, указывая на то, что оба препарата улучшали показатели роста у поросят. Улучшение показателей роста связано с лучшей кишечной средой (кишечный pH) и стимулированием потребления энергии за счет повышения очевидной усвояемости питательных веществ. Между тем, улучшение перистальтики кишечника и кислая среда способствуют увеличению переваривания и всасывания питательных веществ и улучшению усвояемости питательных веществ поросятами, что впоследствии способствует росту [24], что имеет большое значение для поросят с несовершенной пищеварительной системой.Хуанг и др. предположили, что добавки ТКМ увеличивали очевидную усвояемость питательных веществ, таких как сухое вещество рациона, СР и общую энергию у свиней, что согласуется с нашими результатами [24]. Кроме того, наши данные показали, что усвояемость CP, CF, NDF, ADF, Ca и P была увеличена при лечении TCM1, но добавление TCM2 не оказало значительного влияния на поглощение CF, Ca и P, что указывает на то, что TCM1 оказывает большее влияние. комплексное влияние на кажущуюся усвояемость, чем у TCM2. Кроме того, изменения в усвояемости различных питательных веществ также могут быть связаны с уменьшением воспаления кишечника и улучшением микробиоты кишечника, что, скорее всего, связано с TCM1 и TCM2.

Хорошо известно, что разные отделы кишечника выполняют различные физиологические функции. Толстая кишка имеет оптимальные условия для обильного роста бактерий: теплая, влажная, анаэробная, наполненная остатками корма, которые текут с относительно небольшой скоростью. Многие виды патогенов, такие как спирохеты, проходят через тонкую кишку до тех пор, пока в конечном итоге не колонизируются и не размножаются в толстой кишке, что увеличивает риск бактериальной инфекции и воспалительной реакции [25, 26]. Между тем, предыдущее исследование показало, что экспрессия TLR4 и CD14 выше в толстой кишке, чем в кишечнике [27].Таким образом, учитывая самую высокую корреляцию между иммунитетом толстой кишки и сигнальным путем TLR4/MyD88/NF- κ B, мы исследовали экспрессию связанных с воспалением генов и белков в сигнальном пути TLR4/MyD88/NF- κ B, как а также воспалительные цитокины ниже по течению.

Хотя диарея может быть вызвана различными причинами, обычно речь идет о воспалении кишечника. Сигнальный путь TLR4/MyD88/NF- κ B является одним из основных путей, опосредующих воспалительные реакции в кишечнике, которые запускаются рецепторами распознавания образов (PRR) и TLR посредством взаимодействия с антигеном кишечной микробиоты [28].TLR4 необходим для передачи сигналов, опосредованной LPS. После связывания с TLR4 LPS активирует MyD88-зависимый путь, ключевой воспалительный сигнальный путь [29]. Активация MyD88 будет фосфорилировать киназу I κ B, которая, в свою очередь, активирует фактор транскрипции NF- κ B и запускает нижестоящую экспрессию провоспалительных цитокинов наряду с другими иммунными генами [30]. NF- κ B находится вне ядра в своей неактивной форме, связанной с ингибитором I κ B- α .После активации уровни белков NF- κ B p65, p-NF- κ B p65 и pI κ B- α повышались, а уровни I κ B- α были снижены [31]. В этом исследовании оба препарата ТКМ снижали уровень белка NF- κ B p65, p-NF- κ B p65 и pI κ B- α , повышая уровни белка I κ B-0 α 7. уровни белка и значительно снизили отношение фосфорилированного белка (p-NF- κ B p65 и pI κ B- α ) к общему белку, что согласуется с Xu et al.[32], тем самым подтверждая противовоспалительную активность TCM1 и TCM2. Важно отметить, что в группах ТКМ результаты связанных с воспалением генов в сигнальном пути TLR4/MyD88/NF- κ B и NF- κ B p65, p-NF- κ B p65, I κ Уровни белка B- α и pI κ B- α соответствовали более низким уровням воспалительного цитокина, что указывало на то, что ТКМ уменьшала воспаление путем подавления активности TLR4/MyD88/NF- κ B сигнальный путь в толстой кишке.Более того, эти изменения могут быть связаны с вызванным ТКМ улучшением разнообразия или численности кишечной микробиоты [33].

Взаимодействие между микробиотой и хозяином влияет на иммунологический гомеостаз, и изменения в этом взаимодействии связаны с различными воспалительными цитокинами. Предыдущее исследование показало, что назначение ТКМ снижает уровень воспалительных цитокинов, что связано с увеличением количества полезной кишечной микробиоты и снижением уровня ЛПС [34]. Кроме того, некоторые компоненты китайских растительных лекарственных средств проявляют свои фармакологические эффекты посредством взаимодействия с кишечными бактериями [14, 35].Важно отметить, что нарушенная кишечная микробиота, как в разнообразии, так и в изобилии, играет важную роль в патологическом развитии воспалительного заболевания кишечника (ВЗК) [33]. В настоящем исследовании группы ТКМ значительно повысили богатство или разнообразие микробиоты слепой кишки. Также, согласно анализу NMDS и PLS-DA, мы наблюдали значительные структурные изменения микробиоты слепой кишки в группах ТКМ1 и ТКМ2 по сравнению с контролем. Все эти результаты показали, что экспериментальные группы TCM1 и TCM2 демонстрируют разные структуры микробиоты слепой кишки по сравнению с контрольной группой.

Наши результаты показали, что основными типами были Firmicutes , за которыми следовали Bacteroidetes в бактериальных сообществах слепой кишки поросят (рис. 8), что соответствует предыдущему исследованию [35]. Исследование показало, что добавление ТКМ или ее экстрактов может улучшить структуру микробиоты кишечника за счет увеличения количества пробиотиков и уменьшения количества патогенов, что приводит к снижению риска ВЗК [36, 37]. В текущем исследовании TCM1 значительно увеличил количество типов слепой кишки Cyanobacteria и Actinobacteria .Как сообщалось, цианобактерии играют жизненно важную роль в подавлении воспаления путем производства противовоспалительных питиноевых кислот B и C [38]. Между тем, на уровне рода TCM1 увеличил численность Eubacterium , Bulleidia и Catenibacterium соответственно, а численность Streptococcus и Bifidobacterium была повышена в группе TCM2. Кишечные пробиотики могут быть эффективными для вторичной профилактики у пациентов с рецидивирующей диареей, ассоциированной с Clostridium difficile , путем поддержания нормальной желудочно-кишечной флоры [39].Как сообщалось, Bulleidia мог ферментировать глюкозу, а противовоспалительные продукты ацетат, лактат и следовые количества сукцината были конечными продуктами ферментации [40]. Несколько исследований показали, что Eubacterium и Bifidobacteria способны использовать углеводы для производства короткоцепочечных жирных кислот, которые могут ингибировать воспалительные реакции в кишечнике [41, 42]. Также показано, что Bifidobacteria модулируют иммунную систему кишечника и увеличивают выработку иммуноглобулина А [42].По-видимому, увеличение численности этих полезных видов бактерий может быть связано с облегчением воспаления кишечника с помощью лечения ТКМ. И наоборот, кишечные бактерии также могут облегчать воспаление, вызывая улучшение целостности кишечного эпителиального барьера [43]. Кроме того, это также может быть связано с аминокислотами, богатым компонентом ТКМ, таким как аспарагиновая кислота и глутаминовая кислота, которые могут быть доступны для микробиоты в кишечнике у млекопитающих и играть решающую роль в регуляции иммунитета слизистой оболочки кишечника и микробиоты. прямо или косвенно способствуя кишечному гомеостазу [14, 44].


Действительно, кишечная микробиота не только испытывает долгосрочную коэволюцию с хозяином [45], но также регулирует иммунитет хозяина [46]. В частности, образ жизни, диета и прием лекарств в значительной степени способствуют изменению микробиоты кишечника [47]. В текущих исследованиях было обнаружено, что TCM1 и TCM2 в основном состоят из антибактериальных и противоопухолевых активных ингредиентов, таких как эфирное масло, алкалоиды и флавоны. Таким образом, мы исследовали функцию микробиоты на основе предполагаемых метагеномов с использованием алгоритма PICRUSt [48].Наш анализ предполагаемых метагеномов выявил уменьшение числа путей развития заболеваний человека, включая метаболические заболевания и рак, при лечении ТКМ по сравнению с контролем. Это открытие предполагает, что, помимо снижения pH кишечника и подавления воспаления, известно, что увеличение численности полезных видов бактерий после вмешательства ТКМ также оказывает заметное влияние на метаболические заболевания и рак.

5. Заключение

Пищевые добавки с TCM1 и TCM2 эффективно снижают частоту диареи у поросят и способствуют росту за счет улучшения физического состояния кишечника, усвояемости питательных веществ, облегчения воспаления толстой кишки и улучшения микробного состава слепой кишки.Важно отметить, что назначение ТКМ может быть потенциальной терапевтической стратегией при диарее поросят.

Доступность данных

Данные, использованные для поддержки результатов этого исследования, можно получить у соответствующего автора по запросу.

Раскрытие информации

Цзянь Чен и Яцин Мао являются соавторами.

Конфликт интересов

Авторы заявляют об отсутствии конфликта интересов.

Благодарности

Все авторы благодарят всех членов коллектива за помощь в экспериментальном процессе в лаборатории клинической ветеринарной медицины Колледжа зоотехники и технологии сельскохозяйственного университета Цзянси.Эта работа была поддержана крупными научно-исследовательскими проектами провинции Цзянси (20194ABC28008) и компанией Spirit Jinyu Biological Pharmaceutical Co. , Ltd. (Хух-Хото, Внутренняя Монголия, Китай).

Основные причины диареи у свиней – Veterinaria Digital

Среди наиболее важных проблем, связанных с их негативным влиянием на продуктивность и прибыльность свиноводства, являются желудочно-кишечные расстройства, особенно диарея у свиней.

Диарея у свиней является клиническим признаком, присутствующим при многих заболеваниях свиней.Причин много: вовлеченными этиологическими агентами являются бактерии, вирусы и паразиты; также могут присутствовать пищевые факторы.

Типы диареи различаются на разных продуктивных стадиях: диарея новорожденных, диарея после отъема и диарея серого откорма. В промышленном производстве они часто имеют эндемический вид, потому что производители чрезмерно используют антибиотики, которые наносят вред здоровью кишечника и повышают устойчивость бактерий.

В целях сохранения эффективности антибиотиков, важных для медицины человека, Всемирная организация здравоохранения (ВОЗ) призывает ограничить использование антибиотиков только в тех случаях, когда они действительно необходимы, и прекратить их систематическое использование в качестве стимуляторов роста или профилактических мер у животных. .

В соответствии с этими рекомендациями также существует ограничение на использование оксида цинка (противодиарейное средство), поскольку были задокументированы случаи бактериальной резистентности, помимо негативного воздействия, которое он оказывает на окружающую среду. В Европе с 2022 года его использование будет ограничено 150 ppm, что делает необходимым исследование новых альтернатив.

Натуральные растворы, содержащие растительные экстракты (пронутриенты, модуляторы флоры), представляют собой средство, эффективность которого в борьбе с диареей у свиней была доказана заменой оксида цинка и стимуляторов роста.

  1. Причины диареи у свиней

Этот вирус широко распространен в популяциях свиней по всему миру и является основной причиной острого гастроэнтерита у молодых животных. Существует четыре серотипа, поражающих свиней: чаще всего выявляется А, но инфекция также может быть вызвана типами В, С и Е, а в некоторых случаях возникают смешанные инфекции с более чем одним серотипом одновременно.

Вирус передается фекально-оральным путем, заражение приводит к разрушению энтероцитов тонкой кишки.Заболевают в основном кормящие и молодые поросята, как правило, в течение первой недели жизни. Взрослое население на большинстве ферм испытывает 100% сероконверсию и не болеет.

Повреждения, вызванные вирусом в энтероцитах, влияют на всасывание в кишечнике, вызывая водянистую, беловатую и обильную диарею, которая может сопровождаться рвотой, приводя к обезвоживанию, хотя и с низкой смертностью.

Это заболевание вызывается коронавирусом (PEDv), который может поражать любую продуктивную категорию.Наиболее восприимчивы поросята, у которых заболеваемость может достигать 100%, у свиноматок она более вариабельна.

У поросят в возрасте до недели заболевание вызывает симптомы острого пищеварения, рвоту, водянистую и обильную диарею с последующим электролитным дисбалансом и, во многих случаях, смертью. Летальность в этой категории колеблется от 50 до 100%. После этого периода максимальной восприимчивости смертность может снизиться до 10%. Свиньи на откорме имеют признаки, аналогичные признакам у поросят, но менее выраженные, которые самоограничиваются через неделю, что влияет на их продуктивность.

У свиноматок может не быть диареи, у них могут просто проявляться такие симптомы, как слабость и анорексия. В тех случаях, когда они теряют свой помет, они страдают репродуктивными нарушениями, такими как агалактия или поздняя течка, вызванные отсутствием поросят в период лактации.

Острые вспышки ЭДС возникают, когда болезнь впервые попадает на ферму, после чего она может исчезнуть с фермы, остаться в станках для опороса при недостаточной гигиене или сохраняться среди поросят-отъемышей и свиней на откорме, где она продолжает циркулировать, вызывая легкие пост- диарея при отлучении от груди.В этих эндемичных случаях существует риск того, что если поросята будут плохо иммунизированы от свиноматок, возникнет новая вспышка.

  • Трансмиссивный гастроэнтерит (ТГЭ):

Это заболевание, как и ЭДС, вызывается монотипным коронавирусом. Это самый вирулентный энтеровирус, который поражает свиней и может поражать всех возрастов. Практически все поросята, пораженные в течение первой недели жизни, погибают от обезвоживания, и, несмотря на то, что через три недели болезнь становится самокупирующейся, экономические потери высоки.

Вирус у свиней передается перорально и размножается в кишечных ворсинках тонкой кишки, вызывая их разрушение. В результате клиническими признаками являются острая диарея и рвота. Болезнь может сохраняться в станках для опороса в течение трех-четырех недель, пока у свиноматок не выработается достаточный иммунитет для защиты поросят.

Его проявления аналогичны эпидемической диарее свиней, но в этом случае картина обычно менее острая и с меньшей смертностью у поросят-отъемышей.

ТГЭ может стать эндемичным в хозяйствах, не применяющих систему «все-в-все-вне» или имеющих плохие санитарно-гигиенические условия. При этой форме проявления заболевание проявляется легкой диареей в период отъема, с высокой заболеваемостью и низкой смертностью.

  • Диарея, вызванная Escherichia coli, колибактериоз

Колибактериоз является распространенным заболеванием поросят-сосунов и поросят-отъемышей, вызываемым колонизацией тонкого кишечника энтеротоксигенными штаммами Escherichia coli .Эти штаммы E. coli имеют фимбрии или пили, которые позволяют им прикрепляться к эпителию тощей и подвздошной кишки. Патогенные штаммы продуцируют энтеротоксины, вызывающие секрецию жидкости и электролитов в просвет кишечника, что приводит к диарее.

Инфекции

coli возникают в основном на трех уровнях: диарея новорожденных (в первые несколько дней жизни), диарея поросят (после рождения и до отъема) и диарея после отъема (в первые несколько недель после отъема).Эта бактерия может присутствовать в сочетании с другими патогенами, такими как ротавирус.

Диарея у новорожденных поросят может начаться уже через 2-3 часа после заражения. Фекалии могут быть беловатыми, желтоватыми или коричневыми. Тяжелые случаи могут привести к обезвоживанию организма и вызвать смертность более 70%. Чем меньше они заражаются, тем выше этот процент. Диарея может стать геморрагической и вызвать внезапную смерть.

После отъема поросят период часто связан с расстройствами пищеварения, E.coli может заразить их. В этой категории мы можем увидеть такие признаки, как вялость и дезориентация с заметным падением потребления. Однако диарея имеет тенденцию быть менее тяжелой, а смертность низкая, около 10%.

  • Некротический энтерит, вызываемый Clostridium perfringens

Это заболевание всегда является проблемой для свиноматок и их поросят. Ответственным этиологическим агентом является Clostridium perfringens типов A и C. Он обнаружен в почве и кишечнике всех свиней.

Поросята заражаются С. perfringens перорально, с фекалиями свиноматок, обычно в первые дни жизни. Поросята более восприимчивы к энтериту, если они не потребляют достаточного количества молозива.

При наличии необходимых условий у хозяина микроорганизм проходит через энтероциты тощей кишки и вырабатывает экзотоксин, вызывающий некроз структурных компонентов ворсинок.

perfringens типа А может привести к летальному исходу, но вызываемый им энтерит протекает мягче по сравнению с типом С, который более опасен.У свиней типа А обычно наблюдается пастообразный понос, их шерсть может стать жесткой, они обычно выздоравливают, но мы видим влияние на задержку роста.

Картина совершенно иная, когда заболевание вызывается C. perfringens типа C: у поросят диарея с неприятным запахом, часто с кровью, и многие из них быстро умирают. В слабых пометах смертность типа С может достигать 100% и происходить настолько быстро, что происходит в течение нескольких часов, даже до появления признака. Наиболее частое проявление острое.

Болезнь Clostridium difficile характеризуется диареей у новорожденных поросят.Течение болезни настолько быстрое, что они обычно заражаются через несколько часов после рождения и даже рождаются с диареей.

Как и C. perfringens, C. difficile встречается повсеместно, а также присутствует в кишечнике свиней. При благоприятных условиях они размножаются с большой скоростью и выделяют токсины, вызывающие диарею.

  • Пролиферативная энтеропатия или илеит, вызванные Lawsonia intracellularis

Течение заболевания вначале характеризуется пролиферацией незрелых эпителиальных клеток кишечника, которые внутри содержат большое количество Lawsonia intracellularis .Травмы возникают в последних 50 сантиметрах подвздошной кишки и восходящей трети толстой кишки.

Изменения в кишечнике варьируют от отека и гиперемии с утолщением и покраснением слизистой до мозгоподобной слизистой. Картина может ухудшаться вплоть до появления свернувшейся крови в просвете кишки и некротических скоплений в слизистой оболочке.

Поражает свиней на откорме, образуя неоднородные пометы, в которых появляется переменный процент животных с низким весом, большинство из которых страдают хронической серой диареей.

Кокцидиоз является наиболее частой причиной паразитарной диареи у поросят. Появляется с 5 -го -го дня жизни. Наиболее распространенным этиологическим агентом является Cystoisospora suis , для которого характерна желтоватая диарея без запаха. Другими менее распространенными кокцидиями являются представители рода Eimeria и Cryptosporidium .

Традиционные методы лечения сосредоточены на контроле Cystoisospora suis , и наиболее часто используемыми препаратами являются толтразурил, триметоприм-сульфонамид.

Пронутриенты-оптимизаторы кишечника, вводимые перорально поросятам, являются эффективным средством борьбы с кокцидиями.

  1. Традиционные методы лечения и естественные решения диареи у свиней

– Пронутриенты

В естественном состоянии животные инстинктивно потребляют растения, содержащие пронутриенты. Это активные ботанические молекулы, необходимые в небольших количествах для правильного функционирования организма.Пронутриенты следует добавлять в коммерческие корма для улучшения функции органов и повышения устойчивости к инфекциям животных.

Пронутриенты действуют, стимулируя определенные участки ДНК для активации определенных генов, которые не будут экспрессироваться или экспрессия которых будет снижена. Эта стимуляция ДНК, производимая пронутриентами, увеличивает синтез функциональных белков, улучшая физиологию органов-мишеней.

Существуют различные типы пронутриентов. Ниже приведены те, которые применяются для профилактики кишечных заболеваний, возникающих при диарее у свиней.

– Кишечные кондиционеры

Кишечные кондиционеры представляют собой группу пронутриентов, в которых энтероциты являются клетками-мишенями. В небольших количествах они способствуют регенерации и активности этих клеток, таким образом, слизистая оболочка кишечника лучше организована, способствуя усвоению питательных веществ. Увеличение скорости обновления энтероцитов улучшает целостность слизистой оболочки и ограничивает колонизацию патогенными бактериями. Кроме того, клетки обновляются быстрее, что ограничивает колонизацию бактериями.

Как исследования in vitro, так и in vivo показали, что такое увеличение уровня усвоения витаминов и аминокислот улучшает скорость роста и конверсию.

Благодаря своим характеристикам пронутриенты-кондиционеры могут использоваться вместо стимуляторов роста.

– результаты применения пронутриентов в поросятах после отъема

Рисунок 1: Испытание по оценке эффективности пронутриентов кондиционеров по сравнению с оксидом цинка для снижения процента диареи в период после отъема.

– Кишечные оптимизаторы

Пронутриенты, которые действуют как оптимизаторы кишечника, способствуют активности местной иммунной системы в кишечнике, таким образом, клетки местной иммунной системы готовы реагировать на простейшие, такие как Cystoisospora suis и другие патогены, во время их прохождения через кишечник.

 

– Использование оптимизирующих пронутриентов у поросят-сосунов

Рисунок 2: оценивалась эффективность оптимизации пронутриентов по сравнению с толтразурилом.Значительно снизилась смертность групп пронутриентов.

– Модуляторы микробиоты кишечника

На рынке представлены натуральные растворы, способные сбалансировать кишечную флору, ограничить распространение патогенных бактерий и способствовать развитию полезной флоры.

Цименоловое кольцо представляет собой растительный экстракт, используемый в качестве консерванта и кишечного биоцида. Он эффективен против кишечной палочки, сальмонеллы, клостридий и других микроорганизмов, вызывающих диарею.

Модуляция микробиоты, вызванная биоцидным действием цименолового кольца, предотвращает диарею и улучшает продуктивные параметры свиней на разных стадиях роста.

Непрямой метод борьбы с диареей у поросят заключается в воздействии на микробиоту свиноматки. Цименоловое кольцо, вводимое перед опоросом и во время лактации, снижает бактериальную нагрузку материнских фекалий, которые являются основным источником инфекции поросят.

– Производственные параметры и влияние на микробиоту при применении цименолового кольца у поросят-отъемышей

Таблица 1: Наблюдаются результаты, полученные с использованием цименолового кольца, как производственные параметры, так и процент диареи были лучше, чем в контрольной группе. Рисунок 3: соответствует тому же, что и в таблице 1. Был проанализирован тип флоры, присутствующей в кишечнике поросят после отъема, при этом наибольшее количество Lactobacillus наблюдалось в группе, получавшей цименоловое кольцо. Следовательно, это молекула, воздействующая на патогенные микроорганизмы, но безвредная для полезной флоры.
  • Антибиотики-стимуляторы роста

Антибиотики обычно используются для борьбы с бактериальной диареей.

Антибиотические стимуляторы роста (AGP) постоянно используются в субтерапевтических дозах для мониторинга развития бактерий, связанных с диарейными процессами, и стимулирования развития.

Польза AGP хорошо известна, однако остатки, которые они оставляют в мясе, и устойчивость, которую приобретают бактерии, являются причинами, по которым законодательство разных стран запрещает или ограничивает их использование с целью охраны здоровья человека.

Кроме того, Европейский Союз запретил их с 2006 года.

На рынке имеется вакцин E. coli , состоящих из мертвых штаммов, определенных патогенов, специфических антигенов или их комбинации.Также используются вакцины, сочетающие антигены эндотоксина Clostridium perfringens с антигенами E. coli .

Еще один метод иммунизации — аутовакцины. Их можно получить в лаборатории из патогенов, выделенных на той же ферме, где они будут использоваться.

В качестве менее сложного инструмента фермы могут применять систему обратной связи. Это процесс сбора инфекционного материала из фекалий поросят с диареей, который затем разводят и перорально вводят свиноматкам или подсвинкам для их иммунизации.Этот иммунитет передастся их поросятам во время лактации.

Было доказано, что противовирусные вакцины не являются достаточной единственной профилактической мерой. Хотя они существуют для ротавирусов и коронавируса, упомянутых выше, меры биобезопасности, а также контроль вторичных инфекций необходимы для снижения их заболеваемости.

Для повышения эффективности вакцинации на рынке есть натуральные средства. Иммуностимулирующие пронутриенты представляют собой биологически активные молекулы, целью которых является стимуляция специфического и неспецифического иммунитета.Они являются усилителями вакцин и стратегически используются в разные периоды. Их применение показано как для свиноматок, так как они улучшат титр антител в молозиве, так и в сочетании с вакцинацией свиней на любом этапе жизни.

Это соединение широко используется для профилактики диареи у поросят. Добавление в корм в количестве 3000 частей на миллион эффективно для борьбы с вызывающими диарею бактериями, однако необходимо использовать этот ингредиент в больших дозах из-за его низкой биодоступности (22%), что представляет риск для окружающей среды.В результате его использование будет ограничено в Европе до 150 частей на миллион с 2022 года, ограничения, которые вскоре коснутся остального мира.

Другой стратегией борьбы с бактериальной диареей является использование антибиотиков в терапевтических дозах. Их можно вводить парентерально или с пищей в форме пульса.

Несмотря на использование в терапевтических дозах, введение в последовательных циклах приводит к снижению чувствительности бактерий к этим антибиотикам с риском резистентности.

Их использование ограничено во многих странах (например,грамм. Европейский Союз), где необходимо ветеринарное назначение, так как ветеринар должен оценить группу соответствующих животных и решить, оправдано ли лечение антибиотиками.

  1. Выводы

Ветеринары, как медицинские работники, привержены принципам, установленным Всемирной организацией здравоохранения, в которых основное внимание уделяется систематическому сокращению использования антибиотиков. Эта рекомендация направлена ​​на сохранение эффективности антибиотиков для здоровья человека.

На сегодняшний день существуют различные натуральные решения для борьбы с диареей (пронутриенты, цименоловое кольцо), которые позволяют сократить использование антибиотиков и воздействие некоторых добавок на окружающую среду.

Знание наиболее распространенных этиологических агентов диарейных заболеваний позволит нам разработать превентивную стратегию для уменьшения воздействия или установления раннего диагноза и соответствующего лечения.

Что люди, выращивающие свиней, должны знать о гриппе (гриппе)

Введение

Как тот, кто разводит свиней, будь то для шоу (например,грамм. 4-H или Future Farmers of America [FFA]) или в рамках сельскохозяйственной деятельности (например, коммерческого производителя свинины) у вас могут возникнуть вопросы о гриппе (гриппе) как у свиней, так и у людей. В этом документе рассматриваются все, что известно о вирусах гриппа у свиней и людей, а также то, что люди, контактирующие со свиньями, могут сделать, чтобы снизить риск заболевания или заражения своих свиней.

Инфекции вируса гриппа у свиней и людей

Существует множество причин респираторных заболеваний у свиней, включая грипп.Известно, что среди типов гриппа свиней заражают только вирусы гриппа типа А. Большинство вирусов гриппа, циркулирующих у свиней, отличаются от вирусов, циркулирующих у людей. Когда вирусы, которые обычно циркулируют у свиней, заражают людей, их называют «вариантными» вирусами.

В настоящее время среди свиней в США циркулируют три основных вируса гриппа: h2N1, h2N2 и h4N2. Эти вирусы обычно не заражают людей и генетически отличаются от вирусов h2N1 и h4N2, которые обычно циркулируют среди людей. Когда вирусы гриппа, циркулирующие у свиней, сильно отличаются от вирусов человеческого гриппа, вызывающих заболевания у людей, у людей может быть практически отсутствует иммунная защита против вирусов, циркулирующих у свиней. Кроме того, вакцины против человеческого гриппа, вероятно, не обеспечивают защиту от вирусов, обнаруженных у свиней.

Вирусы гриппа обычно поражают свиней и поголовье свиней и могут приводить к высоким показателям заболеваемости среди свиней, но к небольшому числу смертельных исходов.

Признаки гриппа у свиней включают:

  • Кашель («лай»)
  • Чихание
  • Высокая температура
  • Затрудненное дыхание
  • Выделения из носа
  • Отключение подачи

Однако свиньи также могут заразиться вирусами гриппа от людей и от птиц.Это межвидовое распространение и возможное смешивание вирусов гриппа могут привести к появлению новых и очень разных вирусов гриппа, которые могут легко распространяться между людьми.

Вопросы и ответы о гриппе у свиней

В. Как грипп распространяется среди свиней?

A. Считается, что вирусы гриппа распространяются среди свиней так же, как вирусы человеческого гриппа распространяются среди людей. В основном это происходит в результате тесного контакта между инфицированными и неинфицированными свиньями и, возможно, в результате контакта неинфицированной свиньи с объектом, зараженным инфицированной свиньей.Свиньи также могут заразиться вирусами гриппа от тех, кто за ними ухаживает.

В. Можно ли предотвратить заражение свиней вирусом гриппа?

A. Можно снизить риск инфекций у свиней и/или тяжесть заболевания, следуя следующим стратегиям управления:

  • Вакцинация стад
  • Использование хороших мер биобезопасности
  • Соблюдение правил гигиены
  • Вакцинация владельцев свиней вакциной против сезонного гриппа
  • Использование надлежащих систем вентиляции
В.Как насчет вакцин против гриппа для свиней?

A. Вакцины против гриппа для свиней могут помочь, но не на 100%. Иногда используемая вакцина может не защищать от вируса или циркулирующих вирусов. Кроме того, современные вакцины могут быть неэффективны для молодых свиней из-за влияния антител, полученных от свиноматки. Как правило, защита молодых свиней достигается путем вакцинации свиноматок; однако эти материнские антитела не полностью защищают молодых свиней и уменьшаются к тому времени, когда им исполняется 10–13 недель или раньше.Производители могут вакцинировать своих животных после снижения материнских антител.

В. Чем могут помочь ветеринары?

A. Вы должны работать вместе со своим ветеринаром над разработкой стратегий управления, чтобы уменьшить распространение гриппа среди стад и предотвратить занос и распространение вирусов гриппа между свиньями, людьми и птицами.

В. Могут ли люди заразиться гриппом, употребляя в пищу свинину?

A. Не было доказано, что вирусы гриппа свиней передаются людям при употреблении в пищу должным образом обработанной и приготовленной свинины (свинины) или других продуктов, полученных из свиней. Для получения дополнительной информации о надлежащем обращении и приготовлении свинины посетите информационный бюллетень веб-сайта Министерства сельского хозяйства США «Свежая свинина с фермы на стол».

В. Как насчет 2009 h2N1?

A. Вирус гриппа h2N1 2009 года был впервые обнаружен у людей в Соединенных Штатах в апреле 2009 года. Это был новый вирус гриппа среди людей, который мог легко передаваться от человека к человеку, вызвав первую пандемию гриппа в более чем 40 лет. Этот вирус имел два гена вирусов гриппа, которые обычно циркулируют у свиней в Европе и Азии, три гена, которые обычно циркулируют у свиней Северной Америки, а также гены вирусов гриппа птиц и людей.Однако этот конкретный вирус не был обнаружен у свиней в Северной Америке до апреля 2009 года. Вирус гриппа h2N1 2009 года теперь считается вирусом гриппа человека.

В октябре 2009 г. был подтвержден первый случай заражения свиньи вирусом гриппа h2N1 2009 в США. Заражение свиней вирусом гриппа h2N1 2009 г. также было обнаружено в других странах, включая Канаду, Австралию и Аргентину. Министерство сельского хозяйства США и другие исследователи провели исследования на свиньях, которые показали, что вирус h2N1 2009 года вызывал у свиней заболевание, аналогичное другим хорошо известным циркулирующим вирусам свиного гриппа.

В. Насколько распространены вариантные инфекции среди людей?

A. Инфицирование людей вирусами гриппа А, обычно встречающимися у свиней (теперь называемыми вариантными вирусами), является редким явлением, но частота таких обнаружений в последние годы увеличилась. Это может происходить по ряду причин, в том числе: улучшенные лабораторные методы тестирования на эти вирусы в Соединенных Штатах, усиление эпиднадзора за гриппом в Соединенных Штатах или, возможно, увеличение частоты обнаружения вариантных вирусов представляет собой истинное увеличение в ряде таких случаев, возможно, в результате контакта с инфицированными свиньями или в результате последующей ограниченной передачи от человека к человеку.

Грипп может передаваться от свиней к людям и от людей к свиньям

  • Вирусы человеческого гриппа могут инфицировать свиней и могут занести новые вирусы гриппа в популяцию свиней.
  • Вирусы гриппа, которые обычно циркулируют у свиней, могут заразить людей, но это не является обычным явлением.
  • В 2005 и 2006 годах было зарегистрировано три случая заражения людей вирусами гриппа, которые обычно циркулируют у свиней («вариантные вирусы»).
  • Начиная с 2007 года, ежегодно регистрировалось от трех до четырех таких случаев.Это увеличение числа сообщений может быть частично связано с тем, что заражение людей новыми (нечеловеческими) вирусами гриппа в 2007 году стало подлежать уведомлению на национальном уровне. Это означает, что, когда у людей обнаруживается заражение человека нечеловеческим вирусом гриппа, о нем необходимо сообщать федеральным властям. .
  • В 2012 г. в CDC было сообщено о 313 различных случаях, что является самым большим числом случаев, зарегистрированных за один год.
  • Информация об инфекциях, зарегистрированных вариантными вирусами гриппа в США , содержит самую последнюю информацию об инфекциях вариантными вирусами, о которых сообщалось в CDC.
  • Вирусы гриппа, которые обычно распространяются среди людей, отличаются от тех, которые распространяются среди свиней.
  • Люди, которые ежегодно проходят вакцинацию против человеческого гриппа, все же могут заболеть вирусами свиного гриппа.
  • Свиньи, вакцинированные против свиного гриппа, все еще могут заболеть некоторыми вирусами человеческого гриппа.
  • При заражении людей вариантными вирусами гриппа симптомы в основном такие же, как и при заболевании вирусами гриппа человека, и могут включать лихорадку, кашель, ломоту в теле, головные боли, утомляемость и насморк или заложенность носа.Также может быть рвота или диарея.
  • Большинство зарегистрированных случаев заражения человека вариантными вирусами произошло у людей, которые находились рядом с инфицированными свиньями в общественных местах, таких как ярмарки или контактные зоопарки, или непосредственно работали с инфицированными свиньями.
  • Расследование случаев заражения людей вариантными вирусами является обычным делом. Эти исследования предназначены для определения того, распространяется ли рассматриваемый вирус гриппа от человека к человеку. Важно знать, распространяются ли вирусы гриппа, распространенные среди свиней, среди людей, чтобы можно было предотвратить случаи заболевания других людей.

Предотвращение распространения вирусов гриппа между людьми и свиньями

Как и все остальные, зоотехники, ухаживающие за свиньями, должны проходить ежегодную вакцинацию против сезонного гриппа. Хотя вакцинация людей вакциной против сезонного гриппа, вероятно, не защитит от заражения вариантными вирусами гриппа (поскольку они существенно отличаются от вирусов человеческого гриппа А), вакцинация важна для снижения риска передачи вирусов сезонного гриппа А от больных людей другим людям. и к свиньям.Вакцинация против сезонного гриппа также может снизить вероятность коинфицирования людей или свиней как вирусами гриппа человека, так и вирусами гриппа свиней. Считается, что такие двойные инфекции являются источником рекомбинации двух разных вирусов гриппа А, что может привести к появлению нового вируса гриппа А с другой комбинацией генов, что может представлять серьезную проблему для здоровья населения или животных.

Другие рутинные меры:

  • Часто мойте руки с мылом и проточной водой до и после контакта с животными,
  • По возможности избегайте тесного контакта с животными, которые выглядят или ведут себя больными, и
  • Избегайте контакта со свиньями, если у вас есть симптомы гриппа.

Если вам приходится вступать в контакт со свиньями во время болезни, или если вы должны вступать в контакт со свиньями, которые, как известно или подозреваются, инфицированы, или с окружающей их средой, вы должны использовать соответствующие меры защиты (например, носить защитную одежду , перчатки, маски, закрывающие рот и нос, и другие средства индивидуальной защиты) и соблюдайте правила гигиены дыхания и рук.

Если вы или члены вашей семьи заболели гриппоподобными симптомами и нуждаетесь в лечении, выполните следующие действия:

  • Свяжитесь со своим поставщиком медицинских услуг и сообщите ему о ваших симптомах и о том, что вы работаете со свиньями.Ваш врач может назначить лечение противовирусными препаратами против гриппа и может потребовать, чтобы у вас взяли образец из носа и горла для тестирования в отделе здравоохранения вашего штата.
  • Избегайте или ограничьте контакты с членами семьи и другими людьми до тех пор, пока у вас не будет жара в течение 24 часов без использования жаропонижающих препаратов, и избегайте поездок.
  • Соблюдайте правила гигиены органов дыхания и рук. Это включает в себя прикрывание рта и носа салфеткой при кашле или чихании и выбрасывание использованных салфеток в корзину для мусора.Если салфетки недоступны, кашляйте или чихайте в верхнюю часть рукава. Всегда мойте руки после кашля или чихания. Это должно снизить риск распространения вашего вируса среди других.
  • Максимально избегайте или ограничивайте контакты со свиньями. Держитесь подальше от свиней в течение 7 дней после появления симптомов или до тех пор, пока у вас не будет жара в течение 24 часов без использования жаропонижающих препаратов, в зависимости от того, что дольше. (Это необходимо для защиты ваших свиней от болезней.)

Почти все случаи гриппа у людей вызываются вирусами гриппа человека, а не вирусами свиней.Однако, если вы инфицированы вирусом гриппа животного происхождения, отдел здравоохранения захочет поговорить с вами о вашей болезни и убедиться, что другие люди, с которыми вы живете и работаете, не больны тем же вирусом.

ДЕПАРТАМЕНТ ЗДРАВООХРАНЕНИЯ И СОЦИАЛЬНЫХ СЛУЖБ США
Центры по контролю и профилактике заболеваний
Министерство сельского хозяйства США

Национальная информационная служба по болезням животных

Редакционная информация

Автор: Марк Уайт BVSc LLB DPM MRCVS

Отзыв: Марк Уайт BVSc LLB DPM MRCVS 2017

Опубликовано: 2012

Диарея (понос) является одним из наиболее распространенных заболеваний, поражающих молодых поросят до отъема.

Он может варьироваться от легкого до тяжелого, краткосрочного или стойкого, от кремообразного до водянистого, от незначительного до смертельного. Сыпь является клиническим признаком, представляющим собой результат широкого спектра поражений кишечника поросенка, причины которого часто связаны со смесью инфекционных агентов, экологических воздействий, а также влияния питания и содержания.

Функция кишечника поросят

Желудочно-кишечный тракт включает ротовую полость, пищевод (глотку), желудок и кишечник. Каждый компонент имеет определенные функции, но именно при нарушении работы кишечника возникает диарея.Пища, в основном материнское молоко у поросят, предварительно переваривается в желудке перед поступлением в тонкую кишку (SI) для химического расщепления (переваривания) и всасывания. Затем он попадает в толстую кишку (LI), основной функцией которой является реабсорбция воды, прежде чем отходы выводятся в виде фекалий.

Размыв может быть результатом любой из следующих неисправностей:

1. Нарушение предварительного пищеварения в желудке

2. Нарушение переваривания/всасывания в тонком кишечнике, что приводит к попаданию непереваренного пищевого материала в толстый кишечник, где могут размножаться бактерии

3.Излияние избыточной жидкости в тонкую кишку в результате токсинов

4. Отсутствие реабсорбции жидкости в толстой кишке

Таблица 1 содержит краткое описание типов повреждений, которые могут привести к каждой из этих неисправностей.

Таким образом, можно видеть, что диарея является результатом ряда часто взаимодействующих факторов, и всегда необходимо выявлять и корректировать различные нарушения для достижения профилактики и контроля.

Мы обсудим некоторые основные инфекционные агенты позже, но сначала необходимо остановиться на более основных принципах.

 

 

Возможные причины

 

Нарушение функции желудка

Перегрузка (переедание)

Незрелость (например, недоношенные поросята)

Стресс

Проблемы с качеством молока

 

Нарушение пищеварения/всасывания в тонком кишечнике

Снижение кровоснабжения кишечника (озноб)

Перегрузка (переедание)

Повреждения, вызванные бактериальными токсинами (например,грамм. клостридии)

Вирусное поражение кишечника

Паразитарное поражение кишечника (кокцидиоз)

Черви (Strongyloides)

Избыточное излияние жидкости

E. coli и другие бактериальные токсины

 

Неспособность толстой кишки всасывать жидкость

Перегрузка

Снижение кровоснабжения (озноб)

Микробное повреждение из-за избыточного роста (вторичное по отношению к снижению кровоснабжения)

 

 

Таблица 1.Причины нарушения работы кишечника

 

Защита поросят

Поросенок рождается уязвимым для индивидуальных проблем, с которыми он столкнется. Иммунитет не передается через плаценту поросенку, в отличие от человеческих младенцев. Природный способ защитить его от инфекции заключается в том, чтобы свиноматка обеспечила иммунитет через молозиво (предмолочное молоко, поросята), содержащее защитные антитела, которые могут поглощаться поросенком в течение первых двенадцати часов жизни (отсюда необходимость хорошего раннего прикорма). сосать) и может омывать кишечник, не всасываясь в течение многих дней после этого.(Молокозиво также является жизненно важным источником основных питательных веществ в послеродовой период.) 

Охлаждение

Тело имеет встроенный защитный механизм, благодаря которому, когда температура тела падает, кровоснабжение прекращается или сокращается до жизненно важных органов, сохраняя приток крови к жизненно важным структурам, таким как мозг и сердце. Кишечник будет частью этого механизма отключения, и его нормальная способность проталкивать пищу (перистальтика) и поглощать питательные вещества будет нарушена. Это, по существу, позволяет непереваренному материалу пройти вниз в толстую кишку, где бактерии, которые обычно могут жить в равновесии в кишечнике, будут разрастаться на богатом запасе пищи. Неисправность и размыв являются очевидными результатами.

Гигиена

После рождения (а в некоторых случаях и во время прохождения через родовые пути) поросенок подхватывает микробные агенты, которые колонизируют кишечник. Многие из них безвредны и являются частью нормальной и необходимой кишечной флоры, которая требуется свиньям по мере взросления.

Гигиена окружающей среды будет определять количество такого поглощения (это включает как загрязнение вымени, так и помещения), и важно, чтобы все потребляемое поддерживалось в равновесии.Эта полезная колонизация зависит от диапазона загрязняющих веществ (вредных или безвредных), уровней защиты, обеспечиваемой молозивом, количества потребляемых микробов и нормально функционирующего кишечника, предотвращающего избыточный рост. Рутинное введение антибиотиков при рождении может вызвать значительные и длительные нарушения в развитии нормальной микробной популяции кишечника (микробиома)

В коммерческих системах, особенно в помещениях, важна максимальная гигиена, с процедурами «все включено, полностью выключено», мойкой, дезинфекцией и сушкой — предпочтительно с использованием моющих средств в рамках процесса мойки — стандартной практикой. Это не обязательно всегда имеет место в небольших системах, где длительное занятие загонов и т. д. позволяет сбалансированной флоре развиваться в окружающей среде, что обеспечивает новорожденному поросенку правильный баланс и защиту от полезных микробов, которые конкурируют с патогены. Одно из худших действий, которые можно предпринять в такой установке, — попытаться очистить, но не сделать это тщательно — в результате останется загрязнение с нарушенным балансом. Не может быть полумер:

  • Если очистка, дезинфекция и сушка выполняются в соответствии с политикой, они должны выполняться в соответствии с самыми высокими стандартами
  • Если диарея (и другие заболевания поросят) не очевидны, а очистка и дезинфекция обычно не проводятся, оставьте колодец в покое
  • Однако при появлении в системе загрязнений требуется тщательная очистка с обезжириванием, дезинфекцией и сушкой.Дезинфицирующим средствам необходимо оставить достаточное время контакта, чтобы они подействовали, но концентрированные дезинфицирующие средства могут обжечь свиней, и их нельзя оставлять на поверхности пола

Обжорство

Современные свиноматки — даже некоторые из более традиционных пород — могут давать гораздо больше молока, чем нужно поросятам в раннем возрасте. Сильные поросята могут съесть этот запас, что приведет к перегрузке. Это всегда чаще случается с поросятами с самыми большими передними сосками.

Кроме того, по мере того, как поросята растут, предложение увеличивается, и снова может возникнуть переедание, что приводит к тому, что часто называют «молочным поносом» через четырнадцать дней.(Это следует отличать от кокцидиоза.)

Специфические инфекции

(Примечание: клостридиальные выделения см. на семинаре 5, часть 1)

Кишечная палочка

Бактерии E.coli обычно обнаруживаются в кишечнике свиней (и большинства других млекопитающих). Скорость выделения кишечной палочки от свиноматки увеличивается по мере приближения ее к опоросу, и тремя основными источниками инфекции для поросят являются:

  1. Свиноматка
  2. Другие инфицированные и особенно поросята-поросята в том же или других пометах
  3. Окружающая среда

Большинство штаммов кишечной палочки безвредны. Однако существуют штаммы, чрезвычайно вредные для поросят, большинство из которых классифицируются как гемолитическая кишечная палочка (из-за особенностей их роста в лаборатории). Каждый штамм идентифицируется по номеру и, в некоторых случаях, по названию (например, Abbottstown).

Баланс между степенью воздействия поросенка при рождении и иммунитетом, полученным поросенком в результате передачи молозива от матери, будет определять, будет ли наблюдаться заболевание.

Действие этих вредоносных штаммов бактерий заключается в том, что они прилипают к стенке кишечника и производят токсин (яд), который изменяет его функцию таким образом, что происходит излияние жидкости в кишечник, вызывая диарею.

Клинические признаки

Инфекция кишечной палочки новорожденных проявляется в виде обильного водянистого поноса в течение трех дней с тяжелым и быстрым обезвоживанием. Смерть может наступить быстро - у некоторых однопометников еще до того, как понос станет очевидным. Это часто, хотя и не всегда, происходит в целых пометах и, кажется, распространяется от помета к помету в доме. Понос, вызванный кишечной палочкой, может возникать позже в период сосания, часто в сочетании с другими агентами (например, ротавирусом, кокцидиозом).

Рис. 1. Обезвоживание быстро убивает поросят, подвергшихся бичеванию

Э.coli является одним из немногих патогенных агентов, поражающих поросят, которые легко обнаруживаются ректальными мазками.

Рис. 2. Типичная дневная фотография поросенка с неонатальным энтеритом кишечной палочки. Обратите внимание на полный желудок и воспаленный кишечник
Лечение

Отдельные случаи можно лечить соответствующим пероральным антибиотиком, определяемым тестом на чувствительность, проводимым при первых признаках диареи. Во время вспышки может потребоваться стратегическое лечение всех свиней при рождении.Это не должно быть долгосрочным подходом.

Не менее важным в рамках программы лечения является обеспечение электролитами для уменьшения сильного обезвоживания, которое на самом деле убивает многих поросят. Они должны содержаться в чистоте и свежести, а тяжелобольным свиньям активно вводить перорально, например, по шприцу.

Контроль и профилактика

Принципы управления вращаются вокруг:

1. Сокращение распространения инфекции

2. Уменьшение резервуара инфекции

3.Повышение иммунитета свиноматок и поросят

  1. Болезнь распространяется при любом физическом перемещении нечистот между загонами и зданиями. Крайне важно использовать дезинфицирующие ванночки для ног между загонами и комнатами, чтобы они оставались свежими, чистыми и с правильной скоростью разбавления. Борьба с мухами, мышами и т. д. также имеет жизненно важное значение.

Активное перекрестное воспитание поросят не рекомендуется перед лицом вспышки.

  1. Станок для опороса, в котором был заражен предыдущий помет, является резервуаром инфекции, если его тщательно не очистить.Очистка должна включать использование моющих средств для удаления защитной жировой пленки (получаемой из кормов с высоким содержанием жира в период лактации и ползучей пищи), мойка под высоким давлением и дезинфекция с использованием одобренного DEFRA продукта в соответствующей степени разбавления. Чем дольше ручки могут отдыхать между партиями, тем лучше. Фумигация помещений может быть дополнительным методом. Удаление навозной жижи из каналов под планками снижает риск того, что мухи занесут инфекцию обратно на поверхность загона.

Чистота свиноматки также важна.Свиноматку, если она сильно загрязнена, следует вымыть и высушить перед входом в чистый загон, и она не должна проводить слишком много времени в клетке перед опоросом - предпочтительно от 3 до 5 дней. По закону он не может быть больше 7 дней.

На открытом воздухе сжигание старых грядок, перемещение дуг для опороса (где применимо) и избегание лежачих досок помогут контролировать заболевание.

  1. Иммунитет у свиноматки можно повысить с помощью вакцинации, проводимой до опороса, и она очень хорошо защищает поросят в первые три-четыре дня жизни.Вакцинация свиноматок не защитит поросят старше этого возраста.

Рис. 3:    Очистите молодого поросенка.

Удаление вирусов

Ряд вирусов может поражать молодых поросят, вызывая диарею. К ним относятся вирус РРСС, ротавирус, TGE/PED и многие другие. Во всех случаях вирусы повреждают пальцеобразные выступы, которые в норме увеличивают площадь поверхности кишечника (ворсинки), уменьшая площадь переваривания и всасывания. Это позволяет непереваренному материалу проходить через кишечник, перегружая его как питательными веществами, так и жидкостью.Вирусная диарея может возникнуть в очень раннем возрасте – действительно, некоторые свиньи могут рождаться чищеными.

Гигиена и повышение иммунитета свиноматки (см. ниже) являются ключевыми факторами контроля и выживания, а выздоровление поросят может быть достигнуто только путем поддержания гигиены с использованием легкодоступных электролитов (например, Lectade : Elanco), которые могут преодолеть сниженную функцию кишечника.

Рис. 4: Пальцевидные выступы увеличивают площадь поверхности кишечника, способствуя пищеварению и всасыванию. Это повреждения и снижение вирусных инфекций.

Кокцидиоз

Кокцидиоз у свиней вызывается паразитом Isospora suis. Существует ряд других кокцидий (Eimeria sp), часто встречающихся у свиней, но обычно они считаются безвредными, хотя в редких случаях могут вызывать заболевание у молодых взрослых особей.

Паразит имеет прямой жизненный цикл между свиньями (т. е. нет промежуточного хозяина) с ооцистами, выделяемыми инфицированным человеком в окружающую среду, в которой они проходят процесс созревания в зависимости от температуры, прежде чем заразить других животных орально.Затем микроорганизм колонизирует тонкую кишку, развиваясь в несколько стадий и вызывая повреждение кишечника, ведущее к диарее. Этот процесс занимает несколько дней, и поэтому кокцидиоз не возникает в возрасте до пяти дней и чаще всего не наблюдается до десятидневного возраста.

Заболевание встречается во всех типах систем, но всегда связано с нарушением гигиены.

Клинические признаки

Смыв будет наблюдаться во всем помете или его части примерно с 10-дневного возраста.Смыв обычно бывает желтым и кремовым, при тщательном осмотре могут быть обнаружены пятна крови. Смерть при неосложненном кокцидиозе наступает редко, хотя при вовлечении кишечной палочки или ротавируса возможен летальный исход.

Рис. 5: Типичный кремовый кокцидиальный понос

Потеря физического состояния будет очевидна у пораженных особей, и общим последствием будет снижение веса при отъеме (средний вес стада на 25-й день отъема может снизиться на 1 кг на поросенка во время вспышки) и повреждение кишечника при отъеме, которое может вызвать вторичный энтерит после отъема.Снижение веса при отъеме повлияет на общий рост после отъема.

Рис. 6: Кокцидиоз, приводящий к ухудшению состояния и снижению веса при отъеме.

Реакция больного на лечение антибиотиками, как правило, очень плохая, и во многих случаях диарея прекращается спонтанно при отлучении от груди, что позволяет предположить, что повреждение кишечника вызывает непереносимость молока.

Во многих пораженных стадах у одной или двух поросят в помете могут проявляться ранние и легкие признаки диареи в возрасте 7 дней, а остальная часть помета заболевает на 5-7 дней позже, поскольку молодые поросята действуют как генераторы паразит.

Диагностика

Описанная клиническая картина дает четкое указание на роль кокцидий, хотя, поскольку возможна комбинированная инфекция с другими агентами, желательна лабораторная диагностика.

Несмотря на то, что свиноматки-носители и больные поросята выделяют кокцидиальные ооцисты с фекалиями, их очень трудно обнаружить, и даже если они обнаружены, это не обязательно означает, что это является причиной. Единственным надежным методом подтверждения диагноза является умерщвление остро пораженной, нелеченной типичной особи свиньи и исследование кишечника.Макроскопически они могут быть утолщены и воспалены, но для подтверждения необходима гистопатология.

На многих фермах реакция на лечение и контрольные меры используются для подтверждения диагноза.

Управление

Гигиена играет важную роль в борьбе с кокцидозом. Ооцисты, которые выделяются с фекалиями и развиваются в инфекционные стадии в окружающей среде – при температуре выше 16°C – очень устойчивы к обычным дезинфицирующим средствам. Эффективными методами лечения являются огонь (пламенная пушка) и промывка загона известью - в последнем случае известь должна высохнуть в течение 4 дней, прежде чем поголовье будет помещено в обработанный загон.

Утверждается, что некоторые сухие дезинфицирующие средства обладают антикокцидийным действием и могут быть полезными в качестве дополнения к обработке окружающей среды. Тщательное мытье загонов жизненно важно, и проблемы, как правило, хотя и не всегда, возникают в помещениях, где постоянно находятся люди, и на определенных типах полов, где тщательная уборка затруднена (твердый, потрескавшийся бетон, формованные пластиковые планки). Ветеринар может также назначить специфическое антикокцидийное лечение перорально в качестве профилактической меры, но время такого лечения должно быть тщательно продумано и строго соблюдено.

В стаде на открытом воздухе необходимо перемещать дуги между последовательными опоросами, а в случае возникновения проблем следует избегать использования досок. Предоставление лежаков в загонах для опороса увеличивает загрязнение вымени и не должно поощряться (они также будут способствовать оставлению помета в жаркую погоду).

Черви

Редкий червь - Strongyloides ransomi - может заражать поросят внутриутробно или через молозиво/молоко и вызывать диарею у поросят в возрасте двух-трех дней. Чаще всего это происходит у свиноматок, содержащихся на открытом воздухе на постоянно занятой земле, где паразит может накапливаться.

Высокоэффективна глистогонная обработка свиноматок перед опоросом с использованием подготовительного глистовера.

Пара слов об «обратной связи» или контролируемом воздействии

Скармливание зараженного материала и подстилки после эпизода поноса (или даже фекалий свиноматок после опороса) свиноматкам на поздних сроках беременности (никогда не раньше 75 дней беременности) исторически использовалось как метод повышения иммунитета у свиноматок для защиты поросята.

(Скармливание плацентарной ткани и мертвых поросят строго запрещено законодательством. )

При некоторых инфекционных заболеваниях обратная связь может быть единственным способом остановить вспышку (например, при вирусном заболевании, таком как ротавирус), но в некоторых случаях может принести больше вреда, чем пользы (например, при кокцидиозе).

Его не следует использовать рутинно в качестве метода (действительно, это сомнительно законно в соответствии с законодательством о кормах, предназначенным для снижения заражения сальмонеллой), и его следует проводить только под строгим ветеринарным советом.

Заключение

Сыпь обычно наблюдается у молодых поросят.Контроль зависит от внимания со стороны окружающей среды и руководства, диагностики и соответствующей вакцинации или лечения.

(PDF) Полевая оценка некоторых отобранных лекарственных растений для лечения диареи поросят в Гане

Лекарственные растения для лечения диареи поросят

Afr. Дж. Биомед. Рез. Том. 22, №3 (сентябрь) 2019 г. . Opoku-Agyemang et al

ОБСУЖДЕНИЕ

В этом исследовании описана полевая оценка противодиарейного

эффекта водных экстрактов семян Picralima nitida,

и коры стеблей Ficus exasperata и Khaya

senegalЭтот антидиарейный эффект зависел от дозы

в каждом экстракте, как показано в Таблице 1, в которой

выгодно сравнивались со стандартными препаратами Coliprajet, Sulphadimidine

и Enrovet, часто используемыми при лечении состояния в

Гане.

Этот вывод о дозозависимом эффекте P. nitida

дополнительно подтверждает более ранние работы, в которых сообщалось о его

противомикробной активности (Alawa et al., 2012) и противодиарейное

и противовоспалительное действие (Erharuyi et al., 2014).

Аналогичные результаты были также получены с экстрактом Ficus

exasperata, где 10% и 5% концентрации экстракта

ингибировали диарею, сравнимую с таковой, полученной с

70% субъектов, принимавших сульфадимидин.

Антидиарейный эффект экстракта Khaya senegalensis был ограничен

концентрацией 10% из-за некоторых отмеченных побочных эффектов, которые

включали тошноту, рвоту и вялость.Антидиарейный эффект, наблюдаемый у выбранного растения, может быть связан с известным антибактериальным эффектом экстрактов (Makut et al.

2008, Adebayo et al., 2009, Erharuyi et al., 2014). Это

первый отчет об использовании экстракта для лечения диареи у

ветеринарных субъектов. В заключение, это исследование ясно показало

, что Picralima nitida, Ficus exasperata и Khaya

senegalensis, растения могут быть полезны для лечения диареи поросят

, однако широкое клиническое испытание на khaya

senegalensis выявило всю степень следует провести его острую и хроническую

токсичность и провести клиническую оценку эффективных

дозировок для использования в клинической ветеринарной практике.

ССЫЛКИ

Адебайо, Э. А., Ишола, О. Р., Тайво, О. С., Майолагбе, О. Н., и

Адекей, Б. Т. (2009). Оценка метанольного экстракта Ficus

exasperata из коры, листьев и корней для фитохимического анализа и антимикробной активности

, 3(12), 283–287.

Адейза, А.А., Макери, Х.К., и Мохаммед, М. (2010).

Сравнительная трипаноцидная активность воды и метанола in vitro

экстракты трех частей Khaya senegalensis на Trypanosoma evansi,

4(14), 1365–1369.http://doi.org/10.5897/JMPR10. 058

Алава, Дж. П., Джоктан, Г. Э., и Акут, К. (2002). Этноветеринария

Медицинская практика для жвачных в субгумидной зоне северной

Нигерии, 54, 79–90.

Алава, Дж. П., Джоктан, Г. Э., Акут, К., Амонкан, А. К., Ахуи, М.

Л. Б., Конан, А. Б., … Биологические науки, А. (2012). Журнал ветеринарии Пакистана

. Азиатско-тихоокеанский журнал тропической медицины, 2(1), 79–90.

http://doi.org/10.1016/S1995-7645(13)60182-0

Амонкан, А. К., Ахуи, М. Л. Б., Конан, А. Б., Куаку, Л. К.,

Блейере, М. Н., Буафу, М. Г. К., и Кати-кулибали (20000).

Сравнительная оценка Ficus exasperata vahl . Водный экстракт листьев

и спиронолактон на экскрецию с мочой у нормотензивных

крыс. Всемирный журнал фармации и фармацевтических наук 3(2),

825–833.

Ампонсах И.К., Флейшер Т.С., А.к. (2013). Противовоспалительное,

антиоксидантное и противомикробное действие экстракта коры

и

фракций Ficus exasperata Vahl. (Moraceae), 2(3), 38–44.

Anowi, CF, Umanah, U., Emezie, AU, & Utoh-nedosa, AU

(2012). Антидиарейные, спазмолитические и фитохимические свойства

этанольного экстракта листьев фикуса острого, 2(1), 26–32.

Бхандари, С. К., Сюй, Б., Ньячоти, К. М., Гистинг, Д.В., Краузе,

Д.О., Бхандари, С.К.,… Краузе, Д.О. (2008). Оценка

альтернатив антибиотикам с использованием Escherichia coli K88 + модель

диареи поросят: влияние на микробную экологию кишечника. .2006-822

Cam, AJT, & Traditional, AJ (2007). Исследовательская работа, 4(4),

434–442.

Давидови В., Йоксимови М., Стоянови Б. и Рели Р. (2012).

Использование растений для защиты здоровья сельскохозяйственных животных, 28(1), 87–98.

http://doi.org/10.2298/BAh2201087D

Эрхаруйи О., Фалодун А. и Лангер П. (2014). Лекарственное использование,

фитохимия и фармакология Picralima nitida (Apocynaceae

) при тропических болезнях: обзор. Asian Pacific Journal of Tropical

Medicine, 7(1), 1–8. http://doi.org/10.1016/S1995-7645(13)60182-0

Джусс А. и Идакво П. (2009). Оценка полифенольного профиля

и антиоксидантных свойств листьев, стеблей и корневой коры

Khaya senegalensis (Desv.), 5 (май 2004 г.), 80–84.

Ланс, К., Жорж, К., и Браун, Г. (2007). Неэкспериментальная проверка

этноветеринарных растений и местных знаний использовалась

для домашних свиней и кур в Тринидаде и Тобаго, 375–385. (2012). Оценка экстракта Ficus Exasperata.

Кора корня Vahl на антимикробную активность против некоторых штаммов

Клинические изоляты бактерий и грибов Оценка экстракта

декабрь 2015 г.).http://doi.org/10.5923/j.ijmb.20120201.02

Длина, Ф. (2005). Антибактериальный скрининг экстрактов корня, семян и стебля Picralima nitida, 4 (июнь), 522–526.

Длина, Ф. (2008). Фитохимический скрининг и антимикробная

активность спиртовых и метанольных экстрактов листьев и коры

Khaya senegalensis, 7(9), 1216–1219.

Мадек, Ф., Бриду, Н., Буне, С., и Джестин, А. (1998).

Измерение нарушений пищеварения у поросят при отъеме и

связанных с ними факторов риска.

Мадек, Ф., Бриду, Н., Кариоле, Р., Дюваль-и, Ю., и Хэмпсон, Д.

Дж. (2000). Экспериментальные модели колибактериоза свиней после отъема

и их взаимосвязь с диареей после отъема и расстройствами пищеварения

, встречающимися в области ®, 72.

Nabuurs, M. J. A. (2015). Поросята-отъемыши как модель для изучения

патофизиологии диареи.Поросята-отъемыши как модель для изучения

, 2176 (декабрь), 41–45.

http://doi.org/10.1080/01652176.1998.9694967

Ойебанджи, Х., Вара, С., Умар, Р., и Исмаила, М. (2015). Анти-

диарейные и токсикологические свойства экстракта коры стебля Khaya

senegalensis, 4(8), 2997–3015.

Портер, П., Ноукс, Д.Э., и Аллен, В.Д. (1970). Секреторный IgA

и антитела к Escherichia coli в свином молозиве и молоке

и их значение в пищеварительном тракте молодой свиньи.

Управление статистических исследований и информации (SRID), 2010 г.

Факты и цифры, Министерство продовольствия и сельского хозяйства (МИД),

Гана. http://mofa.gov.gh/site/wp-content/uploads/

2011/10/AGRICULTURE-IN-GHANA-FF-2010.pdf

Такин М.С., Аттиндехоу С., Сезан А. и Аттакпа, SE (2013).

Биоактивность, терапевтическое применение и токсикологические риски Khaya

senegalensis, 1(4), 122–129.

Убулом, П.ME, Иманде, Н.Г., Удоби, CE, и Иия, И. (2012).

Ларвицидные и противогрибковые свойства Picralima nitida

(Apocynaceae) Экстракты листьев, 2(2), 132–139.

Вондрускова Х., Сламова Р., Трчкова М., Зрали З. и Павлик,

И. (2010). Альтернативы антибиотикам-стимуляторам роста в профилактике

диареи у поросят-отъемышей: обзор, 2010(5), 199–224.

Юсфзай С.А., Хан Н., Икбал А., Вахаб М. и Сиддики Ф.

(2010). Этноветеринарное исследование Маргазарской долины, 7(3), 273–27

.

Добавить комментарий

Ваш адрес email не будет опубликован.